AJP - Endo AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 295: E938-E946, 2008. First published August 19, 2008; doi:10.1152/ajpendo.90462.2008
0193-1849/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
295/4/E938    most recent
90462.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sheng, H.
Right arrow Articles by Ni, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sheng, H.
Right arrow Articles by Ni, X.

Corticotropin-releasing hormone stimulates SGK-1 kinase expression in cultured hippocampal neurons via CRH-R1

Hui Sheng,1,4,* Tingting Sun,1,4,* Binhai Cong,1,4 Ping He,1,4 Yanmin Zhang,1,4 Jin Yan,3 Changlin Lu,2,4 and Xin Ni1,4

Departments of 1Physiology, 2Neurobiology, and 3Psychology, Second Military Medical University; and 4Key Laboratory of Molecular Neurobiology, Ministry of Education, Shanghai, China

Submitted 23 May 2008 ; accepted in final form 12 August 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Corticotropin-releasing hormone (CRH) has been shown to exhibit various functions in hippocampus. In the present study, we examined the effect of CRH on the expression of serum/glucocorticoid-inducible protein kinase-1 (SGK-1), a novel protein kinase, in primary cultured hippocampal neurons. A dose-dependent increase in mRNA and protein levels of SGK-1 as well as frequency of SGK-1-positive neurons occurred upon exposure to CRH (1 pmol/l to 10 nmol/l). These effects can be reversed by the specific CRH-R1 antagonist antalarmin but not by the CRH-R2 antagonist astressin 2B. Blocking adenylate cyclase (AC) activity with SQ22536 and PKA with H89 completely prevented CRH-induced mRNA and protein expression of SGK-1. Blockage of PLC or PKC did not block CRH-induced SGK-1 expression. Our results suggest that CRH act on CRH-R1 to stimulate SGK-1 mRNA and protein expression in cultured hippocampal neurons via a mechanism that is involved in AC/PKA signaling pathways.

serum/glucocorticoid-inducible protein kinase-1; corticotropin-releasing hormone receptor-1; adenylate cyclase; adenosine 3'5'-cyclic monophosphate-dependent protein kinase; phospholipase C; protein kinase C

CORTICOTROPIN-RELEASING HORMONE (CRH), a 41-amino acid polypeptide originally isolated from ovine hypothalamus, is the primary factor driving stress-induced adrenocorticotropin secretion from the anterior pituitary and capable of integrating the neuroendocrine, behavioral, autonomic, and immune response to stress (35, 47). The anatomic distribution of CRH and its receptors in brain suggests that this peptide also may modulate the neuronal function of hippocampus (2, 13, 39, 44). Previous studies have shown that CRH produces a long-lasting enhancement of synaptic efficacy in the rat hippocampus in vivo (50, 51) and facilitates the induction and stability of long-term potentiation in hippocampus (5). Injection of CRH into hippocampus enhances classical fear conditioning in mice (40) and improves the retention of one-way inhibitory avoidance learning in rats (27). In addition, it has also been demonstrated that CRH has neuroprotective activity against amyloid β-peptide- or glutamate-induced cell death (3, 14, 37). However, the molecular basis responsible for CRH actions in hippocampus is not fully understood.

Serum/glucocorticoid-inducible kinase-1 (SGK-1), a novel protein kinase, was originally identified as transcriptionally induced by serum and glucocorticoids (52). SGK-1 is a member of the PKA, PKG, and PKC ("AGC") family of serine/threonine protein kinases. The catalytic domain of SGK-1 is 54% homologous to the catalytic domain of PKB (22, 52). It has been demonstrated that SGK-1 is expressed in all tissues that have been studied, including the pancreas, liver, heart, lung, muscle, intestine, ovary, and brain (25, 49). SGK-1 is involved in regulation of ion channel activity and abundance in the lung, kidney, and heart (20, 48, 53) as well as cell survival and proliferative responses (8, 42). Some studies have shown that SGK-1 is involved in the control of synaptic efficacy and plasticity (12, 30) and facilitates memory consolidation of spatial learning in rats (46).

It is known that the most of AGC family members are regulated predominantly at the enzymatic level by posttranslational phosphorylation and dephosphorylation (18, 19). However, SGK-1 is transcriptionally induced by a diverse set of stimuli including hormones, heat shock, ultraviolet radiation, and oxidative stress (1, 2). Moreover, it has been shown that SGK-1 protein is ubiquitinated (7), which would allow quick removal of SGK-1 gene products upon termination of the stimulus. Thus, the mechanisms by which SGK-1 expression is regulated have become of interest. In addition to glucocorticoids, various endogenous factors such as gonadotropins, insulin, and transforming growth factor are shown to induce SGK-1 transcript expression (1, 22, 34, 38). Signaling molecules involved in the transcriptional regulation of SGK-1 include cyclic AMP (cAMP), PKC, and MAPK (26, 31, 36, 38).

SGK-1 has been found to be expressed in many brain areas, including hippocampus and cortex, and induced by various stress stimuli (23, 32, 34). However, the bioactive factors that mediate SGK-1 expression in the nervous system are not fully characterized. In hippocampus, CRH receptors (CRH-Rs) are expressed in neurons (2, 39, 43) and are able to activate more than one signaling cascade, including the PLC/PKC and adenylate cyclase (AC)/PKA pathways (6, 43). Therefore, we hypothesized that CRH could regulate SGK-1 expression to exert its profound action on hippocampal neurons. In the present study, we determined the effects of CRH on SGK mRNA and protein expression in cultured hippocampal neurons and then investigated whether these effects could have occurred through an AC/PKA- or PLC/PKC-dependent pathway.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Preparation of hippocampal neuron cultures. All animal procedures were approved by the Institutional Animal Care and Use Committee of Second Military Medical University. Primary hippocampal neurons were cultured according to modified Nelson's method, as described previously (33, 43). Briefly, the hippocampi were dissected from neonatal (P1) Sprague-Dawley rats in ice-cold dissection solution containing sucrose-glucose-HEPES (136 mM NaCl, 5.4 mM KCl, 0.2 mM Na2HPO4, 2 mM KH2PO4, 16.7 mM glucose, 20.8 mM sucrose, 0.0012% phenol red, and 10 mM HEPES, pH 7.4) and then incubated with 0.125% trypsin at 37°C for 20–25 min. Single-cell suspension was obtained by mechanical dissociation using a Pasteur pipette with a fire-narrowed tip in DMEM containing 10% heat-inactivated fetal calf serum (FCS) and 10% horse serum. Cells were then plated at a density of 1 x 105 cells/cm2 on poly-L-lysine-coated culture plates or glass coverslips and maintained in 5% CO2 at 37°C in DMEM containing 10% FCS and 10% horse serum overnight. The culture medium was then changed to serum-free B27/neurobasal medium (Life Technologies, Grand Island, NY). One-half of the medium was replaced with fresh medium every 3 days. More than 95% of the cells obtained were neurons that were assessed by immunostaining with the neuron-specific marker microtubule-associated protein-2 (MAP-2; Neomarkers, Fremont, CA).

On the 8th day after plating, cells were changed to fresh medium and contained one of following treatments: human/rat CRH (0–10 nmol/l; Sigma-Aldrich, St. Louis, MO), rat urocortin II (0–10 nmol/l; Sigma-Aldrich), antalarmin (0–100 nmol/l; Sigma-Aldrich), astressin 2B (0–100 nmol/l; Sigma-Aldrich), SQ22536 (10 µmol/l; Sigma-Aldrich), H89 (10 µmol/l; Calbiochem, La Jolla, CA), forskolin (1 µmol/l; Sigma-Aldrich), U73122 [GenBank] (1 µmol/l; Sigma-Aldrich), Gö6976 (0.1 µmol/l; Calbiochem), and phorbol 12-myristate 13-acetate (0–1 µmol/l; Calbiochem). Antalarmin, H89, forskolin, U73122 [GenBank] , Gö6976, and phorbol 12-myristate 13-acetate (PMA) were first dissolved in dimethyl sulfoxide (DMSO) and then diluted by DMEM to achieve the final concentration of DMSO less than 0.01%. Control cultures were maintained without additives or contained the same final solvent concentration, and each treatment was performed in triplicate for each preparation of cells. After 1–24 h, the cells were collected for total RNA and protein extraction or fixed in 4% paraformaldehyde for 1 h.

Immunofluorescence analysis. Fixed cells were washed with PBS and incubated with 10% BSA for 1 h. To ensure achieving specific staining of SGK-1, two antibodies from different sources were used: mouse monoantibodies against SGK-1 (sc-28338; Santa Cruz Biotechnology, Santa Cruz, CA) and rabbit antibodies against SGK-1 (Cell Signaling Technology, Danvers, MA). Both SGK-1 antibodies were raised against a short peptide mapping near the COOH terminus of SGK-1. The cells were incubated with one of two antibodies at a dilution of 1:500 overnight at 4°C. For double staining, some slices were incubated with glial fibrillary acidic protein (GFAP) antibody (Santa Cruz Biotechnology) at a dilution of 1:500. All dilutions were made in 1% BSA in PBS. Subsequently, the specimens were washed with PBS three times and then incubated with fluorescein isothiocyanate/rhodamine-conjugated anti-mouse IgG (1:100) or fluorescein isothiocyanate/rhodamine-conjugated anti-rabbit at 37°C for 1 h in the dark. Thoroughly rinsed with PBS, the cell nuclei were visualized by applying the DNA-specific dye hochest at a final concentration of 5 µg/ml. For negative controls, these two primary antibodies were either substituted with a normal IgG in same dilution or preabsorbed with blocking peptide (supplied with antibodies by Santa Cruz Biotechnology). Peptide-antibody ratio was 5:1 (wt/wt). CRH- and dexamethasone-treated cell slides were used for negative control slides. Results were viewed under fluorescent microscope with the use of appropriate filters.

To determine the frequency histograms of SGK-1 neurons in cultured hippocampal neurons, a threshold of average cytoplasmic density level of immunoreactive product was set, determined using an image of negative control neurons (normal IgG control). The optical density threshold was then applied to all other CRH-treated neurons. The areas of all measured cells were obtained at the same time, and for each cell the optical density of immunoreactive product and the cell areas were plotted. At least 500 cells from the CRH-treated neurons or vehicle were measured for each slide.

Western blotting analysis. Western blot was conducted as described previously (43). Briefly, cells were scraped off the plate in the presence of lysis buffer containing the following chemicals: 60 mM Tris·HCl, 2% sodium dodecyl sulfate (SDS), 10% sucrose, 2 mM phenylmethylsulfonyl fluoride (Merck, Darmstadt, Germany), 1 mM sodium orthovanadate (Sigma-Aldrich), and 10 µg/ml aprotinin (Bayer, Leverkusen, Germany). The lysates were then quickly sonicated and centrifuged at 4°C. The supernatant was harvested and then diluted in sample buffer (250 mM Tris·HCl, 4% SDS, 10% glycerol, 2% β-mercaptoethanol, and 0.002% bromophenol blue). Aliquots of proteins were separated by SDS-PAGE (10%) and subsequently transferred to nitrocellulose membranes by electroblotting. The membrane was blocked in 0.1% Tris-buffered saline-Tween-20 (TBST) containing 5% skim milk powder for 2 h and then incubated SGK-1 antibodies (Santa Cruz Biotechnology) at a dilution of 1:1,000 or antibodies against phosphorylated PLC-β3 (Cell Signaling Technology) at a dilution 1:1,000 overnight at 4°C. After three washes with TBST, the membrane was incubated with the secondary antibodies of horseradish peroxidase-conjugated antibody for 1 h at room temperature. Immunoreactive proteins were visualized using the enhanced chemiluminescence Western blotting detection system (Santa Cruz Biotechnology). The light-emitting bands were detected with X-ray film.

Total RNA extraction, RT-PCR, and quantitative real-time RT-PCR. Total RNA was prepared using Trizol reagent (Life Technologies). Two micrograms RNA was reverse transcribed with oligo(dT)12–18 primer using the Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI) and then stored at –20°C. The primers for SGK-1 were sense 5'TTGAGAGGGACTTGGAGGAGGT3' and antisense 5'CCAGAATGAGGGGAATGGTAGC3' (accession no. NM_019232). The primers for CRH-R1 were sense 5'-CCG CTA CAA CAC GAC AAA CA-3' and antisense 5'-AGG ATG AAA GCC GAG ATG AG-3' (accession no. NM_030999). The primers for CRH-R2 were sense 5'-CCC TGC CCT ATC ATT GTC G-3' and antisense 5'-GCC TTC ACT GCC TTC CTG T-3' (accession no. NM_022714). Quantitative real-time PCR was carried out using Rotor-Gene 3000 (Corbett Research).The reaction solution consisted of 2.0 µl of diluted cDNA product, 0.1 µM of each paired primer, 100 µM deoxynucleotide triphosphates, 1 U Taq DNA polymerase (Promega), and 1x PCR buffer. SYBR Green (BMA, Rockland, ME) was used as detection dye. Quantitative real-time PCR conditions were optimized according to preliminary experiments to achieve linear relationship between initial RNA concentration and PCR product. The temperature range to detect the melting temperature of the PCR product was set from 60 to 95°C. Amplification of two housekeeping genes, β-actin and GAPDH, was measured for each sample as an internal PCR control for sample loading and normalization. The specificity of the primers was verified by examining the melting curve as well as subsequent sequencing of the quantitative real-time PCR products. The size of CRH-R1 or CRH-R2 PCR product was 267 and 230 bp, respectively. The size of amplican for SGK-1 was 190 bp. To determine the relative quantitation of gene expression for both target and housekeeping genes, the comparative CT (threshold cycle) method with arithmetic formulae was used (29). Subtracting the CT of housekeeping gene from the CT of the target gene yields the {Delta}CT in each group (control and experimental groups), which was entered into the equation 2–{Delta}{Delta}CT and calculated for the exponential amplification of PCR. For each experiment, the amount of SGK-1 mRNA under various treatment conditions is expressed relative to the amount of transcript present in the untreated control. Because very similar data were obtained by using either β-actin or GAPDH as an internal control, β-actin was used for calculation of {Delta}CT in presentation of results.

RIA of cAMP. After 8 days of plating, neurons were treated with increasing concentrations of CRH for 3, 5, and 30 min and then terminated by the addition of 0.1 ml of 0.3 mol/l HCl. Cells were frozen overnight, followed by heating of the tubes in boiling water for 5 min. The supernatants were collected by centrifuge and stored at –20°C for later assay for cAMP.

cAMP was assayed using commercially available RIA kits (Shanghai Institute of Biological Product, Shanghai, China). The sensitivity was 0.1 pmol/l. The mean intra- and interassay coefficients of variation were 4.24 and 5.57%, respectively (manufacturer's data).

Statistical analyses. The values are expressed as means ± SE. The data were analyzed by Student's t-test, paired t-test, and one-way ANOVA followed by least significant difference t-test. Significance was set at P < 0.05.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Expression of SGK-1 in cultured hippocampal neurons. As shown in Fig. 1A, immunofluorescence analysis revealed that immunoreactive staining of SGK-1 was localized mainly in the somata and nucleus of neurons. In some cells, the processes were positively labeled by SGK-1.


Figure 1
View larger version (60K):
[in this window]
[in a new window]

  		Fig. 1. Immunofluorescence analysis of serum/glucocorticoid-inducible kinase-1 (SGK-1) expression in cultured hippocampal neurons. A: immunostaining with antibody against SGK-1. B: cells were stained with the primary antibodies of SGK-1 that were preabsorbed with blocking peptide. C: negative control: primary antibodies were substituted with normal mouse IgG. Cells were treated with dexamethasone (1 µmol/l) for 24 h and were then immunostained for SGK-1 (D) and microtubule-associated protein-2 (MAP-2; E) or SGK-1 (G) and glial fibrillary acidic protein (GFAP; H). F: SGK-1 and MAP-2 overlie. I: SGK-1 and GFAP overlie. Original magnifications, x200 (A–C) or x100 (D–I).

 
Our previous study showed that >95% of cells prepared by modified Nelson's method are neurons (43). To test whether astrocytes express SGK-1 in the absence or presence of dexamethasone, cells were double-stained with antibodies of SGK-1 and GFAP, the marker for astrocytes. As shown in Fig. 1, SGK-1-positive cells were not stained by GFAP but by MAP-2, the marker of neuron.

CRH stimulates SGK-1 expression in hippocampal neurons. As shown in Fig. 2A, CRH significantly increased SGK-1 mRNA levels in a dose-dependent manner over the concentration range of 1 pmol/l to 10 nmol/l. Maximal effect was obtained at a concentration of 10 nmol/l, which caused an ~2.5-fold increase in SGK-1 mRNA level after a 24-h incubation period. CRH (10 nmol/l) treatment also resulted in a time-dependent increase in SGK-1 mRNA expression, with a significant increase by 30 min and the maximal increase by 3 h (Fig. 2B).


Figure 2
View larger version (28K):
[in this window]
[in a new window]

  		Fig. 2. Concentration and time-dependent effect of corticotropin-releasing hormone (CRH) on SGK-1 transcript levels in cultured hippocampal neurons. A: hippocampal neurons were incubated with indicated concentrations of CRH for 24 h. B: cells were incubated for indicated time with CRH (10 nmol/l). SGK-1 mRNA levels were determined by real-time quantitative RT-PCR. Data are normalized to the control and presented as means ± SE (n = 5). *P < 0.05, **P < 0.01 vs. control.

 
To elucidate whether CRH subsequently influences SGK-1 protein expression, Western blot and immunofluorescence analysis were applied to real protein intensity and the frequency of SGK-1 positive neurons, respectively. Western blot analysis showed that CRH (1 pmol/l to 10 nmol/l) enhanced SGK-1 protein level in a dose-dependent manner over a 24-h treatment period (Fig. 3A). The frequency of SGK-1-positive neurons was significantly increased after 3 h of treatment, and the maximal effect was obtained by a 24-h treatment period (Fig. 3B). The frequency of SGK-1-positive cells was 22 ± 1.7% in absence of CRH. Cells were treated with increasing concentrations of CRH (1 pmol/l to 10 nmol/l) for 24 h, and the frequency of SGK-1-positive cells was significantly increased to 55 ± 3.3 and 66 ± 2.9% at doses of 1 pmol/l and 10 nmol/l, respectively (Fig. 3, C and D). To test whether astrocytes express SGK-1 in response to CRH, cells were double-stained with antibodies of SGK-1 and GFAP. It was found that the SGK-1-positive neurons were not stained by GFAP (data not shown).


Figure 3
View larger version (27K):
[in this window]
[in a new window]

  		Fig. 3. Effects of CRH on SGK-1 protein levels in cultured hippocampal neurons. A: neurons were treated with increasing concentrations of CRH for 24 h. The protein of cells was extracted for Western blot analysis. Representative protein bands are presented at top of histogram. Data of SGK-1 protein levels are normalized to the control and presented as means ± SE (n = 3). **P < 0.01 vs. control. B: neurons were incubated with 10 nmol/l CRH for indicated time. Cells were then fixed in 4% paraformaldehyde for immunofluorescence analysis. Cumulative data showing the rates of SGK-1-positive neurons (n = 5). Data are presented as means ± SE. **P < 0.01 vs. control. C: neurons were incubated with 1 pmol/l (b), 100 pmol/l (c), 10 nmol/l (d), and vehicle (a) for 24 h. Then, cells were fixed in 4% paraformaldehyde for immunofluorescence analysis. Original magnifications, x100. D: cumulative data showing the rates of SGK-1-positive neurons in absence and presence of CRH (n = 4). Data are presented as means ± SE. **P < 0.01 vs. control.

 
CRH receptor type 1 but not type 2 mediates CRH-induced SGK-1 expression. Our previous study had shown that cultured hippocampal neurons express both CRH-R1 and CRH-R2 (43). Quantitative RT-PCR analysis showed that the mRNA level of CRH-R1 was higher than that of CRH-R2 in cultured hippocampal neurons (Fig. 4A). To determine the subtype of CRH receptor-mediated CRH effect, the specific antagonist of CRH-R1 or CRH-R2 was used. As shown in Fig. 4, the CRH-R1 antagonist antalarmin (0.1 µmol/l) did not affect SGK-1 mRNA expression but completely blocked the CRH (10 nmol/l)-induced SGK-1 mRNA expression. Antalarmin at 100 pmol/l reversed CRH (1 pmol/l)-induced SGK-1 protein expression. Antalarmin (0.1 µmol/l) blocked CRH (10 nmol/l)- induced increase in frequency of SGK-1-positive neurons. Cells treated with CRH-R2 antagonist astressin 2B (0.1 µmol/l) and CRH (10 nmol/l) had SGK-1 mRNA levels that were not significantly different from those of cells treated with CRH (10 nmol/l) alone. There was no significant difference in SGK-1 protein level between the cells treated with CRH (1 pmol/l) alone and the cells treated with astressin 2B (100 pmol/l) and CRH (1 pmol/l).


Figure 4
View larger version (37K):
[in this window]
[in a new window]

  		Fig. 4. CRH receptor (CRH-R)1 mediated CRH-induced SGK-1 expression. A: real-time quantitative RT-PCR analysis CRH-R1 and CRH-R2 mRNA levels in hippocampal neurons. Data are presented as means ± SE (n = 7). **P < 0.01 vs. CRH-R1. B: real-time quantitative RT-PCR analysis of SGK-1 mRNA levels. Cells were treated with CRH (10 nmol/l), antalarmin (Anta; 100 nmol/l), CRH (10 nmol/l) in combination with antalarmin (CRH + Anta; 100 nmol/l), astressin 2b (Astr; 100 nmol/l), or CRH (10 nmol/l) in combination with astressin 2b (CRH + Astr; 100 nmol/l) for 24 h (n = 5). Data are normalized to the control and presented as means ± SE. Ctl, control. **P < 0.01 vs. control. C: Western blot analysis of SGK-1 protein levels in neurons that were treated with CRH (1 pmol/l), CRH (1 pmol/l) + Anta (100 pmol/l), and CRH (1 pmol/l) + Astr (100 pmol/l) (n = 3). Representative protein bands are presented at top of histogram. Data are normalized to the control and presented as means ± SE. **P < 0.01 vs. control. D: immunofluorescence analysis of SGK-1-positive neurons. Cells were treated with CRH (10 nmol/l), Anta (100 nmol/l), CRH (10 nmol/l) + Anta (100 nmol/l), Astr (100 nmol/l), or CRH (10 nmol/l) + Astr (100 nmol/l) for 24 h. Data are presented as means ± SE (n = 5). **P < 0.01 vs. control. E: SGK-1 mRNA level in cultured neurons after a 24-h treatment with indicated concentrations of urocortin II (Uro II). Data are normalized to the control and presented as means ± SE (n = 4). F: cumulative data showing the rates of SGK-1-positive neurons after a 24-h treatment with indicated concentrations of Uro II. Data are presented as means ± SE (n = 4).

 
To further clarify whether CRH-R2 is involved in the CRH-induced SGK-1 expression, we examined the effect of the CRH-R2 exclusive agonist urocortin II on SGK-1 expression. Application of urocortin II (0.1–10 nmol/l) did not affect SGK-1 expression at mRNA and protein levels (Fig. 4, E and F).

CRH-R1 is involved in CRH stimulation of cAMP production and phosphorylated PLC-β3 expression. It is known that CRH receptors could couple to multiple G proteins and induce at least activation of AC/PKA and PLC/PKC signaling pathways. Our previous study demonstrated that CRH dose-dependently stimulated cAMP production and expression of phosphorylated PLC-β3 in cultured hippocampal neurons over a concentration range of 1 pmol/l to 10 nmol/l (43). In the present study, we determined whether CRH-R1 was involved in CRH-induced cAMP production and phosphorylated PLC-β3 expression. As shown Fig. 5A, enhancement of cAMP production induced by CRH (10 nmol/l) could be blocked by antalarmin (0.1 µmol/l). CRH (10 nmol/l)-induced expression of phosphorylated PLC-β3 was also reversed by antalarmin (0.1 µmol/l) (Fig. 5B).


Figure 5
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 5. Effect of CRH-R1 antagonist on CRH-induced cAMP production and phosphorylated PLC-β3 expression in cultured hippocampal neurons. Cells were treated CRH (10 nmol/l) for 3 min in absence and presence of the CRH-R1 antagonist Anta (0.1 µmol/l). A: the content of cAMP in cells was determined by RIA. Data are normalized to the control and represented as means ± SE (n = 3). **P < 0.01 vs. control. B: Western blot analysis was used to reveal phosphorylated PLC-β3 expression. Representative protein bands are presented at top of histogram. Data of phosphorylated PLC-β3 levels are normalized to the control and presented as means ± SE (n = 3). **P < 0.01 vs. control.

 
The role of AC/PKA signaling pathway in CRH-induced SGK-1 expression. We further observed the effects of blocking AC and PKA on CRH-induced SGK-1 expression. SQ22356 (10 µmol/l) itself did not affect SGK-1 mRNA and protein expression, but it was able to block CRH-induced increase in SGK-1 mRNA and protein expression. Treatment of cells with H89 (10 µmol/l) exhibited a similar effect as SQ22536, completely blocking CRH-induced SGK-1 expression at mRNA and protein levels (Fig. 6).


Figure 6
View larger version (30K):
[in this window]
[in a new window]

  		Fig. 6. Effects of PKA and adenylate cyclase inhibitors on CRH-induced SGK-1 expression. A: real-time quantitative RT-PCR analysis of SGK-1 mRNA levels. Cells were treated with CRH (10 nmol/l) alone, SQ22536 (10 µmol/l), CRH (10 nmol/l) + SQ22536 (10 µmol/l), H89 (10 µmol/l), CRH (10 nmol/l) + H89 (10 µmol/l), or forskolin (0.1 µmol/l) for 24 h. Data are normalized to the control and presented as means ± SE (n = 4). **P < 0.01 vs. control. B: Western blot analysis of SGK-1 protein levels in neurons that were treated with CRH (1 pmol/l), CRH (1 pmol/l) + SQ22536 (10 µmol/l), CRH (1 pmol/l) + H89 (10 µmol/l), or forskolin (0.1 µmol/l) for 24 h. Representative protein bands are presented on the top of histogram. Data are normalized to the control and presented as means ± SE (n = 3). **P < 0.01 vs. control. C: immunofluorescence analysis of SGK-1-positive neurons. Cells were treated with CRH (10 nmol/l) alone (b), SQ22536 (10 µmol/l; c), CRH (10 nmol/l) + SQ22536 (10 µmol/l) (d), H89 (10 µmol/l; e), or CRH (10 nmol/l) + H89 (10 µmol/l) (f) for 24 h; a: vehicle control. Original magnifications, x100. D: cumulative data showing the rates of SGK-1-positive neurons. Data are presented as means ± SE (n = 5). **P < 0.01 vs. control.

 
To confirm the role of the AC/PKA signaling pathway in the regulation of SGK-1 expression, we observed the effect of AC activator forskolin on SGK-1 expression. The results showed that forskolin (0.1 µmol/l) significantly increased SGK-1 mRNA and protein expression (Fig. 6).

The effect of PLC and PKC inhibitors on CRH-induced SGK-1 expression. Because CRH significantly induced phosphorylated PLC-β3 expression in cultured hippocampal neurons, we tested the effect of PLC inhibitor U73122 [GenBank] on CRH-induced SGK-1 expression. Treatment of cells with U73122 [GenBank] (1 µmol/l) alone significantly increased SGK-1 mRNA and protein expression (Fig. 7). Cells that were treated with U73122 [GenBank] (1 µmol/l) and CRH (10 nmol/l) had SGK-1 mRNA and protein levels that were not significantly different from those of cells treated with CRH (10 nmol/l) alone (Fig. 7).


Figure 7
View larger version (37K):
[in this window]
[in a new window]

  		Fig. 7. Effects of PLC and PKC inhibitors on SGK-1 expression. A: real-time quantitative RT-PCR analysis of SGK-1 mRNA levels. Cells were treated with CRH (10 nmol/l), U73122 [GenBank] (1 µmol/l), CRH + U73122 [GenBank] , Gö6976 (0.1 µmol/l), or CRH + Gö6976 for 24 h. Data are normalized to the control and presented as means ± SE (n = 4). **P < 0.01 vs control. B: Western blot analysis of SGK-1 protein levels in neurons that were treated with CRH (1 pmol/l), U73122 [GenBank] (1 µmol/l), CRH + U73122 [GenBank] , Gö6976 (0.1 µmol/l), or CRH + Gö6976 for 24 h. Representative protein bands were presented on top of histogram. Data are normalized to the control and presented as means ± SE (n = 3). **P < 0.01 vs. control. C: immunofluorescence analysis of SGK-1-positive neurons. Cells were treated with CRH (10 nmol/l; b), U73122 [GenBank] (1 µmol/l; c), CRH + U73122 [GenBank] (d), Gö6976 (0.1 µmol/l; e), or CRH + Gö6976 (f) for 24 h; a: vehicle control. Original magnifications, x100. D: cumulative data showing the rates of SGK-1-positive neurons. Data are presented as means ± SE (n = 5). **P < 0.01 vs. control.

 
PKC is a major downstream signaling molecule that can be activated by the PLC signaling pathway. Thus, we tested whether PKC signaling pathway is involved in CRH regulation of SGK-1 expression. Blocking PKC activity with Gö6976 (0.1 µmol/l) did not block CRH-induced SGK-1 expression at mRNA and protein levels (Fig. 7). Moreover, treatment of neurons with Gö6976 alone could significantly increase the frequency of SGK-1-positive neuron as well as protein intensity and mRNA level of SGK-1 (Fig. 7).

In addition, we also observed the effect of PKC activator PMA (0.01–1 µmol/l) on SGK-1 mRNA and protein expression. PMA treatment did not result in significant changes in mRNA level, protein intensity of SGK-1, or the frequency of SGK-1-positive neurons (data not shown).


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In this study, we have demonstrated that CRH dose-dependently stimulated SGK-1 mRNA and protein expression in cultured hippocampal neurons. The stimulatory effect of CRH on SGK-1 expression was completely reversed by CRH-R1 antagonist. However, CRH-R2 antagonist did not block CRH-induced SGK-1 expression. Urocortin II, the exclusive CRH-R2 agonist, did not affect SGK-1 expression. We also found that CRH-R1 mediated CRH-induced increase in cAMP production in these cells and that blocking PKA and AC prevented CRH-induced SGK-1 expression. These findings suggest that CRH may be one of bioactive factors that induce SGK-1 expression in hippocampal neurons.

Both CRH-R1 and -R2 are identified in hippocampus and primary hippocampal neurons (2, 39, 43). Moreover, both CRH-R1 and -R2 have been implicated in the modulation of hippocampal functions in vivo and in vitro. More recently, we reported that CRH-R1 mediates CRH regulation of N-methyl-D-aspartate (NMDA) receptor activity in hippocampal neurons (43). Some studies have shown that CRH-R1 mediates the anxiogenic-like effect (9) and neuroprotective activity of CRH (15, 40). Sananbenesi et al. (41) have demonstrated that CRH-R2 in hippocampus is a link to stress-enhanced memory consolidation. The present study showed that activation of CRH-R1 could induce expression of SGK-1, a novel protein kinase, in cultured hippocampal neurons, suggesting that CRH-R1 may exert its function through the SGK-1 signaling pathway in hippocampal neurons.

It has been found that CRH receptors activate multiple G proteins and subsequently lead to activation of multiple signaling pathways, including the AC/PKA and PLC/PKC pathways (6, 16, 43). Blank et al. (6) found that CRH receptors couple to Gs, Gq/11, and Gi to evoke hippocampal neuronal excitability via PKA- or PKC-dependent signaling pathway in mice. Eilliott-Hunt et al. reported that, in rat hippocampus, CRH activates PKA and MAPK signaling pathways to exert neuroprotective effects (14). In the present study, we showed that CRH acts on CRH-R1 to stimulate cAMP production in primary hippocampal neurons. It is known that PKA is activated by cAMP, which is produced by AC; thus, AC and PKA inhibitors were applied to elucidate the role of PKA in CRH stimulation of SGK-1 expression. It was found that blocking either PKA or AC completely prevented CRH-induced SGK-1 expression. These data suggested that the AC/PKA signaling pathway is involved in CRH induction of SGK-1 expression. Sequence analysis revealed that there are three cAMP-responsive element-binding protein sites in the SGK-1 promoter region (45), providing the molecular basis that activation of PKA signaling pathway upregulates SGK-1 expression. Studies by Alliston et al. (1) and Gonzalez-Robayna et al. (17) demonstrated that, in rat ovarian granulose cells, activation of the cAMP pathway induces SGK-1 expression.

We also found that activation of CRH-R1 resulted in not only activation of cAMP/PKA but also PLC-β3 signaling pathways in hippocampal neurons. In this study, we also examined the effect of PLC and PKC inhibitors on CRH-induced SGK-1 expression. It was found that blockage of PLC and PKC cannot reverse CRH effect. Moreover, PLC as well as PKC inhibitors significantly induced SGK-1 expression. Although we did not show the effect of PLC activator on SGK-1 expression, we demonstrated that PKC activator did not influence SGK-1 mRNA and protein levels. Thus, it could be suggested that CRH stimulation of SGK-1 expression may be independent of the PLC/PKC signaling pathway. Interestingly, our previous study showed that the PLC/PKC but not AC/PKA signaling pathway is involved in CRH regulation of NMDA activity in cultured hippocampal neurons (43). Together, this suggests that CRH may exhibit multiple effects in hippocampal neurons through different signaling pathways.

Although activation of PKC by PMA did not affect SGK-1 expression, inhibition of PLC and PKC resulted in an increase in SGK-1 mRNA and protein expression, which may suggest that maintenance of SGK-1 expression at a relative low level in cultured hippocampal neurons is due to the tonic inhibitory effect of the intrinsic PLC/PKC signaling pathway. A study by Lang et al. (24) showed that SGK-1 transcript could be induced by activation of PKC in fibroblasts. Thus, it is suggested that regulation of SGK-1 expression by PKC signaling pathway may be dependent on cell context. However, the role of PLC/PKC signaling pathway in the modulation of SGK-1 expression remains to be further elucidated.

It has been known that SGK-1 transcript expression can be acutely regulated by various stimuli (34, 38). We also observed, in this study, that SGK-1 mRNA expression was significantly enhanced after cells were exposed to CRH for 30 min. A number of stimuli, such as stress, hyper- or hypo-osmotic stress, and transient ischemia, have been shown to induce SGK-1 transcript expression (4, 28, 34). It is found that global ischemia could induce CRH release in hippocampus (21). During exposure to stress, CRH can be secreted directly from the nerve terminals located in the hippocampus (10). Thus, CRH might be one of the mediators that control SGK-1 expression in response to various stimuli, such as ischemia. Nevertheless, the specific link between stress and SGK-1 expression needs to be further elucidated.

SGK-1 has been implicated in modulation of various physiological functions such as activity of ion channels, cell survival, and proliferation (8, 20, 42, 48, 53). In the nervous system, SGK-1 has been shown to be involved in learning and memory, neuroprotection, and dendrite growth (12, 30, 42, 46). Interestingly, CRH has been demonstrated to be involved in learning, dendrite growth, and neuroprotection (3, 11, 14, 27, 37, 40). The results of the present study indicate that there may be a functional link between CRH and SGK-1 in hippocampal neurons. Thus, it would be of interest to further study the functions controlled by the CRH-SGK-1 system in the future.

In summary, CRH acts on CRH-R1 to stimulate SGK-1 mRNA and protein expression in cultured hippocampal neurons via a mechanism that is involved in AC/PKA signaling pathways. Our results suggest that CRH may exert its function through the SGK-1 signaling pathway in hippocampus.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work is supported by the National Basic Research Program of China (2007CB512303) and the Program for Changjiang Scholars and Innovative Research Team in Universities (No. IRT0528).


   FOOTNOTES
 

Address for reprint requests and other correspondence: X. Ni, Dept. of Physiology, Second Military Medical University, 800 Xiangyin Rd., Shanghai 200433, P. R. China (e-mail: nixin{at}smmu.edu.cn)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* H. Sheng and T. Sun contributed equally to this article. Back


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alliston TN, Gonzalez-Robayna IJ, Buse P, Firestone GL, Richards JS. Expression and localization of serum/glucocorticoid-induced kinase in the rat ovary: relation to follicular growth and differentiation. Endocrinology 141: 385–395, 2000.[Abstract/Free Full Text]
  2. Avishai-Eliner S, Yi SJ, Baram TZ. Developmental profile of messenger RNA for the corticotropin-releasing hormone receptor in the rat limbic system. Brain Res Dev Brain Res 91: 159–163, 1996.[CrossRef][Medline]
  3. Bayatti N, Zschocke J, Behl C. Brain region-specific neuroprotective action and signaling of corticotropin-releasing hormone in primary neurons. Endocrinology 144: 4051–4060, 2003.[Abstract/Free Full Text]
  4. Bell LM, Leong ML, Kim B, Wang E, Park J, Hemmings BA, Firestone GL. Hyperosmotic stress stimulates promoter activity and regulates cellular utilization of the serum- and glucocorticoid-inducible protein kinase (Sgk) by a p38 MAPK-dependent pathway. J Biol Chem 275: 25262–25272, 2000.[Abstract/Free Full Text]
  5. Blank T, Nijholt I, Eckart K, Spiess J. Priming of long-term potentiation in mouse hippocampus by corticotropin-releasing factor and acute stress: implications for hippocampus-dependent learning. J Neurosci 22: 3788–3794, 2002.[Abstract/Free Full Text]
  6. Blank T, Nijholt I, Grammatopoulos DK, Randeva HS, Hillhouse EW, Spiess J. Corticotropin-releasing factor receptors couple to multiple G-proteins to activate diverse intracellular signaling pathways in mouse hippocampus: role in neuronal excitability and associative learning. J Neurosci 23: 700–707, 2003.[Abstract/Free Full Text]
  7. Brickley DR, Mikosz CA, Hagan CR, Conzen SD. Ubiquitin modification of serum and glucocorticoid-induced protein kinase-1 (SGK-1). J Biol Chem 277: 43064–43070, 2002.[Abstract/Free Full Text]
  8. Buse P, Tran SH, Luther E, Phu PT, Aponte GW, Firestone GL. Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, Sgk, in mammary tumor cells. A novel convergence point of anti-proliferative and proliferative cell signaling pathways. J Biol Chem 274: 7253–7263, 1999.[Abstract/Free Full Text]
  9. Chaki S, Nakazato A, Kennis L, Nakamura M, Mackie C, Sugiura M, Vinken P, Ashton D, Langlois X, Steckler T. Anxiolytic- and antidepressant-like profile of a new CRF1 receptor antagonist, R278995/CRA0450. Eur J Pharmacol 485: 145–158, 2004.[CrossRef][Web of Science][Medline]
  10. Chen Y, Brunson KL, Adelmann G, Bender RA, Frotscher M, Baram TZ. Hippocampal corticotropin releasing hormone: pre- and postsynaptic location and release by stress. Neuroscience 126: 533–540, 2004.[CrossRef][Web of Science][Medline]
  11. Chen Y, Dubé CM, Rice CJ, Baram TZ. Rapid loss of dendritic spines after stress involves derangement of spine dynamics by corticotropin-releasing hormone. J Neurosci 28: 2903–2911, 2008.[Abstract/Free Full Text]
  12. David S, Stegenga SL, Hu P, Xiong GX, Kerr E, Becker KB, Venkatapathy S, Warrington JA, Kalb RG. Expression of serum- and glucocorticoid-inducible kinase is regulated in an experience-dependent manner and can cause dendrite growth. J Neurosci 25: 7048–7053, 2005.[Abstract/Free Full Text]
  13. De Souza EB, Insel TR, Perrin MH, Rivier J, Vale WW, Kuhar MJ. Corticotropin-releasing factor receptors are widely distributed within the rat central nervous system: an autoradiographic study. J Neurosci 5: 3189–3203, 1985.[Abstract]
  14. Elliott-Hunt CR, Kazlauskaite J, Wilde GJ, Grammatopoulos DK, Hillhouse EW. Potential signalling pathways underlying corticotrophin-releasing hormone-mediated neuroprotection from excitotoxicity in rat hippocampus. J Neurochem 80: 416–425, 2002.[CrossRef][Web of Science][Medline]
  15. Facci L, Stevens DA, Pangallo M, Franceschini D, Skaper SD, Strijbos PJ. Corticotropin-releasing factor (CRF) and related peptides confer neuroprotection via type 1 CRF receptors. Neuropharmacology 45: 623–636, 2003.[CrossRef][Web of Science][Medline]
  16. Grammatopoulos DK, Randeva HS, Levine MA, Kanellopoulou KA, Hillhouse EW. Rat cerebral cortex corticotropin-releasing hormone receptors: evidence for receptor coupling to multiple G-proteins. J Neurochem 76: 509–519, 2001.[CrossRef][Web of Science][Medline]
  17. Gonzalez-Robayna IJ, Falender AE, Ochsner S, Firestone GL, Richards JS. Follicle-stimulating hormone (FSH) stimulates phosphorylation and activation of protein kinase B (PKB/Akt) and serum and glucocorticoid-induced kinase (Sgk): evidence for a kinase-independent signaling by FSH in granulosa cells. Mol Endocrinol 14: 1283–1300, 2000.[Abstract/Free Full Text]
  18. Hunter T. Protein kinases and phosphatases: the yin and yang of protein phosphorylation and signaling. Cell 80: 225–236, 1995.[CrossRef][Web of Science][Medline]
  19. Hunter T. Signaling—2000 and beyond. Cell 100: 113–127, 2000.[CrossRef][Web of Science][Medline]
  20. Itani OA, Auerbach SD, Husted RF, Volk KA, Ageloff S, Knepper MA, Stokes JB, Thomas CP. Glucocorticoid-stimulated lung epithelial Na+ transport is associated with regulated ENaC and sgk1 expression. Am J Physiol Lung Cell Mol Physiol 282: L631–L641, 2002.[Abstract/Free Full Text]
  21. Khan S, Milot M, Lecompte-Collin J, Plamondon H. Time-dependent changes in CRH concentrations and release in discrete brain regions following global ischemia: effects of MK-801 pretreatment. Brain Res 1016: 48–57, 2004.[CrossRef][Web of Science][Medline]
  22. Kobayashi T, Cohen P. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3- kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339: 319–328, 1999.[CrossRef][Web of Science][Medline]
  23. Koya E, Spijker S, Homberg JR, Voorn P, Schoffelmeer AN, De Vries TJ, Smit AB. Molecular reactivity of mesocorticolimbic brain areas of high and low grooming rats after elevated plus maze exposure. Brain Res Mol Brain Res 137: 184–192, 2005.[CrossRef][Medline]
  24. Lang F, Klingel K, Wagner CA, Stegen C, Warntges S, Friedrich B, Lanzendorfer M, Melzig J, Moschen I, Steuer S, Waldegger S, Sauter M, Paulmichl M, Gerke V, Risler T, Gamba G, Capasso G, Kandolf R, Hebert SC, Massry SG, Broër S. Deranged transcriptional regulation of cell-volume-sensitive kinase hSGK in diabetic nephropathy. Proc Natl Acad Sci USA 97: 8157–8162, 2000.[Abstract/Free Full Text]
  25. Lang F, Böhmer C, Palmada M, Seebohm G, Strutz-Seebohm N, Vallon V. (Patho)physiological significance of the serum- and glucocorticoid-inducible kinase isoforms. Physiol Rev 86: 1151–1178, 2006.[Abstract/Free Full Text]
  26. Lee CT, Tyan SW, Ma YL, Tsai MC, Yang YC, Lee EH. Serum- and glucocorticoid-inducible kinase (SGK) is a target of the MAPK/ERK signaling pathway that mediates memory formation in rats. Eur J Neurosci 23: 1311–1320, 2006.[CrossRef][Web of Science][Medline]
  27. Lee EH, Hung HC, Lu KT, Chen WH, Chen HY. Protein synthesis in the hippocampus associated with memory facilitation by corticotropin-releasing factor in rats. Peptides 13: 927–937, 1992.[CrossRef][Web of Science][Medline]
  28. Leong ML, Maiyar AC, Kim B, O'Keeffe BA, Firestone GL. Expression of the serum- and glucocorticoid-inducible protein kinase, Sgk, is a cell survival response to multiple types of environmental stress stimuli in mammary epithelial cells. J Biol Chem 278: 5871–5882, 2003.[Abstract/Free Full Text]
  29. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2[–Delta Delta C(T)] method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
  30. Ma YL, Tsai MC, Hsu WL, Lee EH. SGK protein kinase facilitates the expression of long-term potentiation in hippocampal neurons. Learn Mem 13: 114–118, 2006.[Abstract/Free Full Text]
  31. Mizuno H, Nishida E. The ERK MAP kinase pathway mediates induction of SGK (serum- and glucocorticoid-inducible kinase) by growth factors. Genes Cells 6: 261–268, 2001.[Abstract]
  32. Murata S, Yoshiara T, Lim CR, Sugino M, Kogure M, Ohnuki T, Komurasaki T, Matsubara K. Psychophysiological stress-regulated gene expression in mice. FEBS Lett 579: 2137–2142, 2005.[CrossRef][Web of Science][Medline]
  33. Nelson TE, Gruol DL. The chemokine CXCL10 modulates excitatory activity and intracellular calcium signaling in cultured hippocampal neurons. J Neuroimmunol 156: 74–87, 2004.[CrossRef][Web of Science][Medline]
  34. Nishida Y, Nagata T, Takahashi Y, Sugahara-Kobayashi M, Murata A, Asai S. Alteration of serum/glucocorticoid regulated kinase-1 (sgk-1) gene expression in rat hippocampus after transient global ischemia. Brain Res Mol Brain Res 123: 121–125, 2004.[CrossRef][Medline]
  35. Owens MJ, Nemeroff CB. Physiology and pharmacology of corticotropin-releasing factor. Pharmacol Rev 43: 425–473, 1991.[Web of Science][Medline]
  36. Park J, Leong ML, Buse P, Maiyar AC, Firestone GL, Hemmings BA. Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J 18: 3024–3033, 1999.[CrossRef][Web of Science][Medline]
  37. Pedersen WA, McCullers D, Culmsee C, Haughey NJ, Herman JP, Mattson MP. Corticotropin-releasing hormone protects neurons against insults relevant to the pathogenesis of Alzheimer's disease. Neurobiol Dis 8: 492–503, 2001.[CrossRef][Web of Science][Medline]
  38. Perrotti N, He RA, Phillips SA, Haft CR, Taylor SI. Activation of serum- and glucocorticoid-induced protein kinase (Sgk) by cyclic AMP and insulin. J Biol Chem 276: 9406–9412, 2001.[Abstract/Free Full Text]
  39. Radulovic J, Sydow S, Spiess J. Characterization of native corticotropin-releasing factor receptor type 1 (CRFR1) in the rat and mouse central nervous system. J Neurosci Res 54: 507–521, 1998.[CrossRef][Web of Science][Medline]
  40. Radulovic J, Ruhmann A, Liepold T, Spiess J. Modulation of learning and anxiety by corticotropin-releasing factor (CRF) and stress: differential roles of CRF receptors 1 and 2. J Neurosci 19: 5016–5025, 1999.[Abstract/Free Full Text]
  41. Sananbenesi F, Fischer A, Schrick C, Spiess J, Radulovic J. Mitogen-activated protein kinase signaling in the hippocampus and its modulation by corticotropin-releasing factor receptor 2: a possible link between stress and fear memory. J Neurosci 23: 11436–11443, 2003.[Abstract/Free Full Text]
  42. Schoenebeck B, Bader V, Zhu XR, Schmitz B, Lübbert H, Stichel CC. Sgk1, a cell survival response in neurodegenerative diseases. Mol Cell Neurosci 30: 249–264, 2005.[CrossRef][Web of Science][Medline]
  43. Sheng H, Zhang Y, Sun J, Gao L, Ma B, Lu J, Ni X. Corticotropin-releasing hormone depresses n-methyl-D-aspartate receptor-mediated current in cultured rat hippocampal neurons via CRH receptor type 1. Endocrinology 149: 1389–1398, 2008.[Abstract/Free Full Text]
  44. Swanson LW, Sawchenko PE, Rivier J, Vale WW. Organization of ovine corticotropin-releasing factor immunoreactive cells and fibers in the rat brain: an immunohistochemical study. Neuroendocrinology 36: 165–186, 1983.[Web of Science][Medline]
  45. Tessier M, Woodgett JR. Serum and glucocorticoid-regulated protein kinases: variations on a theme. J Cell Biochem 98: 1391–1407, 2006.[CrossRef][Web of Science][Medline]
  46. Tsai KJ, Chen SK, Ma YL, Hsu WL, Lee EH. Sgk, a primary glucocorticoid-induced gene, facilitates memory consolidation of spatial learning in rats. Proc Natl Acad Sci USA 99: 3990–3995, 2002.[Abstract/Free Full Text]
  47. Vale W, Spiess J, Rivier C, Rivier J. Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science 213: 1394–1397, 1981.[Free Full Text]
  48. van Bemmelen MX, Rougier JS, Gavillet B, Apothéloz F, Daidié D, Tateyama M, Rivolta I, Thomas MA, Kass RS, Staub O, Abriel H. Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination. Circ Res 95: 284–291, 2004.[Abstract/Free Full Text]
  49. Waldegger S, Barth P, Raber G, Lang F. Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci USA 94: 4440–4445, 1997.[Abstract/Free Full Text]
  50. Wang HL, Wayner MJ, Chai CY, Lee EH. Corticotrophin-releasing factor produces a long-lasting enhancement of synaptic efficacy in the hippocampus. Eur J Neurosci 10: 3428–3437, 1998.[CrossRef][Web of Science][Medline]
  51. Wang HL, Tsai LY, Lee EH. Corticotrophin-releasing factor produces a protein synthesis-dependent long-lasting potentiation in dentate gyrus neurons. J Neurophysiol 83: 343–349, 2000.[Abstract/Free Full Text]
  52. Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL. Characterization of SGK, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13: 2031–2040, 1993.[Abstract/Free Full Text]
  53. Yun CC, Palmada M, Embark HM, Fedorenko O, Feng Y, Henke G, Setiawan I, Boehmer C, Weinman EJ, Sandrasagra S, Korbmacher C, Cohen P, Pearce D, Lang F. The serum and glucocorticoid-inducible kinase SGK1 and the Na+/H+ exchange regulating factor NHERF2 synergize to stimulate the renal outer medullary K+ channel ROMK1. J Am Soc Nephrol 13: 2823–2830, 2002.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
295/4/E938    most recent
90462.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sheng, H.
Right arrow Articles by Ni, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sheng, H.
Right arrow Articles by Ni, X.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.