Am J Physiol Endocrinol Metab 295: E884-E894, 2008.
First published August 5, 2008; doi:10.1152/ajpendo.90438.2008
0193-1849/08 $8.00
Hepatic regulation of fatty acid synthase by insulin and T3: evidence for T3 genomic and nongenomic actions
Anne Radenne,
Murielle Akpa,
Caroline Martel,
Sabine Sawadogo,
Daniel Mauvoisin, and
Catherine Mounier
Département des Sciences Biologiques, Centre de recherche BioMed, Université du Québec, Montreal, Quebec, Canada
Submitted 13 May 2008
; accepted in final form 18 July 2008
 |
ABSTRACT
|
|---|
Fatty acid synthase (FAS) is a key enzyme of hepatic lipogenesis responsible for the synthesis of long-chain saturated fatty acids. This enzyme is mainly regulated at the transcriptional level by nutrients and hormones. In particular, glucose, insulin, and T3 increase FAS activity, whereas glucagon and saturated and polyunsaturated fatty acids decrease it. In the present study we show that, in liver, T3 and insulin were able to activate FAS enzymatic activity, mRNA expression, and gene transcription. We localized the T3 response element (TRE) that mediates the T3 genomic effect, on the FAS promoter between –741 and –696 bp that mediates the T3 genomic effect. We show that both T3 and insulin regulate FAS transcription via this sequence. The TRE binds a TR/RXR heterodimer even in the absence of hormone, and this binding is increased in response to T3 and/or insulin treatment. The use of H7, a serine/threonine kinase inhibitor, reveals that a phosphorylation mechanism is implicated in the transcriptional regulation of FAS in response to both hormones. Specifically, we show that T3 is able to modulate FAS transcription via a nongenomic action targeting the TRE through the activation of a PI 3-kinase-ERK1/2-MAPK-dependent pathway. Insulin also targets the TRE sequence, probably via the activation of two parallel pathways: Ras/ERK1/2 MAPK and PI 3-kinase/Akt. Finally, our data suggest that the nongenomic actions of T3 and insulin are probably common to several TREs, as we observed similar effects on a classical DR4 consensus sequence.
fatty acid synthase; triiodothyronine; insulin; triiodothyronine response element; phosphoinositide 3-kinase; extracellular signal-regulated kinase-1/2 mitogen-activated protein kinase
LIPOGENESIS CONVERTS DIETARY CARBOHYDRATES to fatty acids primarily in liver (28). Insulin and triiodothyronine (T3) are involved in mediating the effects of diet on lipogenesis in vivo (34). Hepatic lipogenesis is increased in hyperthyroid states or in response to T3 injection (10, 15, 19, 24, 25, 28, 62, 71, 76, 83) as well as in hyperinsulinemic subjects (80). In vivo, these two hormones are also involved in the long-term regulation of lipogenic enzymes activities such as fatty acid synthase (37).
Fatty acid synthase (FAS; EC.2.3.1.85) is a key enzyme in hepatic lipogenesis. In the presence of NADPH, this multifunctional enzyme catalyzes the conversion of acetyl-CoA and malonyl-CoA into long-chain saturated fatty acids such as palmitate and stearate (92). The de novo synthesis of fatty acids in human and chicken takes place mainly in the liver (30, 58), whereas in rodents the adipose tissue is also lipogenic (30). In vertebrates, FAS is a homodimer made of two identical peptide chains of
260 kDa (85, 91), located in the cytoplasm of the cell (31). FAS is encoded by a unique gene that generates only one mRNA in mouse (73) and two in chicken and rat, as a result of alternative splicing (3). In the liver, the activity of FAS, like most lipogenic enzymes (95), is regulated through nutrients and hormones. Starvation causes a decrease in the activity of the enzyme, and refeeding restores it (3, 67). A similar effect of refeeding is also observed on the mRNA expression level and stability, as well as on the transcription (3, 41, 48, 52, 66). It was also shown that insulin (74) and T3 (84, 95) increase the FAS mRNA expression level, whereas glucagon (50, 74, 82), medium-chain fatty acids (MCFA) (77), and polyunsaturated fatty acids (PUFA) decrease it (9, 17, 43, 65).
Insulin increases FAS transcription by modifying the binding of various transcription factors on the insulin response element (IRE) located on the promoter (74). The effect of insulin is mediated by the activation of the phosphoinositide (PI) 3-kinase/Akt pathway (93). The first IRE characterized is an E-box, which binds the ubiquitous transcription factors USF1 and USF2 (upstream stimulatory factors), located at –65 bp on the FAS promoter (69, 94). Insulin also increases transcription of FAS by inducing the binding of sterol regulatory element (SRE)-binding protein (SREBP)-1c to two different SREs, one located around –150 bp (51) and the other at –65 bp (51). Finally, insulin also regulates FAS transcription by increasing the binding of NF-Y and Sp1 to the –103-bp to –53-bp region (64).
Various studies from A. G. Goodridge's laboratory (84, 95) showed that T3 is able to potentiate the effect of insulin on FAS transcription through an unknown mechanism. T3 is known to regulate gene transcription via the binding of hormone/receptor complexes to T3 response elements (TREs) located on the promoter of a variety of genes (96). The TREs are located, for the most part, upstream of the minimal promoter but can sometimes be located on the 3' end of the coding sequence (8). A consensual hexameric sequence, (G/A)GGT(C/G)A, was defined. This sequence can be a palindrome (TREpal),a direct repeat (DR), or an inverted palindrome (IP) (32). These TREs bind the T3 receptors (TRs) belonging to the nuclear receptor superfamily (53). The latter can form homodimers or interact with other nuclear receptors, such as RXR (retinoid X receptor), to form heterodimers (11, 27). The heterodimers bind preferentially to DRs separated by four nucleotides (DR4) (75). This increases the transcriptional activity in response to T3 in a more efficient manner than the TR/TR homodimers (39, 47). With regard to the FAS gene, the sequence alignment of different species (mouse, rat, and chicken) suggests the presence of a DR4-type TRE on the promoter (59).
Previous studies suggest that a general increase in the phosphorylation state of the cell would maximize the T3 action by activating the transcription of target genes (42, 61, 88). The TR and RXR receptors, as well as different coactivators, can be targets of these phosphorylation events. In particular, TR can be phosphorylated in the cytosol (33) by caseine kinase II but also in the nucleus (86). This phosphorylation would initiate TR heterodimerization with RXR (7) or could also protect it from degradation, which in turn would increase transcription (89). It has also been shown that SRC1, a TR coactivator, can be phosphorylated by MAP kinase through the activation of membrane-bound receptors (78).
It becomes more apparent that thyroid hormones (THs) regulate transcription via a nongenomic mechanism (5, 63) by activating different intracellular signaling cascades. Cao et al. showed that, in human fibroblasts, T3 was able to activate the PI 3-kinase/PKB/mToR/p70S6K pathway via a direct cytosolic interaction between TR and the PI 3-kinase regulatory subunit p85
(14). Moreover, previous studies have demonstrated that thyroid hormone is able of binding an integrin
(V)β (3) cell surface receptor leading to the activation of a PKC
(1, 6, 21, 60). Subsequently, ERK1/2 MAPK is activated and translocated into the nucleus (22, 81), where it can phosphorylate the TR (22, 81).
In the present study, we show that, at the hepatic level, insulin and T3 act synergistically to stimulate FAS activity. The effect of T3 on FAS is mainly transcriptional and mediated by the binding of a TR/RXR heterodimer on a DR4-type TRE. On top of that, our study reveals that the T3 action on the TRE also involves a nongenomic action through the activation of a PI 3-kinase- and ERK1/2 MAPK-dependent signaling pathway. Finally, our study also suggests that insulin is able to modulate the transcriptional activity of the TRE through the activation of a PI 3-kinase/Akt and/or a Ras/Raf-ERK1/2 MAPK signaling pathway.
 |
MATERIALS AND METHODS
|
|---|
Materials.
The restriction enzymes, the thyroxine (T4) DNA ligase, and the T4 polynucleotide kinase were obtained from New England Biolabs (Pickering, CA). The Taq polymerase was acquired from PerkinElmer (Wellesley, MA). Eggs from white Leghorn chickens were purchased from Couvoir Simentin (Mirabel, QC, Canada). HepG2 cells were purchased from ATCC (Manassas, VA). Minimum Essential Medium (MEM), Waymouth medium, 3,5,3-L-triiodothyronine, insulin, H7, and genistein were obtained from Sigma. LY-294002, PD-98059, and U-0126 inhibitors were purchased from Calbiochem (EMD Biosciences, San Diego, CA). [
-32P]ATP was purchased from PerkinElmer. Fugene HD transfecting agent, CAT-ELISA kit, collagenase H, and Klenow enzyme were obtained from Roche Diagnostic (Laval, QC, Canada). Fetal bovine serum was purchased from Cansera (Etobicoke, ON, Canada). Antibodies [Akt, anti-phospho-Akt (Ser273), p42/44 MAPK, anti-phospho-p42/44 MAPK (Thr202/204)] were acquired from Cell Signaling Technology (Danvers, MA). Anti-TR
1/Trβ1 and anti-RXR
/β/
antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Unless otherwise stated in the text, all other chemicals were purchased from Sigma.
Plasmid constructs.
The goose FAS promoter was graciously provided by Dr. A. G. Goodridge (44). This cosmid contained 46 kb of the FAS gene, including 12 kb downstream of the transcription initiation site. The first 1.6 kb of the FAS promoter were cloned into the pJFCAT1 vector, which incorporates the chloramphenicol acetyl tranferase (29) reporter gene. The –902-bp to –577-bp fragment, containing the FAS TRE, was PCR amplified using specific primers containing HindIII and BamHI restriction sites at their extremities. The amplified fragment was subsequently inserted into the pBLCAT2 vector upstream of the thymidine kinase (88) minimal promoter and the CAT reporter gene. The synthetic sequence of the classical TRE DR4 (AGCTTAGCTTCAGGTCACAGGAGGTCAGAGAGG) was cloned into the pBLCAT2 vector using the HindIII and SalI restriction sites.
Cell culture and transfection.
Chick embryo hepatocytes (CEH) were isolated from livers of 19-day-old chick embryos (35) (protocol no. 590 approved by the University Animal Care Commmittee). Cells (2.5 x 106) were plated in 35-mm tissue dishes and cultured at 40°C under 5% CO2 in Waymouth medium supplemented with streptomycin (100 µg/ml) and penicillin (60 µg/ml). After 24 h, the medium was removed by aspiration and replaced by medium supplemented with T3 and/or insulin and incubated for different periods of time, as indicated in the figure legends. For the experiment using kinase inhibitors, the CEH were incubated with the hormones after a 30-min preincubation period with the various inhibitors (0.5% DMSO, 5 µM genistein, 25 µM H7, 50 µM PD-98059, 50 µM LY-294002, and 20 µM U-0126). The human hepatocarcinoma cells (HepG2) were cultured in MEM supplemented with streptomycin (100 µg/ml), penicillin (60 µg/ml), FBS (10%), and glutamine (4 mM final). The day before transfection, the cells were plated at 80% confluence (
6 x 105 cells per well). The cells were then incubated for 24 h with 7 µl of Fugene HD, 1.5 µg of the different DNA constructs tested, and 0.5 µg of pRSV-β-galactosidase in the absence of serum and antibiotics. The medium was then replaced with one containing antibiotics and serum, and hormones were added as indicated in the figure legends. After 24 h of culture, the cells were harvested and the different cellular extracts prepared.
FAS activity.
FAS activity was measured by tracking the decrease of absorbance at 340 nm, which is the result of NADPH disappearance due to the conversion of malonyl-CoA and acetyl-CoA into long-chain fatty acids (36). Following hormonal stimulation, two to three plates of treated cells (
10 x 106 cells) were harvested in 1x PBS. After a short centrifugation, the cells were resuspended in cold homogenization buffer (0.1 M KPi, pH 7, 3 mM EDTA, pH 7, and 1 mM DTT). The cytosolic extracts were prepared through homogenization of the cells with a Dounce homogenizer. The lysates were subsequently centrifuged at 3,000 rpm for 15 min at 4°C. The FAS activities was evaluated by mixing, in a Quartz cuvette, 50 µl of cell lysate, 0.1 M KPi, pH 7, 0.0025 mM acetyl-CoA, 0.18 mM NADPH, 3 mM EDTA, and 1 mM DTT. The reaction was initialized by adding 0.1 mM of malonyl-CoA. The OD at 340 nm was then recorded for a 15-min period at 40°C in a Cary-100 spectrophotometer (Varian, Quebec, Canada).
Analysis of mRNA expression level.
Total RNA was extracted from CEH as previously described (16). UV-quantified RNA were diluted in DEPC-treated water at a final concentration of 1 µg/µl. Reverse transcription (RT) was performed using the Omniscript enzyme kit of Qiagen (Montreal, QC, Canada) and oligo(dT) (Roche Diagnostics, Quebec, Canada) for 1 h at 37°C, with a 5-min inactivation step at 93°C. qPCRs were then performed using the QuanitTect SYBR Green PCR Kit from Qiagen and the LightCycler device (Roche Diagnostics). The HPRT-1 gene was used as reference. The relative quantification was then performed using the RelQuant software (Roche Diagnostics). For the FAS gene, primers were defined on goose sequences: AGGAAATGAGGCTGCGTTG (sense) and CTGAGTGCTTCACGGTTGATG (antisense), and for the HPRT-1 gene primers were defined on human sequences: ATGACCTCTCAACCTTGACTGG (sense) and GGCCACTTTCACCATCTTTG (antisense).
Analysis of promoter activity.
HepG2 cells were lysed at room temperature in 500 µl of CAT Elisa lysis buffer (Roche Diagnostics). Protein concentration (12) and β-galactosidase activity (79) were measured by the indicated methods. CAT activity was evaluated using the CAT-ELISA kit according to the manufacturer's instructions (Roche Diagnostics). The results were expressed as CAT activity per milligram of soluble protein and then normalized for transfection efficiency using the β-galactosidase activity.
Gel electrophoretic mobility shift assay.
HepG2 cells were incubated for 24 h in serum-free MEM with or without 100 mM insulin, 1.6 µM T3, or both hormones, and nuclear extracts were prepared as previously described (2). A 40-bp double-stranded oligonucleotide corresponding to the TRE sequence of the goose FAS gene (TGCCCTGCCCGCCGCCCTGTGGTAACCTCGGGACCGCGCT) was labeled with [
-32P]ATP using the T4 polynucleotide kinase. Nuclear extract (5 µg) was incubated with 2 µl of binding buffer containing 20,000 cpm of 32P-labeled probe, 10 ng of poly(dI-dC), 1 µl of BSA, 4% (vol/vol) glycerol, and 1% (vol/vol) Ficoll. The reaction was then incubated for 15 min at room temperature. For supershift experiments, nuclear extracts were preincubated for 15 min at room temperature with 2 µg of specific antibody or with IgG. The reaction mixtures were then subjected to electrophoresis on a 6% polyacrylamide gel at 150 V in 25 mM Tris·HCl, 0.19 M glycine, and 1 mM EDTA. Gels were dried and visualized by autoradiography using the phosphoimager system (Molecular Imager FX; Bio-Rad, Mississauga, ON, Canada).
Western blot.
After treatment with the test agents, for the times and the concentrations indicated in the figure legends, CEH were rinsed twice with ice-cold phosphate-buffered saline (pH 7.4) and solubilized with lysis buffer [50 mM HEPES, pH 7.5, 150 mM NaCl, 10 mM sodium pyrophosphate, 100 mM sodium fluoride, 1.5 mM MgCl2, 1 mM EGTA, 200 µM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, tablet of EDTA free complete mini (Roche Diagnostics), 10% glycerol, and 1% Triton X-100]. Cell lysates were clarified by centrifugation at 10 000 g for 20 min at 4°C, and protein concentrations, in the resulting supernatants were determined using the Bradford method (12). Twenty micrograms of protein from cell lysates was mixed with 4 µl of 3x Laemmli sample buffer [2% SDS, 2% β-mercaptoethanol, 10% (vol/vol) glycerol, and 50 mg/ml bromophenol blue in 0.1 M Tris·HCl buffer, pH 6.8], heated at 100°C for 5 min, subjected to SDS-PAGE, and then transferred to Immobilon-P membranes (Millipore) for immunoblotting. Membranes were incubated for 1 h in blocking buffer (1x TBS + 0,1% Tween 20 TBST) containing 5% milk and then overnight at 4°C in TBST-5% BSA with the various antibodies: FAS (1:1,000), GAPDH (1:1,000), Akt (1:1,000), phospho-Akt (1:1,000), p42/44 MAPK (1:1,000), and phospho-p42/44 MAPK (1:1,000). After three consecutive washes in 1x TBST, the membranes were incubated in 1x TBST with 5% milk in the presence of an anti-rabbit IgG bound to horseradish peroxidase (1:10,000). Signals were revealed using the ECL Plus Western blotting detection reagent according to the manufacturer's instructions (GE Healthcare, Baie d'Urfé, QC, Canada). The appropriate bands were quantified using the
-phospho-imager system (Molecular imager FX, Bio-Rad).
 |
RESULTS
|
|---|
Roles of T3 and insulin on FAS enzymatic activity and protein and mRNA levels.
Various studies have already demonstrated that, in liver, T3 and insulin are able to increase FAS enzymatic activity and mRNA expression (87, 88, 95). Incubation of the human HepG2 cells with 10 nM, 100 nM, or 1.6 µM T3 for 24 h significantly increases the level of FAS protein expression. Addition of 100 nM insulin also leads to a similar level of increase, whereas a combination of the two hormones is synergistic (Fig. 1A). Most of the subsequent experiments were performed using 1.6 µM T3 and 100 nM insulin. In CEH, insulin and T3 are able to increase FAS enzymatic activity about threefold (Fig. 1B), and in the presence of both hormones an important synergistic effect is also observed, increasing the activity 14-fold. Similar hormonal effects are observed on mRNA expression level (2.5-fold increase with T3 or insulin and 10-fold with both hormones; Fig. 1C). Taken together, these results suggest that T3 and insulin regulate FAS expression through a pretranslational mechanism.
Effects of insulin and T3 at the transcriptional level.
To evaluate whether the effects of T3 and insulin are the result of a modulation of the FAS promoter's transcriptional activity, we cloned the proximal fragment (
1.5kb upstream of the cap site, –1450 to +133 bp) of the goose FAS promoter upstream of the chloramphenicol acetyltranferase (29) reporter gene. Subsequently, this DNA construct (TRE-TK-CAT) was transiently transfected into HepG2 cells, and the CAT activity was evaluated in the presence or not of the two hormones. As depicted in Fig. 2A, having T3 in the medium increases the transcription of the FAS gene about threefold. This suggests that a TRE is present in the first 1450 bp of the FAS promoter. By 5' serial deletions, we localized the TRE between –902 and –577 bp (data not shown). This sequence, containing the TRE, was then inserted upstream of the minimal promoter of thymidine kinase and the CAT reporter gene and transiently transfected into the cells. When the cells were treated with T3, we observed about a threefold increase in CAT activity. Comparing the goose FAS sequence with that of different species, we were able to accurately localize the TRE between –741 and –696 bp (Fig. 2B). Astonishingly, insulin was also able to increase FAS transcription (
1.5-fold) through this TRE, and in the presence of both hormones the transcription increased more than fourfold (Fig. 2A). Interestingly, the same hormonal effects were obtained when cells were transfected with a classical synthetic TRE (DR4-TK-CAT). These results suggest that both T3 and insulin are able to increase 1) FAS transcription through a specific TRE and 2) the transcriptional activity of a classical DR4 element.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2. Localization of the T3 response element (TRE) on the goose FAS gene promoter. A: HepG2 cells were transiently transfected with various CAT DNA constructs (left, 1.5 µg/well) and pRSV-βGal (0.5 µg/well) as described in MATERIALS AND METHODS. After removal of transfection medium, hepatocytes were incubated for 24 h in MEM (open bars) or in the same medium containing 1.6 µM T3 (hatched bars), 100 nM insulin (filled bars), or both (cross-hatched bars). CAT activities were measured using a CAT ELISA kit. Results are expressed as CAT activities normalized by β-galactosidase activity/mg soluble protein, are represented as a percentage of the activity measured in the respective untreated sample, and are the mean of 3 independent experiments ±SD. *P < 0.05 vs. untreated cells. B: sequence comparison of goose FAS promoter (H: AY391824
[GenBank]
) to human (H: 250144), mouse (M: AL663090
[GenBank]
), rat (X: X54871
[GenBank]
), and chicken (C: X77339
[GenBank]
) FAS promoters. Conserved bases in the TRE between the 5 species are underlined.
|
|
To characterize and identify the transcription factors involved in the hormonal response at the promoter level, we carried out electrophoretic mobility shift assay (EMSA) experiments. For this we used a double-stranded oligonucleotide encompassing the –741 to –696 bp sequence of the goose FAS promoter as a probe (Fig. 3A). This 32P-labeled probe was incubated with the nuclear extracts prepared from HepG2 cells treated or not with T3 and/or insulin. As indicated in Fig. 3B, in presence of nuclear extracts, a retarded band is observed in all conditions (even in the absence of hormonal treatment), suggesting that nuclear proteins are able to bind this 40-bp sequence. Following T3 or insulin treatment, binding of the nuclear proteins is increased (
1.5-fold compared with untreated cells; Fig. 3B). When both hormones were added together, the binding was even stronger (2.5-fold compared with untreated cells; Fig. 3B). By adding specific antibodies directed against TR and RXR to the nuclear extracts, we were able to show that the retarded band either disappeared or was substantially decreased. This suggests that a TR/RXR heterodimer was formed on the FAS TRE, even in the absence of hormonal stimulation, whereas in the presence of T3, insulin, or both the binding of this heterodimer is increased.
Role of phosphorylation in the regulation of FAS.
As previously described, treatments of hepactic cells by T3 and insulin for 24 h strongly induce FAS protein expression (Fig. 1A) and activity (Fig. 1B). However, when insulin is added first in the medium for 10 h followed by a T3 treatment for 14 h, the level of FAS induction is much weaker (only twofold; Fig. 4A). This is equivalent to the level of the stimulation observed in presence of a single hormone. But when T3 is added first for 10 h followed by an insulin treatment for 14 h, FAS enzymatic activity is increased sixfold. This may suggest that additional mechanisms are required to fully induce FAS activity.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4. Role of phosphorylation in the regulation of FAS activity and transcription in response to T3 and insulin treatments. A: CEH were incubated for 24 h without hormone (open bar) or with 100 nM insulin for 10 h and then for 14 h with 1.6 µM T3 (hatched bar) or with 1.6 µM T3 for 10 h and subsequently for 14 h with 100 nM insulin (filled bar). Crossed-hatched bar corresponds to incubation of cells for 24 h in the presence of both hormones. FAS activities were measured as indicated in MATERIALS AND METHODS. Results are expressed as a percentage of the activity measured in the untreated sample, and are the mean of at least 3 independent experiments ±SD. *P < 0.0001 vs. 24 h of treatment with both insulin and T3. B: CEH were incubated for 24 h without hormone (basal) or with 1.6 µM T3, 100 nM insulin, or both. Thirty minutes before hormonal stimulation, cells were preincubated with 0.5% DMSO (filled bars) or 5 µM genistein (cross-hatched bars). FAS activities were measured as indicated in MATERIALS AND METHODS. Results are expressed as a percentage of untreated cells (basal) incubated with DMSO and are the mean of 3 independent experiments. C: CEH were incubated as described above, except that 25 µM H7 was used instead of genistein (crossed-hatched bars). D: HepG2 cells were transfected with TRE-TK-CAT construction, as described in Fig. 2. Cells were then incubated for 24 h without hormone (basal) or with 1.6 µM T3, 100 nM insulin, or both. Thirty minutes before hormonal stimulation, cells were preincubated with 0.5% DMSO (filled bars) or 5 µM genistein (cross-hatched bars). E: HepG2 cells were incubated as described above, except that 25 µM H7 was used instead of genistein (crossed-hatched bars). In both cases, CAT activities were measured as described in Fig. 2. Results are expressed as a percentage of untreated cells (basal) incubated with DMSO and are the mean of 3 independent experiments ±SD. *P < 0.005, DMSO condition vs. treatments with kinase inhibitors.
|
|
T3 and Insulin can activate specific intracellular signaling pathways leading to various phosphorylation cascades, resulting in the transcriptional modulation of numerous genes (5, 68). For that reason, CEH were incubated with a general inhibitor of either tyrosine kinase (genistein) or serine/threonine kinase (H7). The effects of these inhibitors were subsequently evaluated on the T3- and insulin-induced FAS enzymatic activity. Genistein does not statistically modify FAS activity (Fig. 4B), whereas H7 strongly decreases it and this under all hormonal treatments (Fig. 4C). The effect of those inhibitors was subsequently tested on FAS transcription by transfecting the TRE-TK-CAT construct in HepG2 cells. Similar effects of both genistein (Fig. 4D) and H7 (Fig. 4E) were observed on the FAS TRE transcriptional activity. Taken together, our results suggest that phosphorylation mechanisms involving serine/threonine kinases are required to ensure optimal effects of T3 and insulin on the regulation of FAS transcription via the TRE.
Role of the PI 3-kinase and ERK1/2 MAPK pathways in the regulation of FAS in response to T3 and insulin.
It is well known that in liver both T3 and insulin are able to activate various cellular signaling pathways, such as the PI 3-kinase/Akt and/or ERK1/2-MAPK pathways (21, 68). To evaluate the implication of such pathways in FAS regulation in response to these two hormones, we measured FAS enzymatic activity in the presence of specific pharmaceutical inhibitors for each pathway. Preincubation of T3 and insulin-treated CEH cells with LY-290042, a PI 3-kinase inhibitor, or PD-98059, a MEK1/2 inhibitor, strongly decreases FAS enzymatic activity (Fig. 5A). The inhibitors have similar or even more pronounced effects on the FAS promoter activity, generated by the TRE-TK-CAT construct transiently transfected in HepG2 cells (Fig. 5B). Interestingly, identical results were obtained when HepG2 cells were transiently transfected with the DR4-TK-CAT construct (Fig. 5C). Together, these results suggest that PI 3-kinase and/or ERK1/2 MAPK are implicated in the transcriptional regulation of gene transcription in response to T3 and insulin, and this through a TRE (FAS TRE and the classical DR4 element).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 5. Effects of LY-294002 and PD-98059 on FAS activity and TRE-mediated transcription in response to T3 and insulin treatments. A: CEH were incubated for 24 h without hormones (basal) or with 1.6 µM T3, 100 nM insulin, or both. Thirty minutes before hormonal stimulations, cells were preincubated with 0.5% DMSO (filled bars), 50 µM LY-294002 (hatched bars), or 50 µM of PD-98059 (cross-hatched bars). FAS activities were measured as indicated in MATERIALS AND METHODS. Results are expressed as a percentage of untreated cells (basal) incubated with DMSO and are the mean of 3 independent experiments ±SD. *P < 0.005, DMSO condition vs. treatments with kinase inhibitors. HepG2 cells were transfected with TRE-TK-CAT (B) or DR4-TK-CAT construct (C), as previously described in Fig. 2. Cells were then incubated for another 24 h without hormones (basal) or with 1.6 µM T3, 100 nM insulin, or both. Thirty minutes before hormonal stimulation, cells were preincubated with 0.5% DMSO (filled bars), 50 µM LY-294002 (hatched bars), or 50 µM PD-98059 (cross-hatcheded bars). CAT activities were measured as described in Fig. 2. Results are expressed as a percentage of untreated cells (basal) incubated with DMSO and are the mean of 3 independent experiments ±SD. *P < 0.005, DMSO condition vs. treatments with kinase inhibitors.
|
|
To clarify the implication of the two kinases in each hormonal effect, we measured the level of phosphorylation of ERK1/2 MAPK and Akt in response to T3 and insulin when submitted to the specific pharmacological inhibitors. As indicated in Fig. 6A, T3 increases ERK1 phosphorylation level on Thr202/204 residues. This effect is observed at both 100 nM and 1.6 µM of T3. As depicted in Fig. 6B, the maximal T3 effect is detected at 10 min, declining rapidly thereafter. The ERK2 phosphorylation level is not substantially modified by T3. Following an insulin treatment, a maximal phosphorylation of ERK1 is observed at 10 min, which is sustained up to 90 min. Similarly to T3, insulin does not modify ERK2 phosphorylation. When the cells are treated with both hormones, the stimulation profile is identical to the one observed with insulin alone.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 6. Effect of T3 and insulin on the level of ERK1/2 MAPK phosphorylation. A: CEH were serum deprived for 48 h and incubated for 10 min with 100 nM or 1.6 µM T3. B: CEH were serum deprived for 48 h and then incubated for different periods of time (0, 10, 30, 40, 60 and 90 min) with 1.6 µM T3 (top), 100 nM insulin (middle), or both (bottom). Cells were then lysed, and cytosolic proteins were separated on a 10% SDS-PAGE and submitted to Western blotting with an antibody recognizing the phosphorylated form of ERK1/2 MAPK (P-p44) or an antibody recognizing total ERK1/2 MAPK (p44). Autoradiographs are representative of 3 different experiments.
|
|
We then evaluated the level of T3 and insulin-induced ERK1 phosphorylation in the presence of the pharmaceutical inhibitors. As depicted in Fig. 7A, the T3-induced stimulation is lost with U-0126 or PD-98059 as well as with LY-294002. However, in presence of insulin or with both hormones, only MEK inhibitors, and not LY-290042, decrease ERK1 phosphorylation (Fig. 7, B and C, respectively). It is interesting to note that, with all hormonal stimulations, ERK1/2 phosphorylation is totally inhibited by U-0126, whereas PD-98059 did so only partially (Fig. 7, B and C). This is in agreement with the study that demonstrated that U-0126 is 100-fold more potent than PD-98059 in inhibiting ERK1/2 phosphorylation (26).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 7. Effect of PD-98059, U-0126, and LY-294002 on T3- and insulin-induced ERK1/2 MAPK phosphorylation. CEH were serum deprived for 48 h and then preincubated for 30 min with 50 µM PD-98059, 20 µM U-0126, or 50 µM LY-294002 followed by 10 min of incubation with 1.6 µM T3 (A), 100 nM insulin (B), or both (C). Cells were then lysed, and levels of ERK1/2 phosphorylation were evaluated as described in Fig. 6. Autoradiographs are representative of 3 different experiments.
|
|
We then evaluated the effects of those hormones on the phosphorylation state of Akt on Ser473 residue (Fig. 8). As expected, the presence of insulin increase Akt phosphorylation at both 10 and 30 min, whereas no phosphorylation was detected with T3. Incubating the cells with both hormones reveals a pattern similar to that observed with insulin alone.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 8. Effect of T3 and insulin on the level of Akt phosphorylation. CEH were serum deprived for 48 h and then incubated with 1.6 µM T3, 100 nM insulin, or both. Cells were then lysed, and cytosolic proteins were separated on a 10% SDS-PAGE and submitted to Western blotting with an antibody recognizing the Akt phosphorylated form (top) or one recognizing the total Akt protein (bottom). Autoradiograph is representative of 3 different experiments.
|
|
In conclusion, our results suggest that T3 and insulin are able to activate FAS transcription through the TRE. T3 acts on this TRE through a genomic action via the direct binding of the TR/RXR heterodimer. It also acts via a nongenomic action, involving the activation of a PI 3-kinase/ERK1/2 MAPK-dependent pathway. On the other hand, insulin modulates FAS transcription through the same TRE. However, it happens through the activation of two parallel signaling pathways: via a PI 3-kinase/Akt-dependent pathway and/or via a pathway involving ERK1/2 MAPK. Finally, we also showed that the implications of these signaling cascades are not restricted to the FAS promoter but appear to be a general phenomenon, as the same effects are observed on a classical DR4 element.
 |
DISCUSSION
|
|---|
In agreement with previously published studies performed in CEH (84, 95), we showed that T3 and insulin were able to increase FAS enzymatic activity (
3-fold; Fig. 1A) and mRNA expression level (
2.5-fold; Fig. 1C) in both CEH and HepG2 cells. Insulin alone was also identified as a potent FAS activator in mouse models (74). As demonstrated in CEH (84, 95), the presence of the two hormones synergistically stimulated FAS in chicken as well as in human models (Fig. 1). It therefore appears that FAS expression is similarly regulated in different species.
Other studies suggest that the hormonal regulation of FAS is principally pretranslational, probably as a result of the transcriptional modulation of gene expression (73, 74, 84). The transcriptional regulation of FAS by insulin has been well characterized. In 3T3-L1 cells, it was shown that insulin increases FAS transcription through the activation of the PI 3-kinase/Akt-dependent pathway (93). The insulin effect is mediated through the modification of the binding of various transcription factors to insulin response elements located on the FAS promoter (74). An IRE has been identified at –65 bp on the rat FAS promoter (69, 94). It is an E-box that binds the ubiquitous transcription factors USF1 and USF2 (upstream stimulatory factors). In addition, insulin also increases mouse FAS gene transcription by inducing the binding of SREBP-1c on two different SREs located around –150 bp (51) and –65 bp (46). Finally, insulin regulates FAS transcription through the modulation of the binding of NF-Y and Sp1 on the FAS rat promoter region located between –103 to –53 bp (64).
In goose, and probably in other species, we show that insulin also modulates FAS promoter activity by targeting a TRE located between –717 and –701 bp, increasing the binding of a TR/RXR heterodimer (Fig. 3B). Interestingly, a similar phenomenon was observed with a classical DR4 element, suggesting a general effect of insulin on TREs (Figs. 2A and 5C). The action of insulin on the TRE seems to involve the activation of two distinct signaling pathways (PI 3-kinase/Akt and Ras-Raf-ERK1/2 MAPK). The activation of these two pathways may induce the phosphorylation of TR and/or various coactivators resulting in the increase binding of TR/RXR on the TRE (Fig. 3B). However, the exact contribution of these insulin-induced pathways on the FAS TRE remains to be elucidated.
In the present study, we also characterized the mechanism of T3 action on the FAS promoter. We localized a TRE on the goose FAS promoter between –717 and –701 bp. This TRE is a direct-repeat sequence separated by four nucleotides (DR4). It is well conserved among species, suggesting a similar type of regulation (59). Moreover, our results show that, in the presence of insulin and T3, only a weak synergistic effect on TRE-mediated transcription is observed compared with what is seen at the mRNA level and enzymatic activity. This may indicate that the previously identified IREs located downstream on the TRE are necessary to achieve a full stimulation of FAS activity and expression.
Through mobility shift assays, we showed that a TR/RXR heterodimer binds to the TRE even without hormonal stimulation. Adding T3 and/or insulin increases the heterodimer's binding (Fig. 3B). Many studies have shown that the TR/RXR heterodimer binds with better affinity to a DR4-type TRE (75). The four-nucleotide space helps stabilize the TR/RXR complex, leading to increased transactivation (32, 90). The binding of the complex to the TRE, in absence of hormones, could involve FAS basal repression, as previously described for many other genes positively regulated by T3 (97). In this case, the TR/RXR complex would interact with TFIIB (4, 38), interfering with the formation of the transcription preinitializing complex. This basal repression is also maintained through the association of TFIIB with corepressors (40, 54). The presence of hormone would lead to a conformational change, inducing the dissociation of corepressors, and the binding of coactivators, such as the p160/SRC protein (steroid receptor coactivator) (72), the p300/CBP complex (CREB-binding protein) (49), and PCAF (p300.CBP-associated factor) (49). The binding of co-activators on the TR/RXR complex leads to the maximum induction of gene transcription in response to T3.
The classic genomic action of thyroid hormone is well known. Its effect is delayed, appearing only after a few hours of hormonal stimulation. Various studies reported a faster effect of T3, in particular in the control of Ca2+ entry or in protein trafficking (20, 23). In fact, the research demonstrated that the hormone could act through a nongenomic action mechanism, also called extranuclear action, and involves the activation of various signaling cascades (63). Using various hormonal combinations of T3 and insulin, our present study suggests that phosphorylation mechanisms are also involved in the transcriptional regulation of FAS via the TRE (Fig. 4A). This was confirmed by the use of the Ser/Thr kinase inhibitor H7 (Fig. 4, C and E). Previous studies have also shown that the use of H8, another protein kinase inhibitor, decreases insulin- and T3-induced FAS mRNA level in CEH (88). On the other hand, it was shown in various tissues that a general increase of the cell's phosphorylation level, through the use of protein phosphatase inhibitor, induces an increase in the transcription of T3-regulated genes (42, 61). A similar mechanism was described for steroid hormones.
In hepatic cells, we showed that T3 is able to activate the ERK1/2 MAPK pathway through the activation of PI 3-kinase (Figs. 6 and 7). Recently, it has been demonstrated that T3 activates ERK1/2 by two different mechanisms. One is independent of PI 3-kinase, activating cell proliferation, whereas the other is PI 3-kinase dependent, involving various actions such as protein trafficking (86a). The exact mechanism by which T3 activates PI 3-kinase in liver leading to ERK1/2 MAPK activation remains to be determined. In human fibroblasts, in the presence of T3, the TRβ receptor is able to directly interact with p85
, the regulatory subunit of PI 3-kinase, leading to downstream activation of Akt, mToR, and p70S6K (63). This cascade activates the transcription of the ZAK1-4
gene in response to T3 (13). At the hepatic level, we showed that T3 activates PI 3-kinase but not Akt (Fig. 8). In general, activation of PI 3-kinase leads to Akt activation; however, PI 3-kinase needs to be recruited to the plasma membrane to adequately activate Akt (18, 70). But in the presence of T3, TR specifically interacts with the cytosolic p85
regulatory subunit of PI 3-kinase (14). In adult rat alveolar epithelial cells, T3 increased Na-K-ATPase activity in a transcription-independent manner via the activation of two distinct pathways: the PI 3-kinase (56) and the ERK1/2 MAPK pathway (55). They also demonstrated that T3 stimulates the PI 3K-Akt pathway via the Src family of tyrosine kinases.
Independently of PI 3-kinase, thyroid hormones can also bind to an integrin
(V)β (3) cell surface receptor, leading to the activation of ERK1/2 MAPK and its nuclear translocation (6, 21). In the nucleus, ERK1/2 MAPK phosphorylates TR (22, 81), leading to the dissociation of the SMRT and NCor corepressors. Subsequently, this will increase the degradation of the corepressors and induce the transcription (42, 57, 89). TR phosphorylation would also help the heterodimerization with RXR, increasing the binding of the TR/RXR complex to the TRE (7, 45). The SRC-1 coactivators, which are recruited to the TR transcriptional complex, have also been described to be a target of ERK1/2 MAPK (78). In addition, the MAPK/TR complex would also be able to bind and phosphorylate the p53 (81) and STAT transcription factors (60), modulating the transcription of other target genes.
In conclusion, in the present study we have shown (Fig. 9) that, in hepatic cells, T3 regulates the transcription of FAS through a genomic action involving the binding of a TR/RXR heterodimer to the T3 response element. Moreover, T3 can also act via a nongenomic mechanism, involving the activation of PI 3-kinase, which subsequently activates ERK1/2-MAPK, increasing FAS transcription. On the other hand, the binding of insulin on its membrane receptor leads to the activation of both PI 3-kinase/Akt and Ras/Raf/ERK1/2-MAPK signaling pathways, activating FAS transcription via the TRE.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 9. Schematic representation of FAS transcriptional regulation in response to T3 and insulin. Binding of insulin on its membrane receptor leads to activation of PI 3-kinase/Akt and Ras/Raf/ERK1/2 MAPK pathways, both targeting the IRE and probably the TRE localized on the FAS promoter (stippled arrows). T3 can regulate transcription of the FAS gene directly via a genomic mechanism through the binding of TR/RXR heterodimer at the TRE level. However, T3 can modulate the TRE transcriptional activity via a nongenomic mechanism and, through the activation of a PI 3-kinase/ERK1/2 MAPK-dependent pathway (full arrows).
|
|
 |
GRANTS
|
|---|
This work was supported by the National Sciences and Engineering Research Council of Canada.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: C. Mounier, Département des Sciences Biologiques, Centre de recherche BioMed, Université du Québec, CP 8888, Succursale Centreville, Montreal, Canada H36 3P8 (e-mail: mounier.catherine{at}uqam.ca)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Alisi A, Spagnuolo S, Napoletano S, Spaziani A, Leoni S. Thyroid hormones regulate DNA-synthesis and cell-cycle proteins by activation of PKCalpha and p42/44 MAPK in chick embryo hepatocytes. J Cell Physiol 201: 259–265, 2004.[CrossRef][Web of Science][Medline]
- Andrews NC, Faller DV. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19: 2499, 1991.[Free Full Text]
- Back DW, Goldman MJ, Fisch JE, Ochs RS, Goodridge AG. The fatty acid synthase gene in avian liver. Two mRNAs are expressed and regulated in parallel by feeding, primarily at the level of transcription. J Biol Chem 261: 4190–4197, 1986.[Abstract/Free Full Text]
- Baniahmad A, Ha I, Reinberg D, Tsai S, Tsai MJ, O'Malley BW. Interaction of human thyroid hormone receptor beta with transcription factor TFIIB may mediate target gene derepression and activation by thyroid hormone. Proc Natl Acad Sci USA 90: 8832–8836, 1993.[Abstract/Free Full Text]
- Bassett JH, Harvey CB, Williams GR. Mechanisms of thyroid hormone receptor-specific nuclear and extra nuclear actions. Mol Cell Endocrinol 213: 1–11, 2003.[CrossRef][Web of Science][Medline]
- Bergh JJ, Lin HY, Lansing L, Mohamed SN, Davis FB, Mousa S, Davis PJ. Integrin alphaVbeta3 contains a cell surface receptor site for thyroid hormone that is linked to activation of mitogen-activated protein kinase and induction of angiogenesis. Endocrinology 146: 2864–2871, 2005.[CrossRef][Web of Science][Medline]
- Bhat MK, Ashizawa K, Cheng SY. Phosphorylation enhances the target gene sequence-dependent dimerization of thyroid hormone receptor with retinoid X receptor. Proc Natl Acad Sci USA 91: 7927–7931, 1994.[Abstract/Free Full Text]
- Bigler J, Eisenman RN. Novel location and function of a thyroid hormone response element. EMBO J 14: 5710–5723, 1995.[Web of Science][Medline]
- Blake WL, Clarke SD. Suppression of rat hepatic fatty acid synthase and S14 gene transcription by dietary polyunsaturated fat. J Nutr 120: 1727–1729, 1990.[Abstract/Free Full Text]
- Blennemann B, Moon YK, Freake HC. Tissue-specific regulation of fatty acid synthesis by thyroid hormone. Endocrinology 130: 637–643, 1992.[Abstract/Free Full Text]
- Bogazzi F, Hudson LD, Nikodem VM. A novel heterodimerization partner for thyroid hormone receptor. Peroxisome proliferator-activated receptor. J Biol Chem 269: 11683–11686, 1994.[Abstract/Free Full Text]
- Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254, 1976.[CrossRef][Web of Science][Medline]
- Cao X, Kambe F, Miyazaki T, Sarkar D, Ohmori S, Seo H. Novel human ZAKI-4 isoforms: hormonal and tissue-specific regulation and function as calcineurin inhibitors. Biochem J 367: 459–466, 2002.[CrossRef][Web of Science][Medline]
- Cao X, Kambe F, Moeller LC, Refetoff S, Seo H. Thyroid hormone induces rapid activation of Akt/protein kinase B-mammalian target of rapamycin-p70S6K cascade through phosphatidylinositol 3-kinase in human fibroblasts. Mol Endocrinol 19: 102–112, 2005.[Abstract/Free Full Text]
- Castellani LW, Wilcox HC, Heimberg M. Relationships between fatty acid synthesis and lipid secretion in the isolated perfused rat liver: effects of hyperthyroidism, glucose and oleate. Biochim Biophys Acta 1086: 197–208, 1991.[Medline]
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.[Web of Science][Medline]
- Clarke SD, Armstrong MK, Jump DB. Dietary polyunsaturated fats uniquely suppress rat liver fatty acid synthase and S14 mRNA content. J Nutr 120: 225–231, 1990.[Abstract/Free Full Text]
- Dai Y, Wei Z, Sephton CF, Zhang D, Anderson DH, Mousseau DD. Haloperidol induces the nuclear translocation of phosphatidylinositol 3'-kinase to disrupt Akt phosphorylation in PC12 cells. J Psychiatry Neurosci 32: 323–330, 2007.[Web of Science][Medline]
- Das DK, Ganguly M. Mechanism of the control of pulmonary and hepatic fatty acid synthesis by the thyroid hormones. Arch Biochem Biophys 218: 142–155, 1982.[CrossRef][Web of Science][Medline]
- Davis PJ, Davis FB. Nongenomic actions of thyroid hormone on the heart. Thyroid 12: 459–466, 2002.[CrossRef][Web of Science][Medline]
- Davis PJ, Leonard JL, Davis FB. Mechanisms of nongenomic actions of thyroid hormone. Front Neuroendocrinol 29: 211–218, 2008.[Web of Science][Medline]
- Davis PJ, Shih A, Lin HY, Martino LJ, Davis FB. Thyroxine promotes association of mitogen-activated protein kinase and nuclear thyroid hormone receptor (TR) and causes serine phosphorylation of TR. J Biol Chem 275: 38032–38039, 2000.[Abstract/Free Full Text]
- Davis PJ, Tillmann HC, Davis FB, Wehling M. Comparison of the mechanisms of nongenomic actions of thyroid hormone and steroid hormones. J Endocrinol Invest 25: 377–388, 2002.[Web of Science][Medline]
- Dayton S, Dayton J, Drimmer F, Kendall FE. Rates of acetate turnover and lipid synthesis in normal, hypothyroid and hyperthyroid rats. Am J Physiol 199: 71–76, 1960.[Abstract/Free Full Text]
- Diamant S, Gorin E, Shafrir E. Enzyme activities related to fatty-acid synthesis in liver and adipose tissue of rats treated with triiodothyronine. Eur J Biochem 26: 553–559, 1972.[Web of Science][Medline]
- Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk DE, Pitts WJ, Earl RA, Hobbs F, Copeland RA, Magolda RL, Scherle PA, Trzaskos JM. Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem 273: 18623–18632, 1998.[Abstract/Free Full Text]
- Forman BM, Casanova J, Raaka BM, Ghysdael J, Samuels HH. Half-site spacing and orientation determines whether thyroid hormone and retinoic acid receptors and related factors bind to DNA response elements as monomers, homodimers, or heterodimers. Mol Endocrinol 6: 429–442, 1992.[Abstract/Free Full Text]
- Freake HC, Schwartz HL, Oppenheimer JH. The regulation of lipogenesis by thyroid hormone and its contribution to thermogenesis. Endocrinology 125: 2868–2874, 1989.[Abstract/Free Full Text]
- Friedman JE, Ishizuka T, Shao J, Huston L, Highman T, Catalano P. Impaired glucose transport and insulin receptor tyrosine phosphorylation in skeletal muscle from obese women with gestational diabetes. Diabetes 48: 1807–1814, 1999.[Abstract]
- Gandemer G, Pascal G, Durand G. [De novo lipogenesis: kinetics of in vivo incorporation of tritiated water 3H into fatty acids and total lipids of the liver, plasma, adipose tissue and carcass of the male rat]. CR Seances Acad Sci D 290: 1479–1482, 1980.
- Gibson DM, Titchener EB, Wakil SJ. Studies on the mechanism of fatty acid synthesis. V. Bicarbonate requirement for the synthesis of long-chain fatty acids. Biochim Biophys Acta 30: 376–383, 1958.[Medline]
- Glass CK. Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev 15: 391–407, 1994.[Abstract/Free Full Text]
- Glineur C, Bailly M, Ghysdael J. The c-erbA alpha-encoded thyroid hormone receptor is phosphorylated in its amino terminal domain by casein kinase II. Oncogene 4: 1247–1254, 1989.[Web of Science][Medline]
- Goodridge AG. Dietary regulation of gene expression: enzymes involved in carbohydrate and lipid metabolism. Annu Rev Nutr 7: 157–185, 1987.[CrossRef][Web of Science][Medline]
- Goodridge AG. Regulation of fatty acid synthesis in isolated hepatocytes prepared from the livers of neonatal chicks. J Biol Chem 248: 1924–1931, 1973.[Abstract/Free Full Text]
- Goodridge AG. Regulation of the activity of acetyl coenzyme A carboxylase by palmitoyl coenzyme A and citrate. J Biol Chem 247: 6946–6952, 1972.[Abstract/Free Full Text]
- Goodridge AG, Carpenter WR, Fisch JE, Goldman MJ, Kameda K, Stapleton SR. Structure and regulation of the avian gene for fatty acid synthase. Reprod Nutr Dev 29: 359–375, 1989.[CrossRef][Web of Science][Medline]
- Hadzic E, Desai-Yajnik V, Helmer E, Guo S, Wu S, Koudinova N, Casanova J, Raaka BM, Samuels HH. A 10-amino-acid sequence in the N-terminal A/B domain of thyroid hormone receptor alpha is essential for transcriptional activation and interaction with the general transcription factor TFIIB. Mol Cell Biol 15: 4507–4517, 1995.[Abstract]
- Hallenbeck PL, Marks MS, Lippoldt RE, Ozato K, Nikodem VM. Heterodimerization of thyroid hormone (TH) receptor with H-2RIIBP (RXR beta) enhances DNA binding and TH-dependent transcriptional activation. Proc Natl Acad Sci USA 89: 5572–5576, 1992.[Abstract/Free Full Text]
- Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, et al. Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377: 397–404, 1995.[CrossRef][Web of Science][Medline]
- Iritani N, Nishimoto N, Katsurada A, Fukuda H. Regulation of hepatic lipogenic enzyme gene expression by diet quantity in rats fed a fat-free, high carbohydrate diet. J Nutr 122: 28–36, 1992.[Abstract/Free Full Text]
- Jones KE, Brubaker JH, Chin WW. Evidence that phosphorylation events participate in thyroid hormone action. Endocrinology 134: 543–548, 1994.[Abstract/Free Full Text]
- Jump DB, Clarke SD, Thelen A, Liimatta M, Ren B, Badin M. Dietary polyunsaturated fatty acid regulation of gene transcription. Prog Lipid Res 35: 227–241, 1996.[CrossRef][Web of Science][Medline]
- Kameda K, Goodridge AG. Isolation and partial characterization of the gene for goose fatty acid synthase. J Biol Chem 266: 419–426, 1991.[Abstract/Free Full Text]
- Katz D, Reginato MJ, Lazar MA. Functional regulation of thyroid hormone receptor variant TR alpha 2 by phosphorylation. Mol Cell Biol 15: 2341–2348, 1995.[Abstract]
- Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, Solanes G, Lowell BB, Spiegelman BM. Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J Clin Invest 101: 1–9, 1998.[Web of Science][Medline]
- Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM. Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature 355: 446–449, 1992.[CrossRef][Web of Science][Medline]
- Kurokawa R, Yu VC, Naar A, Kyakumoto S, Han Z, Silverman S, Rosenfeld MG, Glass CK. Differential orientations of the DNA-binding domain and carboxy-terminal dimerization interface regulate binding site selection by nuclear receptor heterodimers. Genes Dev 7: 1423–1435, 1993.[Abstract/Free Full Text]
- Kwok RP, Lundblad JR, Chrivia JC, Richards JP, Bachinger HP, Brennan RG, Roberts SG, Green MR, Goodman RH. Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370: 223–226, 1994.[CrossRef][Web of Science][Medline]
- Lakshmanan MR, Nepokroeff CM, Porter JW. Control of the synthesis of fatty-acid synthetase in rat liver by insulin, glucagon, and adenosine 3':5' cyclic monophosphate. Proc Natl Acad Sci USA 69: 3516–3519, 1972.[Abstract/Free Full Text]
- Latasa MJ, Griffin MJ, Moon YS, Kang C, Sul HS. Occupancy and function of the –150 sterol regulatory element and –65 E-box in nutritional regulation of the fatty acid synthase gene in living animals. Mol Cell Biol 23: 5896–5907, 2003.[Abstract/Free Full Text]
- Laux T, Schweizer M. Dietary-induced pre-translational control of rat fatty acid synthase. Biochem J 266: 793–797, 1990.[Web of Science][Medline]
- Lazar MA. Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14: 184–193, 1993.[Abstract/Free Full Text]
- Lee JW, Choi HS, Gyuris J, Brent R, Moore DD. Two classes of proteins dependent on either the presence or absence of thyroid hormone for interaction with the thyroid hormone receptor. Mol Endocrinol 9: 243–254, 1995.[Abstract/Free Full Text]
- Lei J, Mariash CN, Bhargava M, Wattenberg EV, Ingbar DH. T3 increases Na-K-ATPase activity via a MAPK/ERK1/2-dependent pathway in rat adult alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 294: L749–L754, 2008.[Abstract/Free Full Text]
- Lei J, Mariash CN, Ingbar DH. 3,3',5-Triiodo-L-thyronine up-regulation of Na,K-ATPase activity and cell surface expression in alveolar epithelial cells is Src kinase- and phosphoinositide 3-kinase-dependent. J Biol Chem 279: 47589–47600, 2004.[Abstract/Free Full Text]
- Leitman DC, Costa CH, Graf H, Baxter JD, Ribeiro RC. Thyroid hormone activation of transcription is potentiated by activators of cAMP-dependent protein kinase. J Biol Chem 271: 21950–21955, 1996.[Abstract/Free Full Text]
- Leveille GA, O'Hea EK, Chakbabarty K. In vivo lipogenesis in the domestic chicken. Proc Soc Exp Biol Med 128: 398–401, 1968.[CrossRef][Medline]
- Li H, Gu Y, Zhang Y, Lucas MJ, Wang Y. High glucose levels down-regulate glucose transporter expression that correlates with increased oxidative stress in placental trophoblast cells in vitro. J Soc Gynecol Investig 11: 75–81, 2004.[Web of Science][Medline]
- Lin HY, Davis FB, Gordinier JK, Martino LJ, Davis PJ. Thyroid hormone induces activation of mitogen-activated protein kinase in cultured cells. Am J Physiol Cell Physiol 276: C1014–C1024, 1999.[Abstract/Free Full Text]
- Lin KH, Ashizawa K, Cheng SY. Phosphorylation stimulates the transcriptional activity of the human beta 1 thyroid hormone nuclear receptor. Proc Natl Acad Sci USA 89: 7737–7741, 1992.[Abstract/Free Full Text]
- Llobera M, Muniesa A, Herrera E. Effects of hypo- and hyper-thyroidism on in vivo lipogenesis in fed and fasted rats. Horm Metab Res 11: 628–634, 1979.[Web of Science][Medline]
- Losel RM, Falkenstein E, Feuring M, Schultz A, Tillmann HC, Rossol-Haseroth K, Wehling M. Nongenomic steroid action: controversies, questions, and answers. Physiol Rev 83: 965–1016, 2003.[Abstract/Free Full Text]
- Magana MM, Koo SH, Towle HC, Osborne TF. Different sterol regulatory element-binding protein-1 isoforms utilize distinct co-regulatory factors to activate the promoter for fatty acid synthase. J Biol Chem 275: 4726–4733, 2000.[Abstract/Free Full Text]
- Moon YS, Latasa MJ, Griffin MJ, Sul HS. Suppression of fatty acid synthase promoter by polyunsaturated fatty acids. J Lipid Res 43: 691–698, 2002.[Abstract/Free Full Text]
- Morris SM Jr, Nilson JH, Jenik RA, Winberry LK, McDevitt MA, Goodridge AG. Molecular cloning of gene sequences for avian fatty acid synthase and evidence for nutritional regulation of fatty acid synthase mRNA concentration. J Biol Chem 257: 3225–3229, 1982.[Abstract/Free Full Text]
- Morris SM Jr, Winberry LK, Fisch JE, Back DW, Goodridge AG. Developmental and nutritional regulation of the messenger RNAs for fatty acid synthase, malic enzyme and albumin in the livers of embryonic and newly-hatched chicks. Mol Cell Biochem 64: 63–68, 1984.[CrossRef][Web of Science][Medline]
- Mounier C, Posner BI. Transcriptional regulation by insulin: from the receptor to the gene. Can J Physiol Pharmacol 84: 713–724, 2006.[CrossRef][Web of Science][Medline]
- Moustaid N, Beyer RS, Sul HS. Identification of an insulin response element in the fatty acid synthase promoter. J Biol Chem 269: 5629–5634, 1994.[Abstract/Free Full Text]
- Murata H, Hresko RC, Mueckler M. Reconstitution of phosphoinositide 3-kinase-dependent insulin signaling in a cell-free system. J Biol Chem 278: 21607–21614, 2003.[Abstract/Free Full Text]
- Nejad NS, Chaikoff IL, Hill R. Hormonal repair of defective lipogenesis from glucose in the liver of the hypophysectomized rat. Endocrinology 71: 107–112, 1962.[Web of Science][Medline]
- Onate SA, Tsai SY, Tsai MJ, O'Malley BW. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270: 1354–1357, 1995.[Abstract/Free Full Text]
- Paulauskis JD, Sul HS. Cloning and expression of mouse fatty acid synthase and other specific mRNAs. Developmental and hormonal regulation in 3T3-L1 cells. J Biol Chem 263: 7049–7054, 1988.[Abstract/Free Full Text]
- Paulauskis JD, Sul HS. Hormonal regulation of mouse fatty acid synthase gene transcription in liver. J Biol Chem 264: 574–577, 1989.[Abstract/Free Full Text]
- Perlmann T, Rangarajan PN, Umesono K, Evans RM. Determinants for selective RAR and TR recognition of direct repeat HREs. Genes Dev 7: 1411–1422, 1993.[Abstract/Free Full Text]
- Roncari DA, Murthy VK. Effects of thyroid hormones on enzymes involved in fatty acid and glycerolipid synthesis. J Biol Chem 250: 4134–4138, 1975.[Abstract/Free Full Text]
- Roncero C, Goodridge AG. Hexanoate and octanoate inhibit transcription of the malic enzyme and fatty acid synthase genes in chick embryo hepatocytes in culture. J Biol Chem 267: 14918–14927, 1992.[Abstract/Free Full Text]
- Rowan BG, Weigel NL, O'Malley BW. Phosphorylation of steroid receptor coactivator-1. Identification of the phosphorylation sites and phosphorylation through the mitogen-activated protein kinase pathway. J Biol Chem 275: 4475–4483, 2000.[Abstract/Free Full Text]
- Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor, 2000.
- Schwarz JM, Linfoot P, Dare D, Aghajanian K. Hepatic de novo lipogenesis in normoinsulinemic and hyperinsulinemic subjects consuming high-fat, low-carbohydrate and low-fat, high-carbohydrate isoenergetic diets. Am J Clin Nutr 77: 43–50, 2003.[Abstract/Free Full Text]
- Shih A, Lin HY, Davis FB, Davis PJ. Thyroid hormone promotes serine phosphorylation of p53 by mitogen-activated protein kinase. Biochemistry 40: 2870–2878, 2001.[CrossRef][Web of Science][Medline]
- Soncini M, Yet SF, Moon Y, Chun JY, Sul HS. Hormonal and nutritional control of the fatty acid synthase promoter in transgenic mice. J Biol Chem 270: 30339–30343, 1995.[Abstract/Free Full Text]
- Spirtes MA, Medes G, Weinhouse S. Fatty acid synthesis in hyperthyroidism. Am J Med Sci 225: 580–581, 1953.[Web of Science][Medline]
- Stapleton SR, Mitchell DA, Salati LM, Goodridge AG. Triiodothyronine stimulates transcription of the fatty acid synthase gene in chick embryo hepatocytes in culture. Insulin and insulin-like growth factor amplify that effect. J Biol Chem 265: 18442–18446, 1990.[Abstract/Free Full Text]
- Stoops JK, Arslanian MJ, Oh YH, Aune KC, Vanaman TC, Wakil SJ. Presence of two polypeptide chains comprising fatty acid synthetase. Proc Natl Acad Sci USA 72: 1940–1944, 1975.[Abstract/Free Full Text]
- Sugawara A, Yen PM, Apriletti JW, Ribeiro RC, Sacks DB, Baxter JD, Chin WW. Phosphorylation selectively increases triiodothyronine receptor homodimer binding to DNA. J Biol Chem 269: 433–437, 1994.[Abstract/Free Full Text]
- Sun N, Simone TM, Keating T, Tang HY, Lin C, Mousa SA, Lin HY, Davis FB, Davis PJ. Activation by thyroid hormone of mitogen-activated protein kinase and phosphatidylinositol 3-kinase: L-thyroxine kinase vs. 3,5,3-triiodo-L-thyronine and cancer cell proliferation. Poster Session: Basic-Steroid Nuclear Receptors (AR VDR Thyroid Receptors, MR). Endocr Soc 90th Ann Mtg., San Francisco, 2008, p. 2–16.
- Sul HS, Wang D. Nutritional and hormonal regulation of enzymes in fat synthesis: studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu Rev Nutr 18: 331–351, 1998.[CrossRef][Web of Science][Medline]
- Swierczynski J, Mitchell DA, Reinhold DS, Salati LM, Stapleton SR, Klautky SA, Struve AE, Goodridge AG. Triiodothyronine-induced accumulations of malic enzyme, fatty acid synthase, acetyl-coenzyme A carboxylase, and their mRNAs are blocked by protein kinase inhibitors. Transcription is the affected step. J Biol Chem 266: 17459–17466, 1991.[Abstract/Free Full Text]
- Ting YT, Cheng SY. Hormone-activated phosphorylation of human beta1 thyroid hormone nuclear receptor. Thyroid 7: 463–469, 1997.[Web of Science][Medline]
- Umesono K, Murakami KK, Thompson CC, Evans RM. Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65: 1255–1266, 1991.[CrossRef][Web of Science][Medline]
- Wakil SJ. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry 28: 4523–4530, 1989.[CrossRef][Web of Science][Medline]
- Wakil SJ, Stoops JK, Joshi VC. Fatty acid synthesis and its regulation. Annu Rev Biochem 52: 537–579, 1983.[CrossRef][Web of Science][Medline]
- Wang D, Sul HS. Insulin stimulation of the fatty acid synthase promoter is mediated by the phosphatidylinositol 3-kinase pathway. Involvement of protein kinase B/Akt. J Biol Chem 273: 25420–25426, 1998.[Abstract/Free Full Text]
- Wang D, Sul HS. Upstream stimulatory factors bind to insulin response sequence of the fatty acid synthase promoter. USF1 is regulated. J Biol Chem 270: 28716–28722, 1995.[Abstract/Free Full Text]
- Wilson SB, Back DW, Morris SM Jr, Swierczynski J, Goodridge AG. Hormonal regulation of lipogenic enzymes in chick embryo hepatocytes in culture Expression of the fatty acid synthase gene is regulated at both translational and pretranslational steps. J Biol Chem 261: 15179–15182, 1986.[Abstract/Free Full Text]
- Yen PM. Physiological and molecular basis of thyroid hormone action. Physiol Rev 81: 1097–1142, 2001.[Abstract/Free Full Text]
- Yen PM, Darling DS, Carter RL, Forgione M, Umeda PK, Chin WW. Triiodothyronine (T3) decreases binding to DNA by T3-receptor homodimers but not receptor-auxiliary protein heterodimers. J Biol Chem 267: 3565–3568, 1992.[Abstract/Free Full Text]
Copyright © 2008 by the American Physiological Society.