| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
B activation via NADPH oxidase1Department of Internal Medicine, University of Missouri-Columbia; 2Harry S. Truman Memorial Veterans Affairs Medical Center, Columbia, Missouri; 3Wake Forest University School of Medicine, Winston-Salem, North Carolina; 4Diabetes Research Program, Department of Medicine, University of Arizona; and 5Southern Arizona Veterans Affairs Health Care System, Tucson, Arizona
Submitted 16 July 2007 ; accepted in final form 7 December 2007
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
B activation, and TNF-
expression, which were attenuated by in vivo treatment with an angiotensin type 1 receptor blocker (valsartan) or SOD/catalase mimetic (tempol). Moreover, ANG II treatment of L6 myotubes induced NF-B activation and TNF- production and decreased insulin-stimulated Akt activation and GLUT-4 glucose transporter translocation to plasma membranes. These effects were markedly diminished by treatment of myotubes with valsartan, the antioxidant N-acetylcysteine, NADPH oxidase-inhibiting peptide (gp91 ds-tat), or NF-B inhibitor (MG-132). Similarly, NF-B p65 small interfering RNA reduced NF-B p65 subunit expression and nuclear translocation and TNF- production but improved insulin-stimulated phosphorylation (Ser473) of Akt and translocation of GLUT-4. These findings suggest that NF-B plays an important role in ANG II/ROS-induced skeletal muscle insulin resistance.
nuclear factor-B; reduced nicotinamide adenine dinucleotide phosphate; renin-angiotensin system; reactive oxygen species; TG(mRen2)27 rat; tumor necrosis factor-; angiotensin receptor blocker
75–95% of insulin-mediated glucose disposal (26). Skeletal muscle insulin signaling involves insulin binding to its receptor and, subsequently, a series of postreceptor phosphorylation events, including the activation of Akt (protein kinase B) (24). Therefore, factors, such as angiotensin II (ANG II), that impair this signaling processes cause insulin resistance and contribute to systemic glucose intolerance (2, 16, 28).
The renin-angiotensin system (RAS) plays a vital role in regulating blood pressure and the pathogenesis of hypertension and cardiovascular disease. Recent evidence indicates that inhibition of RAS not only improves cardiovascular outcomes but may have metabolic benefits as well; e.g., angiotensin-converting enzyme inhibitors or ANG II type 1 receptor (AT1R) blockers increase insulin sensitivity (3, 9, 29, 31) and reduce onset of type 2 diabetes mellitus compared with other antihypertensive agents (25). Adverse effects of the RAS appear to act directly on skeletal muscle, since interstitial infusion of ANG II has been shown to induce insulin resistance that is independent of vascular effects, whereas ANG II also impairs insulin signaling in cultured myotubes (19, 30). ANG II has prooxidant effects, in that it induces generation of reactive oxygen species (ROS). We have shown that ROS mediate ANG II-induced skeletal muscle insulin resistance and glucose intolerance in the transgenic TG(mRen2)27 (Ren-2) hypertensive rat, which harbors the mouse renin gene and exhibits elevated tissue ANG II levels (3). Yet the intermediate steps linking ROS to insulin resistance in skeletal muscle remain unknown. It is known that ROS activates multiple transcription factors, including NF-B (10, 13). NF-B activation is involved in high-fat diet-induced liver insulin resistance in mice (5). However, it has not been determined whether ANG II activates skeletal muscle NF-B, thereby providing a potential mechanism for ANG II-induced insulin resistance. In the present study, we employed Ren-2 rats and ANG II-treated myotubes to determine the role of ROS-mediated NF-B activation in blunting insulin effects on skeletal muscle. Our results suggest that ANG II-induced ROS generation via NADPH oxidase activates NF-B, which in turn contributes to skeletal muscle insulin resistance.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
, NF-B p65, IB, Akt, phosphorylated (Ser473) Akt, and glucose transporters (GLUT-4 and GLUT-1) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA), Upstate Signaling Technology (Beverly, MA), Abcam (Cambridge, MA), and Cell Signaling (Beverly, MA); antibody against the Na-K-ATPase 1-subunit from Upstate Biotechnology (Lake Placid, NY); rat TNF- ELISA detection kit from R & D Systems (Minneapolis, MN); NF-B NoShift assay kit from Novagen, EMD Biosciences (San Diego, CA); ANG II, human insulin, and NADPH from Sigma (St. Louis, MO); and DMEM, FBS, and antibiotic-antimycotic solution (10,000 U/ml penicillin G, 10 mg/ml streptomycin, and 25 mg/ml amphotericin B) from GIBCO Invitrogen. The peptide gp91 ds-tat is a generous gift from Dr. Patrick Pagano (Henry Ford Research Institute and Hospital, Detroit, MI), and the scrambled small interfering RNA (siRNA) as control was purchased from Bio-Synthesis (Lewisville, TX) with or without a fluorescent tag (carboxytetramethylrhodamine). Animals and treatments. Male Ren-2 and Sprague-Dawley (SD) rats were received at 5–6 wk of age from Bowman Gray School of Medicine (Wake Forest University, Winston-Salem, NC). Animal protocols were reviewed and approved by the Harry S. Truman Veterans Affairs Medical Center Animal Care Committee. After a short period of adaptation, Ren-2 rats were randomly assigned to treatment with the AT1R blocker valsartan (RV group; 30 mg·kg–1·day–1) or the SOD/catalase mimetic tempol (RT group; 1 mM) in their drinking water for 21 days or remained untreated (RC group). These animals were compared with age-matched, untreated SD rats. The rats were weighed and anesthetized with pentobarbital sodium (Nembutal, 35 mg/kg ip), and soleus muscles were dissected and trimmed and frozen in liquid nitrogen and stored at –80°C, fixed, or homogenized for further analysis (see below).
Cell culture.
L6 rat skeletal muscle cells (American Type Culture Collection) were grown in DMEM with 10% (vol/vol) FBS and 1% (vol/vol) antibiotic-antimycotic solution at 5% CO2 and 37°C until they reached 80% confluence. To induce differentiation, cells were further cultured in DMEM containing 2% FBS for 6–8 days. Cells were fed fresh medium every 48 h and used at the myotube stage (60–70%), when GLUT-4 expression is highest (11). Myogenic differentiation to myotubes was confirmed by light microscopy with morphological alignment, elongation, and fusion.
Transfection of gp91 ds-tat. In selected experiments, the NAD(P)H oxidase inhibitor gp91 ds-tat and the scrambled gp91 ds-tat as a control (Bio-Synthesis, Lewisville, TX) were used. The peptide gp91 ds-tat is linked to a nine-amino acid peptide contained in human immunodeficiency virus viral coats (HIV-tat) that is internalized by all cells. The peptide interferes with the binding of the cytosolic subunit p47phox with the membrane subunit gp91phox (Nox2) and inhibits NADPH oxidase activation (18, 32). A scrambled nine-amino acid Nox2 sequence (scramb-tat) was used as a control. In some experiments, gp91 ds-tat and scramb-tat were dissolved in 0.01 mmol/l acetic acid in saline. Myotubes were incubated with gp91 ds-tat (20 µmol/l) or scramb-tat (20 µmol/l) for 1 h before ANG II incubation.
NF-B p65 siRNA transfection.
L6 myotubes were transfected with NF-B p65 siRNA or control siRNA (Santa Cruz Biotechnology) as described elsewhere (30). The differentiation medium was changed to antibiotic-free medium on day 4, and 0.6 µg of siRNA was added to the transfection medium. At 6 h after transfection, DMEM containing 4% FBS was added to each well to a final concentration of 2% FBS (vol/vol). Cells were transfected again on day 6 with 1 µg of siRNA. At 6 h after transfection, the cells were further incubated with ANG II for an additional 24 h. In some experiments, the cells were stimulated with insulin for 30 min.
Measurement of NF-B activation.
Skeletal muscles were dissected and weighed, homogenized in 6 vol of ice-cold buffer [10 mmol/l HEPES (pH 7.9), 100 mmol/l KCl, 0.1 mmol/l EDTA, 0.1 mmol/l EGTA, 0.1 mmol/l dithiothreitol, and 1 mmol/l phenylmethylsulfonyl fluoride] using a Duall homogenizer. The homogenates were centrifuged at 500 g for 30 min at 4°C. The supernatant was resuspended in NucBuster reagent, vortexed twice during incubation on ice for 5 min, centrifuged at 16,000 g for 5 min at 4°C, and washed with ice-cold PBS (7). L6 myotubes were rinsed with PBS and lysed using lysis buffer as described above. Nuclear fragments were extracted according to the manufacturer's instructions. Nuclear extract (5 µl) was mixed with 15 µl of 4x NoShift bind buffer [poly(dI-dC)·poly(dI-dC), salmon sperm DNA, and wild-type DNA] and incubated for 30 min on ice. Thereafter, 1x NoShift bind buffer (80 µl) was added to each NoShift reaction. The streptavidin plate was washed three times for 5 min with 200 µl of 11x NoShift wash buffer. Reaction solution (100 µl) was dispensed into wells of the freshly washed streptavidin plate, which was sealed with aluminum foil and incubated for 60 min at 37°C. After the washing steps, primary antibody (100 µl) was added to each well, and the sample was incubated for 60 min at 37°C. The sample was incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1,000) for 30 min at 37°C and then in the substrate trimethoxybenzoate for 15 min in the dark at room temperature. Thereafter, 100 µl of 1 N HCl were mixed into each well, and absorbance at 450 nm was measured using a plate reader spectrophotometer (model EL808, Bio-Tek).
TNF- immunofluorescence.
Soleus muscle paraffin cross sections (5 µm) were cut for TNF- staining. After they were dewaxed, the slides were blocked with 5% rabbit serum containing 1% BSA and 0.1% saponin. Then the slides were incubated with anti-TNF- (1:200 dilution) overnight at 4°C. After three washes in PBS, rabbit anti-goat IgG antibody conjugated with Alexis 468 (Molecular Probes) was added for 1 h at room temperature. The sections were extensively washed in PBS and mounted on glass slides with mounting medium (Vector), and images were acquired with a fluorescence microscope (Eclipse 50i, Nikon) using Meta Imaging software (Molecular Devices).
Western blot.
L6 myotubes were treated with ANG II (10–7 M) for 24 h in the absence or presence of losartan (10–6 M), N-acetylcysteine (NAC, 30 mM), or gp91 ds-tat (20 µM). Then, in some experiments, myotubes were stimulated with insulin (100 nM) for 15 min. Subcellular fractionation of myotubes was performed as previously described (30). Briefly, the myotubes were homogenized in homogenization buffer. The homogenate was centrifuged at 1,000 g for 30 min at 4°C. An aliquot of the supernatant (S1, as total homogenate) was frozen and stored at –80°C, and the remaining S1 was centrifuged at 12,000 g for 20 min at 4°C, yielding a pellet (mitochondria) and supernatant (S2). S2 was centrifuged at 30,000 g for 1 h at 4°C. The pellet containing the Golgi and sarcoplasmic reticulum was discarded, and the supernatant (S3) was centrifuged at 100,000 g to enrich the plasma membrane (PM) fraction in the pellet and separate the cytosolic fraction (supernatant). Protein concentrations were determined by the method of Bradford (Bio-Rad reagent). Protein (40 µg) from S2 was loaded in 10% SDS-PAGE gel and probed with rabbit anti-Akt or phosphorylated (Ser473) Akt (1:1,000 dilution) antibodies. Forty micrograms of PM-enriched fraction and total homogenate (S2) protein were subjected to 10% SDS-PAGE and immunoblotted using rabbit anti-GLUT-4 (1:1,000 dilution in 5% milk-TBS). PM enrichment was confirmed by Na-K-ATPase 1-subunit immunoblotting. An HRP-coupled secondary anti-rabbit IgG antibody was applied and reacted with enhanced chemiluminescence reagent (Amersham Life Science). The membranes were read and quantified with the Bio-Rad Molecular Imager FX Pro Plus MultiImager System. β-Actin was used as a loading control.
Measurement of 4-HNE. 4-HNE, a by-product of lipid peroxidation and marker of oxidative stress, was measured by immunofluorescence staining and Western blot using anti-4-HNE antibody. Paraffin sections (5 µm) of the soleus muscle were microwaved for 10 min for antigen retrieval and incubated with monoclonal mouse antibody against 4-HNE (OXIS) overnight at 4°C. Goat anti-mouse IgG antibody conjugated with Alexis 568 (Molecular Probe) was used as secondary antibody. The images were acquired with a laser-scanning confocal microscope (model IX70, Olympus). Soleus muscle was also homogenized on ice in homogenization buffer [50 mM phosphate buffer, 0.01 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 2 µM leupeptin, and 2 µM pepstatin A (pH 7.4)] using a Duall homogenizer. The homogenate was centrifuged at 1,000 g for 30 min at 4°C, and the supernatant (S1) was further centrifuged at 13,000 g for 20 min at 4°C, yielding supernatant (S2) and a pellet containing mitochondria. Forty micrograms of protein (S2) were loaded in SDS-PAGE gel and probed with primary antibodies (1:1,000 dilution) against 4-HNE-modified proteins. After the membrane was washed, it was incubated with HRP-conjugated secondary antibodies (1:10,000 dilution). The intensities of the immunoblot lanes were quantified using Quantity One software (Bio-Rad). β-Actin was used as a loading control.
RT-PCR amplification.
TNF- mRNA expression was measured by RT-PCR using the following primers: TGGCCCAGACCCTCACACTC (forward) and CTCCTGGTATGAAATGGCAAATC (reverse). For determination of the relative initial amounts of TNF- cDNA, the cDNA sample was serially diluted 1:5 and 1:25. GAPDH was used as a housekeeping gene to verify that the same amount of RNA was amplified. The PCR products were analyzed using a digital imaging system (Kodak).
TNF- ELISA.
L6 myotubes were stimulated with 10–9–10–5 mM ANG II, with and without inhibitors (see 
Fig. 4), for 24 h. Media samples were collected and centrifuged at 1,000 g for 30 min. TNF- was determined in supernatants using ELISA according to the manufacturer's instruction (R & D Systems).
|
|
|
|
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
Increased NF-B activation in soleus muscle from Ren-2 rats.
Oxidative stress activates multiple redox signaling pathways, including NF-B (13). To test whether increased oxidative stress induced by ANG II was associated with NF-B activation in Ren-2 skeletal muscle, nuclear fractions were isolated and NF-B p65 nuclear translocation was determined by NoShift assay. NF-B p65 nuclear translocation was significantly increased by 189% in soleus muscles from Ren-2 compared with SD rats (Fig. 2A). However, NF-B p65 nuclear translocation was greatly attenuated in muscle from Ren-2 rats treated with valsartan or tempol. Under these conditions, NF-B activation was significantly correlated (r = 0.786, P < 0.01) to 4-HNE levels in rat skeletal muscle (Fig. 2B). Moreover, decreased levels of cytosolic IB were detected in Ren-2 skeletal muscle, whereas valsartan or tempol reversed this effect (Fig. 2C).
Increased TNF- expression in soleus muscle from Ren-2 rats.
NF-B activation is known to upregulate inflammatory cytokines such as TNF- (12), whereas TNF- is a multifunctional cytokine that has been linked to insulin resistance (26). To determine whether NF-B activation in skeletal muscle is associated with an increase in the inflammatory cytokine TNF-, RT-PCR and immunostaining were performed. TNF- mRNA and protein levels were greater in skeletal muscle from Ren-2 than SD rats (Fig. 2, D and E). Again, this effect was attenuated in Ren-2 soleus muscle treated with the AT1R blocker valsartan or the superoxide scavenger tempol (Fig. 2, D and E).
ANG II-induced ROS activates NF-B in L6 myotubes.
The above-described in vivo results from Ren-2 rats suggest that increased ROS might mediate the ANG II-induced NF-B activation expression in skeletal muscle. To further evaluate this possibility, L6 myoblasts were differentiated into myotubes and then treated with ANG II alone or ANG II plus each of the following: gp91 ds-tat (a specific NADPH inhibitor peptide that blocks p47phox binding to gp91phox), valsartan (an AT1R blocker), NAC (an antioxidant), or MG-132 (an NF-B inhibitor). NF-B p65 nuclear translocation and cytosolic IB were determined by NoShift assay and immunoblot, respectively. ANG II significantly increased NF-B p65 nuclear translocation, and concomitant treatment with gp91 ds-tat, valsartan, NAC, or MG-132 inhibited ANG II-induced NF-B p65 nuclear binding activity in L6 myotubes (Fig. 3A). Furthermore, when L6 myotubes were transfected with NF-B p65 siRNA, not only was p65 subunit expression reduced (Fig. 3B), but NF-B nuclear translocation in the presence of ANG II was significantly lower than when L6 myotubes were transfected with scrambled siRNA or treated with ANG II alone (Fig. 3C). NF-B translocation with and without inhibitors was inversely associated with cytosolic IB protein levels measured by Western blotting (data not shown).
ANG II-induced NF-B activation mediated TNF- production in L6 myotubes.
ANG II induced TNF- production in a dose-dependent manner that reached statistical significance at 10–7 M ANG II compared with untreated L6 myotubes (Fig. 4A). Alternatively, coadministration of valsartan, NAC, gp91 ds-tat, or MG-132 reversed ANG II-induced TNF- production in L6 myotubes. Similarly, coadministration of the NF-B inhibitor MG-132 (Fig. 4B) or transfection of NF-B p65 siRNA (Fig. 4C) reversed ANG II-induced TNF- production in the presence of ANG II. These findings suggest that increased TNF- production by skeletal muscle in the presence of ANG II is mediated by ROS-induced NF-B activation.
Inhibition of NF-B improved insulin-mediated phosphorylation (Ser473) of Akt and translocation of GLUT-4 in L6 myotubes.
To determine whether activation of NF-B mediates ANG II-induced insulin resistance in skeletal muscle, L6 myotubes were preincubated with valsartan, NAC, gp91 ds-tat, or the NF-B inhibitor MG-132 for 1 h and then coincubated with ANG II for 24 h. Then the myotubes were exposed to insulin (100 nM) for 15 min. Phosphorylation (Ser473) of Akt and translocation of GLUT-4 to PM were measured by Western blot (Fig. 5). In these experiments, ANG II reduced insulin-mediated phosphorylation (Ser473) of Akt and translocation of GLUT-4. This inhibition was largely prevented by pretreatment with valsartan, NAC, gp91 ds-tat, or the NF-B inhibitor MG-132 (Fig. 5, A and B), suggesting that ROS-induced NF-B activation plays an important role in ANG II-induced skeletal muscle insulin resistance.
|
B p65 siRNA knockdown of p65 protein expression prevented ANG II inhibition of insulin signaling.
To further confirm the role of NF-B in ANG II-induced skeletal muscle insulin resistance, siRNA targeting NF-B subunit p65 was employed in L6 myotubes. NF-B p65 siRNA transfection significantly reduced NF-B p65 levels and inhibited ANG II-induced NF-B activation (Fig. 3, B and C) while also reversing decreases in insulin-stimulated phosphorylation (Ser473) of Akt (Fig. 5C) and translocation of GLUT-4 in L6 myotube PM (Fig. 5D). GLUT-1 transporter levels, while detected in L6 myotube PM, were not altered by ANG II (data not shown). |
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
The primary finding in this investigation is that ANG II-induced oxidative stress activates NF-B in skeletal muscle, which in turn diminishes insulin signaling and GLUT-4 translocation. This interpretation is based on the following findings. 1) ANG II-induced oxidative stress, NF-B activation, and increased TNF- were documented in skeletal muscle from insulin-resistant Ren-2 rats and ANG II-treated L6 myotubes. 2) Antioxidant treatment inhibited ANG II-induced NF-B activation and TNF- production in Ren-2 skeletal muscle and L6 myotubes. 3) ANG II inhibition of insulin-mediated Akt activation and GLUT-4 translocation in L6 myotubes was significantly attenuated by blockade of the AT1R (valsartan), antioxidant treatment (NAC), NF-B inhibition (MG-132), or NF-B p65 knockdown (siRNA; Figs. 3 and 5). Multiple sources of increased ROS are possible, but NADPH oxidase remains a leading candidate, since pretreatment of L6 cells with the specific inhibitor gp91 ds-tat reduced NF-B activation and improved GLUT-4 translocation in the presence of insulin. To our knowledge, this is the first study to document that NF-B activation mediates ANG II-induced insulin resistance in skeletal muscle in an NADPH oxidase-dependent manner. NF-B activation is known to promote increases in inflammatory cytokines, including TNF-, which have been linked to insulin resistance. Interestingly, in the present study, ANG II-induced TNF- generation in L6 myotube cultures was attenuated when the myotubes were preincubated with an antioxidant (NAC), an NADPH oxidase inhibitor (gp91 ds-tat), or an NF-B inhibitor (MG-132) or previously transfected with NF-B p65 siRNA (Fig. 4).
ANG II exerts prooxidant and proinflammatory effects that regulate cell growth, apoptosis, migration, inflammation, and fibrosis and impair insulin signaling in many tissues, including skeletal muscle (3, 17, 30). The ANG II effects on insulin signaling in skeletal muscle appear to be, at least in part, mediated by NADPH oxidase-derived ROS (30). ROS, in turn, may be an important intermediary between the ANG II/AT1R binding event and several downstream cellular outcomes. However, little information as to how ROS diminishes insulin signaling has been garnered. ROS has been shown to activate several signaling pathways, including those involving redox-sensitive transcription factors (NF-B, activating protein-1, and hypoxia inducible factor-1) (1, 27). NF-B, in turn, stimulates the expression of numerous genes, including TNF- and IL-6. It has also been shown that NF-B is involved in fatty acid-induced insulin resistance in liver and adipocytes (5, 21). Furthermore, chronic inflammation and inflammatory cytokines, such as TNF-, IL-6, and IL-8, may play a fundamental role in the pathogenesis of insulin resistance and type 2 diabetes mellitus (20). Some of the questions that have remained unanswered, particularly in skeletal muscle, include the following. 1) Does ANG II induce NF-B activation? 2) If so, does NADPH oxidase-generated ROS mediate ANG II-induced NF-B activation? 3) Does NF-B activation participate in ANG II-induced skeletal muscle insulin resistance? In the present study, skeletal muscle from insulin-resistant Ren-2 rats exhibited increased NF-B activation and TNF- production, which were reversed when the animals were treated with the AT1R blocker valsartan or the superoxide scavenger tempol. Moreover, in vitro experiments confirmed that NF-B activation was essential for perpetuation of ANG II-induced skeletal muscle insulin resistance, since NF-B inhibition with MG-132 or NF-B p65 knockdown by siRNA techniques prevented ANG II-induced reductions in insulin-mediated Akt activation and GLUT-4 translocation.
Collectively, several novel findings were demonstrated in the present investigation. 1) NF-B activation and nuclear translocation are required for ANG II-induced insulin resistance in skeletal muscle. 2) ANG II increased NF-B activation and TNF- production, which were dependent on NADPH oxidase-derived ROS. 3) Blocking the AT1R, inhibiting NADPH oxidase, or preventing NF-B activation attenuated TNF- increases in cultured myotubes. The data provide solid evidence indicating that NADPH oxidase-generated ROS activates NF-B, thus linking ANG II, ROS, and insulin resistance in skeletal muscle. These findings may provide important insights into the pathogenesis and potential targets for treatment that might play a pivotal role in alleviating ANG II-induced insulin resistance.
|
GRANTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
B and human disease. J Clin Invest 107: 3–6, 2001.[CrossRef][Web of Science][Medline]B. Nat Med 11: 183–190, 2005.[CrossRef][Web of Science][Medline]B kinases through phosphorylation of serine residues in the activation loops. FEBS Lett 519: 231–237, 2002.[CrossRef][Web of Science][Medline]B inhibition ameliorates angiotensin II-induced inflammatory damage in rats. Hypertension 35: 193–201, 2000. and insulin resistance: summary and future prospects. Mol Cell Biochem 182: 169–175, 1998.[CrossRef][Web of Science][Medline]B. J Biol Chem 279: 41294–41301, 2004.B: a key role in inflammatory diseases. J Clin Invest 107: 7–11, 2001.[CrossRef][Web of Science][Medline]This article has been cited by other articles:
|
|
 |
|
  L. Lavie and P. Lavie Molecular mechanisms of cardiovascular disease in OSAHS: the oxidative stress link Eur. Respir. J., June 1, 2009; 33(6): 1467 - 1484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. F. Ndisang, N. Lane, and A. Jadhav Upregulation of the heme oxygenase system ameliorates postprandial and fasting hyperglycemia in type 2 diabetes Am J Physiol Endocrinol Metab, May 1, 2009; 296(5): E1029 - E1041. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S. Ghosh, H. D. Massey, R. Krieg, Z. A. Fazelbhoy, S. Ghosh, D. A. Sica, I. Fakhry, and T. W. B. Gehr Curcumin ameliorates renal failure in 5/6 nephrectomized rats: role of inflammation Am J Physiol Renal Physiol, May 1, 2009; 296(5): F1146 - F1157. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Ndisang and A. Jadhav Heme oxygenase system enhances insulin sensitivity and glucose metabolism in streptozotocin-induced diabetes Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E829 - E841. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Mitsuishi, K. Miyashita, A. Muraki, and H. Itoh Angiotensin II Reduces Mitochondrial Content in Skeletal Muscle and Affects Glycemic Control Diabetes, March 1, 2009; 58(3): 710 - 717. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Bashan, J. Kovsan, I. Kachko, H. Ovadia, and A. Rudich Positive and Negative Regulation of Insulin Signaling by Reactive Oxygen and Nitrogen Species Physiol Rev, January 1, 2009; 89(1): 27 - 71. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wei, K. Chen, A. T. Whaley-Connell, C. S. Stump, J. A. Ibdah, and J. R. Sowers Skeletal muscle insulin resistance: role of inflammatory cytokines and reactive oxygen species Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R673 - R680. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
