AJP - Endo Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 295: E1243-E1254, 2008. First published September 16, 2008; doi:10.1152/ajpendo.90415.2008
0193-1849/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
295/5/E1243    most recent
90415.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sangle, G. V.
Right arrow Articles by Shen, G. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sangle, G. V.
Right arrow Articles by Shen, G. X.

TRANSLATIONAL PHYSIOLOGY

Transmembrane signaling pathway mediates oxidized low-density lipoprotein-induced expression of plasminogen activator inhibitor-1 in vascular endothelial cells

Ganesh V. Sangle, Ruozhi Zhao, and Garry X. Shen

Departments of Physiology and Internal Medicine, University of Manitoba, Winnipeg, Manitoba, Canada

Submitted 2 May 2008 ; accepted in final form 9 September 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Atherosclerotic cardiovascular disease is the number one cause of death for adults in Western society. Plasminogen activator inhibitor-1 (PAI-1), the major physiological inhibitor of plasminogen activators, has been implicated in both thrombogenesis and atherogenesis. Previous studies demonstrated that copper-oxidized low-density lipoprotein (C-oLDL) stimulated production of PAI-1 in vascular endothelial cells (EC). The present study examined the involvement of lectin-like oxidized LDL receptor-1 (LOX-1) and Ras/Raf-1/ERK1/2 pathway in the upregulation of PAI-1 in cultured EC induced by oxidized LDLs. The results demonstrated that C-oLDL or FeSO4-oxidized LDL (F-oLDL) increased the expression of PAI-1 or LOX-1 in human umbilical vein EC (HUVEC) or coronary artery EC (HCAEC). Treatment with C-oLDL significantly increased the levels of H-Ras mRNA, protein, and the translocation of H-Ras to membrane fraction in EC. LOX-1 blocking antibody, Ras farnesylation inhibitor (FTI-277), or small interference RNA against H-Ras significantly reduced C-oLDL or LDL-induced expression of H-Ras and PAI-1 in EC. Incubation with C-oLDL or F-oLDL increased the phosphorylation of Raf-1 and ERK1/2 in EC compared with LDL or vehicle. Treatment with Raf-1 inhibitor blocked Raf-1 phosphorylation and the elevation of PAI-1 mRNA level in EC induced by C-oLDL or LDL. Treatment with PD-98059, an ERK1/2 inhibitor, blocked C-oLDL or LDL-induced ERK1/2 phosphorylation or PAI-1 expression in EC. The results suggest that LOX-1, H-Ras, and Raf-1/ERK1/2 are implicated in PAI-1 expression induced by oxidized LDLs or LDL in cultured EC.

oxidized lipoproteins; fibrinolytic inhibitor; lectin-like oxidized low-density lipoprotein receptor-1; H-Ras; Raf-1

ATHEROSCLEROTIC CARDIOVASCULAR DISEASE, particularly coronary artery disease (CAD), is a common cause of morbidity and mortality in Western society. Thrombosis at atherosclerotic lesions is the key underlying mechanism for acute coronary syndrome (31). Imbalance between coagulation and fibrinolysis leads to thrombosis. Plasmin is the key enzyme of the fibrinolytic system. The generation of plasmin is regulated by tissue (tPA) or urokinase plasminogen activator (uPA). Plasminogen activator inhibitor-1 (PAI-1) is the major physiological inhibitor of tPA and uPA (4). Elevated PAI-1 activity in plasma has been considered as a nontraditional risk factor for CAD (45).

Several lines of evidence suggest that an increased level of plasma low-density lipoprotein (LDL) cholesterol constitutes a major modifiable risk factor for CAD. Oxidation of LDL and interactions between oxidized LDL and vascular endothelial cells (EC) are key steps in atherogenesis (42, 43). Previous studies by our group or others demonstrated that copper-oxidized LDL (C-oLDL) is a potent agonist for the production of PAI-1 from cultured human umbilical vein EC (HUVEC) or human coronary artery EC (HCAEC) (28, 35, 36, 46). C-oLDL increased the generation of reactive oxygen species (ROS) and functional activities of multiple antioxidant enzymes in EC (55). Oxidative modification by copper, ultraviolet, or long exposure to EC enhanced the effect of LDL on the generation of PAI-1 from EC (40). PAI-1 has been implicated in inflammation, endothelial dysfunction, and extracellular matrix remodeling (6). Increased levels of PAI-1 protein and mRNA were detected in atherosclerotic or thrombotic lesions in vasculature (3, 52).

Transmembrane signaling pathway for oxidized LDL-induced PAI-1 production in EC remains unclear. Previous studies demonstrated that LDL receptor (LDLR) blocking antibody had no effect on LDL or oxidized LDL-induced PAI-1 release from EC (46). Our previous study indicates that the activation of protein kinase C-β is involved in oxidized LDL-induced PAI-1 overproduction in EC (36). A recent study demonstrated that high glucose-induced PAI-1 expression in EC is mediated via Rho/Rho-kinase and nuclear factor-{kappa}B pathway (21). Lectin-like oxidized LDL receptor-1 (LOX-1) mediates oxidized LDL-induced cellular events in EC (10, 15, 29, 30). The role of LOX-1 in oxidized LDL-induced PAI-1 expression in EC remains unknown.

Small G proteins function as biological switches that modulate signaling between multiple membrane receptors and downstream signal transduction systems (44). Several groups demonstrated close interactions between oxidative stress and H-Ras (16, 27). One of best-characterized downstream effectors of Ras is Raf-1 (48). ROS enhance interactions between H-Ras and several of its downstream effectors, including Raf-1 and ERK1/2 (12, 16). Previous studies demonstrated that LDL increased H-Ras abundance in the membrane fraction of EC (57, 58). The involvement of LOX-1, H-Ras, Raf-1, or ERK1/2 in oxidized LDL-induced PAI-1 expression in EC has not been documented.

The present study examined the roles of LOX-1, H-Ras, and Raf-1/ERK1/2, and interactions between those signaling effectors and activators in oxidized LDL-induced PAI-1 upregulation in cultured vascular EC.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Isolation and modification of lipoproteins. Plasma was freshly separated from blood of healthy donors by centrifugation (2,000 g) for 15 min at 4°C. LDL (density 1.019–1.063) was isolated from plasma using sequential floatation density ultracentrifugation. The modification of C-oLDL was achieved through dialysis against 5 µM CuSO4 for 24 h at 22°C (35), and that of FeSO4-modified LDL (F-oLDL) was generated through dialysis against 6 µM FeSO4 for 24 h at 22°C (49). Free copper or iron ions in oxidized LDLs were removed via dialysis. The oxidation of LDL was confirmed using thiobarbituric acid-reactive substance assay and nondenatured gel electrophoresis. The levels of malondialdehyde in oxidized LDLs were 10-fold greater than that in corresponding batches of LDL. Lipoprotein preparations containing endotoxin levels >0.05 ng/ml measured using E-Toxate kits (Sigma) were excluded from experiments. Lipoproteins were stored in sealed tubes at 4°C in the dark under a layer of nitrogen to prevent autooxidation (35).

Cell culture. Seed HUVEC were obtained from American Type Culture Collection (Manassas, VA). Cells were grown in F-12K medium (Invitrogen) and fed with 10% of fetal bovine serum, 0.1 mg/ml of heparin, and EC growth supplements (Sigma) (37). The initial batch of HCAEC was received from Clonetics (San Diego, CA). EC were used within eight passages from seed cells.

Cell treatment. EC were treated with LDL, F-oLDL, or C-oLDL in dosages and time intervals as indicated. Identical volume of vehicle was added to control cultures for the matching period. Anti-human LOX-1 antibody (a gift from Dr. T. Sawamura, National Cardiovascular Center Research Institute, Osaka, Japan) at 10 µg/ml and LDLR blocking antibody (R & D Systems) at 5 µg/ml were used. Ras farnesylation inhibitor, FTI-277 (10 µM; Calbiochem), Raf-1 inhibitor (1 µM; Calbiochem), or ERK1/2 inhibitor, PD-98059 (10 µM; Sigma), was used. For experiments using blocking antibody or signal transduction inhibitors, 30 min of preincubation was applied. Endothelial cytotoxicity to lipoproteins was determined by cell morphology or leucine incorporation assay (56). No measurable cytotoxicity was detected in EC treated with LDL or oxidized LDLs at experimental conditions.

Western blotting. Western blotting analysis was performed using total cellular lysate, as previously described (37, 56). Targeted proteins were assessed using polyclonal antibodies against LOX-1, LDLR (R & D Systems), H-Ras, phosphorylated (p)Raf-1 (Santa Cruz Biotechnology), pERK1/2, ERK1/2 (Cell Signaling), or monoclonal antibodies PAI-1, β-actin, or nonspecific mouse IgG from Santa Cruz Biotechnology or Sigma. Second antibody conjugated with horseradish peroxidase (Santa Cruz Biotechnology) and enhanced chemiluminence reagents (Amersham) were used to visualize targeted antigens on nitrocellulose membranes. Relative intensities of protein bands were visualized using ChemiDoc system or autoradiography and assessed using Quantity One software (Bio-Rad Laboratories). The protein bands were normalized with internal controls such as β-actin or total ERK1/2 in corresponding samples.

Measurement of hydrogen peroxide. The levels of hydrogen peroxide (H2O2) in postculture media of EC were measured using PeroxiDetect kit from Sigma, as described previously (55).

PAI-1 antigen measurements. The levels of PAI-1 antigen in media of cultured EC were measured using human PAI-1 enzyme-linked immunosorbent assay (ELISA) kits from American Diagnostic, as described previously (13).

RT-PCR. Total RNA was isolated from cultured EC using TRI reagent (MRC), followed by RT-PCR with the use of the Promega kit. The levels of PAI-1 or H-Ras mRNA were examined using RT-PCR. Primers for H-Ras mRNA (sense: 5'-GAATCTCGGCAGGCTCAG-3'; antisense: 5'-CACTCTCATCAGGAGGGTTC-3'), PAI-1 mRNA (sense: 5'-CAGACCAAGAGCCTCTCCAC; antisense: 5'ATCACTTGGCCCATGAAAAG), and β-actin gene (sense: 5'-CGTGGGCCGCCCTAGGCACCA; antisense: 5'-TTGGCCTTAGGGTTCAGGGGGG) were prepared according to reported cDNA sequences (2, 33, 47). PCR for H-Ras comprised 35 cycles: denaturation at 95°C for 15 s, annealing, and extension at 60°C for 1 min. In case of PAI-1 or β-actin, PCR was performed at 95, 60, and 72°C for 1, 2, and 3 min, respectively, with 35 cycles. H-Ras (140 bp), PAI-1 (202 bp), and β-actin (300 bp) mRNA fragments were visualized on 1% agarose gel by use of ethidium bromide. Gels were semiquantified using the ChemiDoc system and Quantity One software. Each specific mRNA band was justified with the intensity of β-actin mRNA.

Detection of translocation of H-Ras. After experimental treatment, HUVEC were harvested by a rubber policeman and homogenized in a Dounce homegenizer. Cellular membrane from cell lysate was separated using Beckman TLX-100 table top ultracentrifugation at 100,000 g at 4°C for 1 h (36, 57). H-Ras expression in membrane fraction was detected using Western blotting and polyclonal antibody against human H-Ras (Santa Cruz Biotechnology).

Gene silence. Small interference RNA (siRNA) targeting H-Ras mRNA was obtained from Santa Cruz Biotechnology. H-Ras siRNA was transfected to EC in serum-free medium using Silence siPort Lipid kit (Ambion), as described previously (56). SiRNA for β-actin or negative control siRNA (Ambion) was transfected in parallel cultures to verify the methodology.

Statistics. Data were expressed as means ± SE and analyzed by one-way ANOVA followed by post hoc Newman-Keuls multiple comparison test for comparisons among multiple groups. The comparisons of probabilities between two groups were done by Student's t-test. The level of significance was defined as P < 0.05.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Effects of oxidized LDLs on cell-associated PAI-1 protein and mRNA. Previous studies from our laboratory demonstrated that C-oLDL significantly increased the release of PAI-1 from HUVEC or HCAEC (36). The present study characterized the effects of C-oLDL (50–150 µg/ml) for 12–48 h on PAI-1 protein and mRNA levels in HUVEC. The maximal increase of PAI-1 protein or mRNA was detected in HUVEC treated with 100 µg/ml of C-oLDL for 24 h (Fig. 1, A–C). Incubation with C-oLDL at 100 µg/ml for 24 h induced a significantly greater increase in cell-associated PAI-1 in HUVEC or HCAEC compared with F-oLDL, a type of oxidized LDL modified by a physiologically relevant condition (49) or unmodified LDL (P < 0.05). The increased expression of cell-associated PAI-1 in HCAEC after LDL, C-oLDL, or F-oLDL treatment was comparable with that in HUVEC (Fig. 1D).


Figure 1
View larger version (22K):
[in this window]
[in a new window]

  		Fig. 1. Dose and time dependence of oxidized LDLs on the plasminogen activator inhibitor-1 (PAI-1) protein or mRNA in human umbilical vein endothelial cells (HUVEC). A and B: HUVEC were treated with 100 µg/ml copper-oxidized LDL (C-oLDL) or vehicle (control) for 12–48 h for measurements of PAI-1 protein (A) and mRNA (B). C: dose response of C-oLDL (50–100 µg/ml) on PAI-1 protein. D: HUVEC or human coronary artery EC (HCAEC) were treated with vehicle, 100 µg/ml LDL, C-oLDL, or FeSO4-modified LDL (F-oLDL) for 24 h. The abundance of PAI-1 and β-actin in total cellular proteins was examined using Western blotting (A, C, and D). The mRNA level of PAI-1 and β-actin was measured using RT-PCR (B). Integrative data were expressed in the %controls after normalization with β-actin (means ± SE; n = 3 experiments). * and **P < 0.05 or 0.01 vs. control; +P < 0.05 vs. LDL; #P < 0.05 vs. F-oLDL.

 
Involvement of LOX-1 in oxidized LDL-induced increase of PAI-1 in EC. The involvement of LOX-1 in oxidized LDL-induced upregulation of PAI-1 in EC was examined using blocking antibody against LOX-1. HUVEC were pretreated with LOX-1 antibody (10 µg/ml) for 30 min and then exposed to C-oLDL or LDL (100 µg/ml) for 24 h. C-oLDL or F-oLDL significantly increased the abundance of LOX-1 in HUVEC or HCAEC compared with vehicle (P < 0.05; Fig. 2A). LOX-1 antibody prevented the effect of C-oLDL on the upregulation of PAI-1 in EC (P < 0.05) and partially inhibited LDL-induced increase of PAI-1 in EC (Fig. 2C). LOX-1 antibody did not change the basal level of PAI-1. The results suggest that LOX-1 is implicated in cross-membrane signaling of oxidized LDL-induced increase of PAI-1 in EC.


Figure 2
View larger version (23K):
[in this window]
[in a new window]

  		Fig. 2. Effects of lectin-like oxidized LDL receptor (LDLR)-1 (LOX-1) and LDLR antibody on oxidized LDLs and LDL-induced increase PAI-1 abundance in EC. A and B: HUVEC or HCAEC were treated with vehicle or 100 µg/ml LDL, C-oLDL, or F-oLDL for 24 h. C: HUVEC were pretreated with LOX-1 blocking antibody (LOX-1 ab) for 30 min at 10 µg/ml and then exposed to 100 µg/ml of LDL or C-oLDL for 24 h. D: HUVEC were pretreated with LDLR blocking antibody (LDLR ab) at 5 µg/ml and then exposed to 100 µg/ml LDL or C-oLDL for 24 h. The expressions of LOX-1, LDLR, PAI-1, or β-actin in cellular proteins were detected by Western blotting. Values are expressed in %controls after normalization with β-actin (means ± SE; n = 3 experiments). * and **P < 0.05 or 0.01 vs. control; + and ++P < 0.05 or 0.01 vs. LDL; #P < 0.05 vs. C-oLDL.

 
The effect of LDLR blocking antibody on LDL- or C-oLDL-induced increase in PAI-1 abundance in EC was examined. HUVEC were pretreated with LDLR blocking antibody (5 µg/ml) for 30 min and then exposed to C-oLDL or LDL (100 µg/ml) for 24 h. LDLR blocking antibody did not significantly affect LDL- or C-oLDL-induced PAI-1 expression in EC (P < 0.05; Fig. 2D). The abundance of LDLR in EC was suppressed by LDL, C-oLDL, or F-oLDL treatment as expected (P < 0.05; Fig. 2B).

Involvement of H-Ras in oxidized LDL-induced PAI-1 production. To determine whether H-Ras is involved in oxidized LDL-induced increase in PAI-1, HUVEC were preincubated with FTI-277 (10 µM), an H-Ras inhibitor, for 30 min and then exposed to 100 µg/ml of LDL or C-oLDL for 24 h. Cell-associated PAI-1, H-Ras, and β-actin were measured using Western blotting, and the levels of PAI-1 antigen were examined in postcultural medium of HUVEC. FTI-277 blocked C-oLDL- or LDL-induced cell-associated PAI-1 in EC (P < 0.05; Fig. 3A). The level of PAI-1 was significantly increased in the media of EC treated with C-oLDL compared with LDL or vehicle. Treatment with FTI-277 prevented C-oLDL- or LDL-induced increase of PAI-1 antigen in the media of EC (P < 0.05; Fig. 3C).


Figure 3
View larger version (20K):
[in this window]
[in a new window]

  		Fig. 3. Involvement of H-Ras in oxidized LDL-induced PAI-1 in EC. A: HUVEC were pretreated with vehicle or FTI-277 (10 µM) for 30 min and then incubated with 100 µg/ml LDL or C-oLDL or vehicle for 24 h. PAI-1 and β-actin in cellular proteins were determined using Western blotting. B: HUVEC were treated with vehicle or 100 µg/ml C-oLDL for 20 min. H-Ras and β-actin in membrane fractions and whole cell lysate were determined by Western blotting. C: HUVEC were treated with FTI-277 and LDL or C-oLDL as described in A. The levels of PAI-1 antigen in the postcultural medium were measured using ELISA assay kits. D: HUVEC were treated with FTI-277 and LDL or C-oLDL as described in A. H-Ras and β-actin in cellular proteins were determined by Western blotting. E: HUVEC were treated with 100 µg/ml LDL, C-oLDL, or vehicle [control (CTL)] for 24 h. The mRNA levels of H-Ras and β-actin were measured using RT-PCR. Values are expressed in %controls after normalization with β-actin (means ± SE; n = 3 experiments). * and **P < 0.05 or 0.01 vs. control; + and ++P < 0.05 or 0.01 vs. LDL; #P < 0.05 vs. C-oLDL.

 
Several studies demonstrated that LDL significantly increased H-Ras abundance in the membrane fraction of EC (57, 58). To explore whether oxidized LDL affects Ras translocation within EC, HUVEC were exposed to C-oLDL (100 µg/ml) for 20 min. H-Ras expression in membrane fraction was significantly increased by C-oLDL compared with control (P < 0.05; Fig. 3B). We did not detect obvious change in H-Ras expression in the whole cell lysate at similar condition. FTI-277 inhibited LDL- or C-oLDL-induced H-Ras expression in HUVEC (P < 0.05; Fig. 3D). To determine the effect of C-oLDL on H-Ras mRNA level, HUVEC were treated with 100 µg/ml of LDL or C-oLDL for 24 h. The level of H-Ras mRNA was significantly increased in EC treated with C-oLDL (P < 0.05; Fig. 3E).

Effect of H-Ras siRNA on oxidized LDL-induced upregulation of PAI-1. The involvement of H-Ras in oxidized LDL-induced upregulation of PAI-1 in EC was verified using siRNAs targeting H-Ras mRNA. H-Ras siRNA blocked C-oLDL- or LDL-induced increases of H-Ras and PAI-1 protein in HUVEC (P < 0.05; Fig. 4). In HUVEC transfected with H-Ras siRNA but without an addition of lipoproteins, the abundance of both H-Ras and PAI-1 was inhibited (P < 0.05). H-Ras siRNA evidently did not affect the abundance of β-actin in EC with or without lipoprotein treatment, and siRNA for β-actin or negative control siRNA evidently did not affect the level of PAI-1 in EC. The results demonstrate that H-Ras is required for oxidized LDL-induced PAI-1 expression in EC.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

  		Fig. 4. Effect of H-Ras small interference RNA (siRNA) on oxidized LDL-induced H-Ras and PAI-1 expression in HUVEC. HUVEC transfected with siRNA against H-Ras gene for 48 h (1st 7 h in serum-free medium and remaining time in the presence of 10% serum) were stimulated with vehicle (CTL) or with an addition of 100 µg/ml LDL or C-oLDL for 24 h. H-Ras, PAI-1, and β-actin in cellular proteins were detected by Western blotting. Values are expressed in %controls after normalization with β-actin (means ± SE; n = 3 experiments). * and **P < 0.05 or 0.01 vs. control; + and ++P < 0.05 or 0.01 vs. LDL; #P < 0.05 vs. C-oLDL.

 
Effect of LOX-1 antibody on oxidized LDL-induced H-Ras expression. To determine relationship between LOX-1 and H-Ras expression induced by oxidized LDL, HUVEC were pretreated with LOX-1 blocking antibody (10 µg/ml) for 30 min and then exposed to 100 µg/ml of C-oLDL or LDL for 24 h. LOX-1 antibody partially, but significantly, inhibited the effect of C-oLDL or LDL on the expression of H-Ras in HUVEC (P < 0.05; Fig. 5). The results demonstrate that activation of LOX-1 is involved in the upregulation of H-Ras in EC induced by oxidized LDL.


Figure 5
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 5. Effect of LOX-1 antibody on oxidized LDL-induced H-Ras expression in EC. HUVEC were pretreated with LOX-1 ab (10 µg/ml) for 30 min and then exposed to 100 µg/ml LDL or C-oLDL for 24 h. H-Ras and β-actin expression in cellular proteins was determined by Western blotting. Values are presented in %control after normalization with β-actin protein (means ± SE; n = 3 experiments). * and **P < 0.05 or 0.01 vs. control; +P < 0.05 vs. LDL; #P < 0.05 vs. C-oLDL.

 
Effects of oxidized LDLs on Raf-1 phosphorylation in EC. Raf-1 is one of the best-characterized downstream effectors of H-Ras involved in the cell signaling pathway. The effects of a physiologically relevant concentration of LDL or C-oLDL (100 µg/ml) (18) on Raf-1 phosphorylation in HUVEC were determined through incubations for 2–120 min. The peak of pRaf-1 was detected in HUVEC treated with C-oLDL for 10 min compared with baseline or LDL at the same condition (P < 0.05). LDL-induced a delayed increase of pRaf-1 expression at 60 min compared with baseline (P < 0.05; Fig. 6A). F-oLDL at 100 µg/ml for 10 min significantly increased Raf-1 phosphorylation in EC compared with control or LDL (P < 0.05; Fig. 6C). HUVEC were preincubated with Raf-1 inhibitor (1 µM) for 30 min and then exposed to 100 µg/ml of C-oLDL for 10 min or LDL for 60 min. Raf-1 phosphorylation induced by C-oLDL or LDL was significantly suppressed by Raf-1 inhibitor (P < 0.05; Fig. 6, B and D). The findings suggest that oxidized LDLs accelerate the phosphorylation of Raf-1 compared with LDL.


Figure 6
View larger version (25K):
[in this window]
[in a new window]

  		Fig. 6. Effect of oxidized LDLs on Raf-1 phosphorylation (pRaf-1) in EC. A: time course of LDL- or C-oLDL-stimulated Raf-1 phosphorylation in HUVEC. HUVEC were treated with 100 µg/ml LDL or C-oLDL for 2–120 min. C: HUVEC or HCAEC were incubated with LDL, C-oLDL, or F-oLDL (100 µg/ml) for 10 min. B and D: HUVEC were pretreated with Raf-1 inhibitor (Raf-1i; 1 µM) for 30 min and then exposed to 100 µg/ml LDL or C-oLDL for 10 min (B) and LDL for 60 min (D). The abundance of pRaf-1 or β-actin in total cellular proteins was analyzed by Western blotting. Values are presented in %controls after normalization with β-actin (means ± SE; n = 3 experiments). * and **P < 0.05 or 0.01 vs. control; + and ++P < 0.05 or 0.01 vs. LDL; #P < 0.05 vs. C-oLDL; xP < 0.05 vs. F-oLDL.

 
Effect of Raf-1 inhibitor on oxidized LDL-induced PAI-1 mRNA. Previous studies from our laboratory demonstrated that C-oLDL significantly increased the steady state of mRNA level of PAI-1 or the release of PAI-1 from EC (32, 36). To determine whether Raf-1 inhibitor affects C-oLDL-induced PAI-1 at mRNA level, HUVEC were preincubated with Raf-1 inhibitor (1 µM) for 30 min and then stimulated with 100 µg/ml of C-oLDL or LDL for 24 h. Raf-1 inhibitor significantly reduced the level of PAI-1 mRNA induced by C-oLDL or LDL (P < 0.05; Fig. 7). The results suggest that Raf-1 activation is required for oxidized LDL or LDL-induced PAI-1 production in EC at mRNA level.


Figure 7
View larger version (18K):
[in this window]
[in a new window]

  		Fig. 7. Involvement of Raf-1 in oxidized LDL-induced PAI-1 mRNA expression in EC. HUVEC were pretreated with vehicle or Raf-1i (1 µM) for 30 min and then exposed to 100 µg/ml LDL, C-oLDL, or vehicle for 24 h. PAI-1 and β-actin mRNA level were measured using RT-PCR. Values are presented in %controls after normalization with β-actin mRNA (means ± SE; n = 3 experiments). * and **P < 0.05 or 0.01 vs. control; + and ++P < 0.05 or 0.01 vs. LDL; #P < 0.05 vs. C-oLDL.

 
Involvement of ERK1/2 in oxidized LDL-induced increase of PAI-1. ERK1/2 is a common downstream signaling effector of Raf-1 and MEK (51). The activation of ERK1/2 was detected in vascular cells treated with oxidized LDL. To examine the time dependence of ERK1/2 activation in EC induced by oxidized LDL, HUVEC were treated with C-oLDL or LDL (100 µg/ml) for 5–120 min. C-oLDL-induced ERK1/2 phosphorylation reached a peak at 20 min. LDL significantly increased ERK1/2 phosphorylation after 60 min of incubation (Fig. 8A). Treatment with F-oLDL increased ERK1/2 phosphorylation in a pattern similar to that of C-oLDL (P < 0.05; Fig. 8B). Treatment with an ERK1/2 inhibitor, PD-98059 (10 µM), blocked LDL- or C-oLDL-induced (100 µg/ml for 24 h) PAI-1 expression in EC (P < 0.05; Fig. 8C). ERK1/2 phosphorylation induced by 100 µg/ml C-oLDL (20 min) or LDL (60 min) was significantly inhibited by PD-98059 (P < 0.05; Fig. 8, D and E).


Figure 8
View larger version (24K):
[in this window]
[in a new window]

  		Fig. 8. Involvement of ERK1/2 phosphorylation in oxidized LDL-induced PAI-1 expression in EC. A: time course of LDL- or C-oLDL-stimulated ERK1/2 phosphorylation in HUVEC. HUVEC were treated with vehicle or 100 µg/ml LDL or C-oLDL for 5–120 min. B: HUVEC or HCAEC were incubated with vehicle, LDL, C-oLDL, or F-oLDL (100 µg/ml) for 20 min. C: HUVEC were pretreated with vehicle or PD-98059 (10 µM) and then exposed to vehicle or 100 µg/ml LDL or C-oLDL for 24 h. PAI-1 and β-actin in cellular proteins were determined by Western blotting. D and E: HUVEC were pretreated with vehicle or PD-98059 (10 µM) and then exposed 100 µg/ml C-oLDL for 20 min or LDL for 60 min. The abundances of pERK1/2 and ERK1/2 in total cellular proteins were analyzed by Western blotting. Values are presented in %controls after normalization with total ERK1/2 or β-actin (means ± SE; n = 3 experiments). * and **P < 0.05 or 0.01 vs. control; + and ++P < 0.05 or 0.01 vs. LDL; #P < 0.05 vs. C-oLDL.

 
Effect of antioxidant on oxidized LDL-induced H2O2 release. Previous studies in our group demonstrated that 80 µmol/l butylated hydroxytoluene (BHT), a potent antioxidant, prevented glycated LDL (glyLDL)-induced generation of H2O2 and PAI-1 in EC (56). The effect of BHT on C-oLDL-induced H2O2 release from HUVEC was examined in the present study. The levels of H2O2 in the postculture medium of EC treated with BHT-C-oLDL were significantly lower than that in cultures treated with C-oLDL without BHT treatment (P < 0.05; Fig. 9).


Figure 9
View larger version (10K):
[in this window]
[in a new window]

  		Fig. 9. Effect of butylated hydroxytoluene (BHT) on oxidized LDL-induced hydrogen peroxide (H2O2) release from EC. Confluent HUVEC were treated with vehicle (CTL), 100 µg/ml C-oLDL, 80 µmol/l BHT, or 100 µg/ml BHT-C-oLDL for 2 h. H2O2 release in media were determined as described in MATERIALS AND METHODS. Values are presented in nmol/106 cells (means ± SE; n = 3 experiments). *P < 0.05 vs. control; #P < 0.05 vs. C-oLDL.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Major novel findings generated from the present study include the following: 1) LOX-1 mediates oxidized LDL-induced PAI-1 expression in cultured vascular EC, 2) the activation and expression of H-Ras are implicated in oxidized LDL-induced PAI-1 upregulation in EC, and 3) increased phosphorylations of Raf-1 and ERK1/2 are required for oxidized LDL-induced expression of PAI-1 in EC.

Several types of membrane receptors are capable of internalizing oxidized LDL, including scavenger receptor (SR)-AI/II, SR-BI, LOX-1, CD36, and macrosialin-CD68 (17). The expressions of both LOX-1 and PAI-1 are increased in atherosclerotic tissues (3, 8, 23, 52). Kakatani et al. (22) reported that LOX-1 antibody reduced arterial thrombus formation in rats. The results of the present study demonstrated that oxidized LDL increased abundance of LOX-1 in vascular EC, which is consistent with a previous report by Sawamura et al. (39) in the same type of cells. The present study originally demonstrated that LOX-1 antibody efficiently blocked oxidized LDL-induced PAI-1 expression. The results suggest that LOX-1 is involved in oxidized LDL-induced PAI-1 expression in cultured vascular EC. The findings suggest a new role of LOX-1 in atherogenic lipoprotein-induced thrombotic process.

The receptor responsible for LDL-induced PAI-1 expression in EC has not been identified. The present study demonstrated that the expression of LDLR was downregulated by LDL, C-oLDL, or F-oLDL, which may reflect a negative feedback of increased intracellular cholesterol, as described previously (7). LDLR antibody failed to prevent LDL or oxidized LDL-induced PAI-1 expression in EC, which is consistent with an earlier report by Tremoli et al. (46). Our previous study demonstrated that treatment of EC with LDL increased lipid peroxidation in LDL, and antioxidants inhibited LDL-induced PAI-1 generation or lipid peroxidation (37). LDL-induced PAI-1 expression in EC may result from EC-mediated oxidation of LDL (37, 40). The present study demonstrated that LOX-1 blocking antibody partially inhibited LDL-induced PAI-1 expression in EC. The findings suggest that increased PAI-1 expression in EC induced by previously unmodified LDL is regulated partially via LOX-1, which is possibly following cell-mediated oxidation of LDL in cultured EC.

Membrane-associated small G proteins, such as Ras and Rho, often mediate the activation of membrane receptors (34, 38). H-Ras is linked closely with oxidative stress (16). H-Ras proteins exist in two interconvertible forms, GDP-bound inactive cytosolic form or GTP-bound active membrane form. By cycling between the two forms, H-Ras mediates various signal transduction pathways that emanate from the activation of membrane receptors. Farnesylation is essential for the translocation of Ras from cytosol to plasma membrane (53). Previous studies by Zhu et al. (57) demonstrated that LDL increased the membrane translocation and activation of H-Ras in human EC. The results of the present study demonstrated that incubation of EC with C-oLDL rapidly increased translocation of H-Ras to cell membrane. Prolonged incubation with C-oLDL significantly increased mRNA level of H-Ras in EC. We further demonstrated that LOX-1 blocking antibody reduced C-oLDL-induced H-Ras expression in EC. Farnesylation inhibitor FTI-277 prevented oxidized LDL-induced PAI-1 expression and release from EC, which was associated with a reduction of the intracellular abundance of H-Ras. H-Ras siRNA effectively inhibited LDL- or C-oLDL-induced upregulation of H-Ras or PAI-1 in EC. The combination of findings suggests that the farnesylation and expression of H-Ras are required for oxidized LDL-induced upregulation of PAI-1 in cultured EC. H-Ras also mediates oxidized LDL-induced PAI-1 expression in other types of cells, such as mesangial cells, as described previously (41). The activation of LOX-1 by oxidized LDL stimulates the activation of H-Ras in EC.

A large body of evidence indicates that intracellular ROS production triggers Ras activation (16, 20, 25). The uptake of oxidized LDL via LOX-1 may increase oxidative stress in EC, which may activate H-Ras. Previous studies by our group and others demonstrated that oxidized LDL induced a quick production of ROS in EC (9, 55). ROS increased interaction between H-Ras and its downstream effectors (12, 16, 25). The present study indicated that BHT, a potent antioxidant, inhibited oxidized LDL-induced H2O2 production in EC. Our recent study demonstrated that BHT inhibited PAI-1 production in EC induced by glyLDL (56) or oxidized LDL (Zhao R, Ma X, and Shen GX, unpublished observation). Relationships between ROS and various cell-signaling effectors related to oxidized LDL-induced PAI-1 production remain to be further investigated in subsequent study. A recent report demonstrated that Rho mediates high-glucose-induced PAI-1 expression in EC (21), which suggests that the upregulation of PAI-1 in EC by metabolic factors may be modulated via different small G proteins.

Numerous lines of evidence demonstrate close links between H-Ras and Raf-1 (25) or other MAP kinases such as ERK, JNK, and p38 kinase (16, 50). Activation of H-Ras recruits Raf-1 from cytosol to cell membrane, leading to the phosphorylation of Raf-1, which in turn phosphorylates and activates MEK and subsequently ERK1/2 (25, 48). Chen et al. (11) reported that increased expression of PAI-1 was associated with elevated phosphorylation of Raf-1 in vascular smooth muscle cells. The present study demonstrated that the phosphorylation of Raf-1 was increased in EC when incubated with C-oLDL or F-oLDL. Raf-1 inhibitor blocked oxidized LDL-induced upregulation of PAI-1 and phosphorylation of Raf-1 in EC. The finding provides new evidence for the modulatory role of Raf-1 in oxidized LDL-induced thrombotic disorders in vasculature.

The present study demonstrated that the phosphorylation of ERK1/2 was rapidly increased in EC exposed to C-oLDL or F-oLDL, which is consistent with previous studies in smooth muscle cells or mesangial cells (26, 19). The results of the present study demonstrated that PD-98059 significantly inhibited oxidized LDL-induced increase in PAI-1 expression, suggesting that the activation of ERK1/2 is required for oxidized LDL-induced PAI-1 expression in EC.

The present study suggests that oxidized LDL increased H-Ras, Raf-1, and ERK1/2 following 10–30 min of incubation. Our previous studies showed that oxidized LDL significantly increased ROS production within 30 min and reached a peak around 2 h (55). Oxidative stress activates heat shock factor-1 (HSF1) (1). GlyLDL or oxidized VLDL (oxVLDL) increased HSF1 expression as early as 2 h and peaked at 6 h. HSF1 mediates oxVLDL- or glyLDL-induced PAI-1 expression in EC through its binding to a homolog of HSF1 in PAI-1 promoter (54, 56). Preliminary studies in our laboratory demonstrated that C-oLDL activated HSF1 in a pattern similar to that of glyLDL or oxVLDL (Zhao R, Ma X, and Shen GX, unpublished data). The results of the present study indicated that oxidized LDL increased the levels of protein and mRNA of PAI-1, which was initiated at 12 h and peaked at 24 h. Oxidized LDL-induced earlier activation of Ras/Raf/ERK may be involved in the regulation of ROS production through an unidentified mechanism, which further activates HSF1 and increases PAI-1 transcription and expression in EC at later time intervals. Previous studies demonstrated that oxidized lipids, which are biologically active components of oxidized LDL, increased LOX-1 expression (24). Oxidized phospholipid-induced monocyte binding to EC was modulated via the activation of cAMP-dependent R-Ras/phosphatidylinositol 3-kinase pathway (14). Oxidized phospholipids also induced inflammatory responses in pulmonary EC through the activation of ERK1/2 cascade (5). Internalized oxidized lipids via LOX-1 potentially contribute to intracellular signaling for the upregulation of PAI-1 in EC. This possibility requires further investigations in subsequent studies.

In summary, the findings of the present study indicate that LOX-1, H-Ras, and Raf-1/ERK1/2 modulate oxidized LDL-induced PAI-1 upregulation in an interactive way in cultured vascular EC. Further studies in atherosclerotic animal models may verify the findings in vivo. Pharmacological interventions on the suggested signaling mediators potentially help to prevent atherogenic lipoprotein-induced intravascular thrombosis.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
The studies were supported by grants from the Heart and Stroke Foundation of Manitoba, Canadian Institutes of Health Research, Canadian Diabetes Association, and the Section of Endocrinology and Metabolism in the Department of Internal Medicine, University of Manitoba. G. V. Sangle was supported by a Studentship Award from the Manitoba Health Research Council.


   ACKNOWLEDGMENTS
 
We thank Dr. R. Bhullar (Faculty of Dentistry, University of Manitoba) for helpful discussion, Dr. T. Sawamura (National Cardiovascular Centre Research Institute, Osaka, Japan) for providing LOX-1 antibody, and the Health Sciences Centre Foundation for providing research space.


   FOOTNOTES
 

Address for reprint requests and other correspondence: G. X. Shen, Diabetes Research Group, Univ. of Manitoba, 835-715 McDermot Ave., Winnipeg, Manitoba R3E 3P4, Canada (e-mail: gshen{at}ms.umanitoba.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ahn SG, Thiele DJ. Redox regulation of mammalian heat shock factor 1 is essential for Hsp gene activation and protection from stress. Genes Dev 17: 516–528, 2003.[Abstract/Free Full Text]
  2. Antalis TM, Clark MA, Barnes T, Lehrbach PR, Devine PL, Schevzov G, Goss NH, Stephens RW, Tolstoshev P. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor. Proc Natl Acad Sci USA 85: 985–989, 1988.[Abstract/Free Full Text]
  3. Arnman V, Nilsson A, Stemme S, Risberg B, Rymo L. Expression of plasminogen activator inhibitor-1 mRNA in healthy, atherosclerotic and thrombotic human arteries and veins. Thromb Res 76: 487–499, 1994.[CrossRef][Web of Science][Medline]
  4. Aso Y. Plasminogen activator inhibitor (PAI)-1 in vascular inflammation and thrombosis. Front Biosci 12: 2957–2966, 2007.[CrossRef][Web of Science][Medline]
  5. Birukov KG, Leitinger N, Bochkov VN, Garcia JG. Signal transduction pathways activated in human pulmonary endothelial cells by OxPAPC, a bioactive component of oxidized lipoproteins. Microvasc Res 67: 18–28, 2004.[CrossRef][Web of Science][Medline]
  6. Brodsky SV, Malinowski K, Golightly M, Jesty J, Goligorsky MS. Plasminogen activator inhibitor-1 promotes formation of endothelial microparticles with procoagulant potential. Circulation 106: 2372–2378, 2002.[Abstract/Free Full Text]
  7. Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science 232: 34–47, 1986.[Free Full Text]
  8. Chen H, Li D, Sawamura T, Inoue K, Mehta JL. Upregulation of LOX-1 expression in aorta of hypercholesterolemic rabbits: modulation by losartan. Biochem Biophys Res Commun 276: 1100–1104, 2000.[CrossRef][Web of Science][Medline]
  9. Chen XP, Xun KL, Wu Q, Zhang TT, Shi JS, Du GH. Oxidized low density lipoprotein receptor-1 mediates oxidized low density lipoprotein-induced apoptosis in human umbilical vein endothelial cells: role of reactive oxygen species. Vascul Pharmacol 47: 1–9, 2007.[CrossRef][Web of Science][Medline]
  10. Chen XP, Zhang TT, Du GH. Lectin-like oxidized low-density lipoprotein receptor-1, a new promising target for the therapy of atherosclerosis? Cardiovasc Drug Rev 25: 146–161, 2007.[CrossRef][Web of Science][Medline]
  11. Chen Y, Budd RC, Kelm RJ Jr, Sobel BE, Schneider DJ. Augmentation of proliferation of vascular smooth muscle cells by plasminogen activator inhibitor type 1. Arterioscler Thromb Vasc Biol 26: 1777–1783, 2006.[Abstract/Free Full Text]
  12. Cheng TH, Shih NL, Chen SY, Loh SH, Cheng PY, Tsai CS, Liu SH, Wang DL, Chen JJ. Reactive oxygen species mediate cyclic strain-induced endothelin-1 gene expression via Ras/Raf/extracellular signal-regulated kinase pathway in endothelial cells. J Mol Cell Cardiol 33: 1805–1814, 2001.[CrossRef][Web of Science][Medline]
  13. Cockell KA, Ren S, Sun J, Angel A, Shen GX. Effect of thrombin on release of plasminogen activator inhibitor-1 from cultured primate arterial smooth muscle cells. Thromb Res 77: 119–131, 1995.[CrossRef][Web of Science][Medline]
  14. Cole AL, Subbanagounder G, Mukhopadhyay S, Berliner JA, Vora DK. Oxidized phospholipid-induced endothelial cell/monocyte interaction is mediated by a cAMP-dependent R-Ras/PI3-kinase pathway. Arterioscler Thromb Vasc Biol 23: 1384–1390, 2003.[Abstract/Free Full Text]
  15. Cominacini L, Pasini AF, Garbin U, Davoli A, Tosetti ML, Campagnola M, Rigoni A, Pastorino AM, Lo Cascio V, Sawamura T. Oxidized low density lipoprotein (ox-LDL) binding to ox-LDL receptor-1 in endothelial cells induces the activation of NF-kappaB through an increased production of intracellular reactive oxygen species. J Biol Chem 275: 12633–12638, 2000.[Abstract/Free Full Text]
  16. Cuda G, Paterno R, Ceravolo R, Candigliota M, Perrotti N, Perticone F, Faniello MC, Schepis F, Ruocco A, Mele E, Cassano S, Bifulco M, Santillo M, Avvedimento EV. Protection of human endothelial cells from oxidative stress: role of Ras-ERK1/2 signaling. Circulation 105: 968–974, 2002.[Abstract/Free Full Text]
  17. Dhaliwal BS, Steinbrecher UP. Scavenger receptors and oxidized low density lipoproteins. Clin Chim Acta 286: 191–205, 1999.[CrossRef][Web of Science][Medline]
  18. Gaziano JM, Manson JE, Ridker PM. Primary and secondary prevention of coronary heart disease. In: Heart Disease: a Textbook of Cardiovascular Medicine, edited by Braunwald E, Zipes DP, and Libby P. Philadelphia, PA: W. B. Saunders, 2001, p. 1040–1065.
  19. Hong HK, Song CY, Kim BC, Lee HS. ERK contributes to the effects of Smad signaling on oxidized LDL-induced PAI-1 expression in human mesangial cells. Transl Res 148: 171–179, 2006.[CrossRef][Web of Science][Medline]
  20. Irani K, Xia Y, Zweier JL, Sollott SJ, Der CJ, Fearon ER, Sundaresan M, Finkel T, Goldschmidt-Clermont PJ. Mitogenic signaling mediated by oxidants in Ras-transformed fibroblasts. Science 275: 1649–1652, 1997.[Abstract/Free Full Text]
  21. Iwasaki H, Okamoto R, Kato S, Konishi K, Mizutani H, Yamada N, Isaka N, Nakano T, Ito M. High glucose induces plasminogen activator inhibitor-1 expression through Rho/Rho-kinase-mediated NF-kappaB activation in bovine aortic endothelial cells. Atherosclerosis 196: 22–28, 2008.[Medline]
  22. Kakatani M, Sawamura T, Chen M. Role of LOX-1 in thrombosis (Abstract). Circulation 102, Suppl II: II 191, 2000.[Abstract/Free Full Text]
  23. Kataoka H, Kume N, Miyamoto S, Minami M, Moriwaki H, Murase T, Sawamura T, Masaki T, Hashimoto N, Kita T. Expression of lectin like oxidized low-density lipoprotein receptor-1 in human atherosclerotic lesions. Circulation 99: 3110–3117, 1999.[Abstract/Free Full Text]
  24. Kelly KJ, Wu P, Patterson CE, Temm C, Dominguez JH. LOX-1 and inflammation: a new mechanism for renal injury in obesity and diabetes. Am J Physiol Renal Physiol 294: F1136–F1145, 2008.[Abstract/Free Full Text]
  25. Kowluru RA, Kowluru A, Chakrabarti S, Khan Z. Potential contributory role of H-Ras, a small G-protein, in the development of retinopathy in diabetic rats. Diabetes 53: 775–783, 2004.[Abstract/Free Full Text]
  26. Kusuhara M, Chait A, Cader A, Berk BC. Oxidized LDL stimulates mitogen-activated protein kinases in smooth muscle cells and macrophages. Arterioscler Thromb Vasc Biol 17: 141–148, 1997.[Abstract/Free Full Text]
  27. Lander HM, Milbank AJ, Tauras JM, Hajjar DP, Hempstead BL, Schwartz GD, Kraemer RT, Mirza UA, Chait BT, Burk SC, Quilliam LA. Redox regulation of cell signalling. Nature 381: 380–381, 1996.[CrossRef][Web of Science][Medline]
  28. Latron Y, Chautan M, Anfosso F, Alessi MC, Nalbone G, Lafont H, Juhan-Vague I. Stimulating effect of oxidized low density lipoproteins on plasminogen activator inhibitor-1 synthesis by endothelial cells. Arterioscler Thromb 11: 1821–1829, 1991.[Abstract/Free Full Text]
  29. Li D, Liu L, Chen H, Sawamura T, Ranganathan S, Mehta JL. LOX-1 mediates oxidized low-density lipoprotein-induced expression of matrix metalloproteinases in human coronary artery endothelial cells. Circulation 107: 612–617, 2003.[Abstract/Free Full Text]
  30. Li D, Mehta JL. Antisense to LOX-1 inhibits oxidized LDL-mediated upregulation of monocyte chemoattractant protein-1 and monocyte adhesion to human coronary artery endothelial cells. Circulation 101: 2889–2895, 2000.[Abstract/Free Full Text]
  31. Libby P, Theroux P. Pathophysiology of coronary artery disease. Circulation 111: 3481–3488, 2005.[Abstract/Free Full Text]
  32. Ma GM, Halayko AJ, Stelmack GL, Zhu F, Zhao R, Hillier CT, Shen GX. Effects of oxidized and glycated low-density lipoproteins on transcription and secretion of plasminogen activator inhibitor-1 in vascular endothelial cells. Cardiovasc Pathol 15: 3–10, 2006.[CrossRef][Web of Science][Medline]
  33. Ponte P, Ng SY, Engel J, Gunning P, Kedes L. Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA. Nucleic Acids Res 12: 1687–1696, 1984.[Abstract/Free Full Text]
  34. Puddu GM, Cravero E, Arnone G, Muscari A, Puddu P. Molecular aspects of atherogenesis: new insights and unsolved questions. J Biomed Sci 12: 839–853, 2005.[CrossRef][Web of Science][Medline]
  35. Ren S, Man RY, Angel A, Shen GX. Oxidative modification enhances lipoprotein(a)-induced overproduction of plasminogen activator inhibitor-1 in cultured vascular endothelial cells. Atherosclerosis 128: 1–10, 1997.[CrossRef][Web of Science][Medline]
  36. Ren S, Shatadal S, Shen GX. Protein kinase C-β mediates lipoprotein-induced generation of PAI-1 from vascular endothelial cells. Am J Physiol Endocrinol Metab 278: E656–E662, 2000.[Abstract/Free Full Text]
  37. Ren S, Shen GX. Impact of antioxidants and HDL on glycated LDL-induced generation of fibrinolytic regulators from vascular endothelial cells. Arterioscler Thromb Vasc Biol 20: 1688–1693, 2000.[Abstract/Free Full Text]
  38. Ruiz-Velasco N, Domínguez A, Vega MA. Statins upregulate CD36 expression in human monocytes, an effect strengthened when combined with PPAR-gamma ligands Putative contribution of Rho GTPases in statin-induced CD36 expression. Biochem Pharmacol 67: 303–313, 2004.[CrossRef][Web of Science][Medline]
  39. Sawamura T, Kume N, Aoyama T, Moriwaki H, Hoshikawa H, Aiba Y, Tanaka T, Miwa S, Katsura Y, Kita T, Masaki T. An endothelial receptor for oxidized low-density lipoprotein. Nature 386: 73–77, 1997.[CrossRef][Web of Science][Medline]
  40. Shen GX. Impact and mechanism for oxidized and glycated lipoproteins on generation of fibrinolytic regulators from vascular endothelial cells. Mol Cell Biochem 246: 69–74, 2003.[CrossRef][Web of Science][Medline]
  41. Song CY, Kim BC, Lee HS. Lovastatin inhibits oxidized low-density lipoprotein-induced plasminogen activator inhibitor and transforming growth factor-beta1 expression via a decrease in Ras/extracellular signal-regulated kinase activity in mesangial cells. Transl Res 151: 27–35, 2008.[CrossRef][Web of Science][Medline]
  42. Steinberg D, Parthasarathy S, Carew TE, Khoo JC, Witztum JL. Beyond cholesterol. Modifications of low-density lipoprotein that increase its atherogenicity. N Engl J Med 320: 915–924, 1989.[Web of Science][Medline]
  43. Stocker R, Keaney JF Jr. Role of oxidative modifications in atherosclerosis. Physiol Rev 84: 1381–1478, 2004.[Abstract/Free Full Text]
  44. Takai Y, Sasaki T, Matozaki T. Small GTP-binding proteins. Physiol Rev 81: 153–208, 2001.[Abstract/Free Full Text]
  45. Thögersen AM, Jansson JH, Boman K, Nilsson TK, Weinehall L, Huhtasaari F, Hallmans G. High plasminogen activator inhibitor and tissue plasminogen activator levels in plasma precede a first acute myocardial infarction in both men and women: evidence for the fibrinolytic system as an independent primary risk factor. Circulation 98: 2241–2247, 1998.[Abstract/Free Full Text]
  46. Tremoli E, Camera M, Maderna P, Sironi L, Prati L, Colli S, Piovella F, Bernini F, Corsini A, Mussoni L. Increased synthesis of plasminogen activator inhibitor-1 by cultured human endothelial cells exposed to native and modified LDLs. An LDL receptor-independent phenomenon. Arterioscler Thromb 13: 338–346, 1993.[Abstract/Free Full Text]
  47. Tsai FM, Shyu RY, Jiang SY. RIG1 inhibits the Ras/mitogen-activated protein kinase pathway by suppressing the activation of Ras. Cell Signal 18: 349–358, 2006.[CrossRef][Medline]
  48. Warne PH, Viciana PR, Downward J. Direct interaction of Ras and the amino-terminal region of Raf-1 in vitro. Nature 364: 352–355, 1993.[CrossRef][Web of Science][Medline]
  49. Watson AD, Berliner JA, Hama SY, La Du BN, Faull KF, Fogelman AM, Navab M. Protective effect of high density lipoprotein associated paraoxonase. Inhibition of the biological activity of minimally oxidized low density lipoprotein. J Clin Invest 96: 2882–2891, 1995.[Web of Science][Medline]
  50. Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME. Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270: 1326–1331, 1995.[Abstract/Free Full Text]
  51. Yang CM, Chien CS, Hsiao LD, Pan SL, Wang CC, Chiu CT, Lin CC. Mitogenic effect of oxidized low-density lipoprotein on vascular smooth muscle cells mediated by activation of Ras/Raf/MEK/MAPK pathway. Br J Pharmacol 132: 1531–1541, 2001.[CrossRef][Web of Science][Medline]
  52. Yorimitsu K, Saito T, Toyozaki T, Ishide T, Ohnuma N, Inagaki Y. Immunohistochemical localization of plasminogen activator inhibitor-1 in human coronary atherosclerotic lesions involved in acute myocardial infarction. Heart Vessels 8: 160–162, 1993.[CrossRef][Web of Science][Medline]
  53. Zhang FL, Casey PJ. Protein prenylation: molecular mechanisms and functional consequences. Annu Rev Biochem 65: 241–269, 1996.[CrossRef][Web of Science][Medline]
  54. Zhao R, Ma X, Shen GX. Transcriptional regulation of plasminogen activator inhibitor-1 in vascular endothelial cells induced by oxidized very low density lipoproteins. Mol Cell Biochem 317: 197–204, 2008.[CrossRef][Web of Science][Medline]
  55. Zhao R, Shen GX. Functional modulation of antioxidant enzymes in vascular endothelial cells by glycated LDL. Atherosclerosis 179: 277–284, 2005.[CrossRef][Web of Science][Medline]
  56. Zhao R, Shen GX. Involvement of heat shock factor-1 in glycated LDL-induced upregulation of plasminogen activator inhibitor-1 in vascular endothelial cells. Diabetes 56: 1436–1444, 2007.[Abstract/Free Full Text]
  57. Zhu Y, Liao H, Wang N, Ma KS, Verna LK, Shyy JY, Chien S, Stemerman MB. LDL-activated p38 in endothelial cells is mediated by Ras. Arterioscler Thromb Vasc Biol 21: 1159–1164, 2001.[Abstract/Free Full Text]
  58. Zhu Y, Liao HL, Wang N, Yuan Y, Ma KS, Verna L, Stemerman MB. Lipoprotein promotes caveolin-1 and Ras translocation to caveolae: role of cholesterol in endothelial signaling. Arterioscler Thromb Vasc Biol 20: 2465–2470, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
R. Zhao, X. Ma, X. Xie, and G. X. Shen
Involvement of NADPH oxidase in oxidized LDL-induced upregulation of heat shock factor-1 and plasminogen activator inhibitor-1 in vascular endothelial cells
Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E104 - E111.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
295/5/E1243    most recent
90415.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sangle, G. V.
Right arrow Articles by Shen, G. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sangle, G. V.
Right arrow Articles by Shen, G. X.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.