AJP - Endo Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 294: E78-E87, 2008. First published October 23, 2007; doi:10.1152/ajpendo.00023.2007
0193-1849/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/1/E78    most recent
00023.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murao, K.
Right arrow Articles by Ishida, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murao, K.
Right arrow Articles by Ishida, T.

Hyperglycemia suppresses hepatic scavenger receptor class B type I expression

Koji Murao,1 Xiao Yu,1 Hitomi Imachi,1 Wen M. Cao,1 Ke Chen,1 Kensuke Matsumoto,1 Takamasa Nishiuchi,1 Norman C. W. Wong,2 and Toshihiko Ishida1

1Division of Endocrinology and Metabolism, Department of Internal Medicine, Faculty of Medicine, Kagawa University, Kagawa, Japan; and 2Departments of Medicine and Biochemistry and Molecular Biology, Faculty of Medicine, University of Calgary, Health Sciences Center, Calgary, Alberta, Canada

Submitted 11 January 2007 ; accepted in final form 17 October 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Hyperglycemia is a major risk factor for atherosclerotic disease. Hepatic scavenger receptor class B type I (SR-BI) binds HDL particles that mediate reverse cholesterol transport and thus lowers the risk of atherosclerosis. Here we examined glucose regulation of SR-BI gene expression in both HepG2 cells and whole animals. Results showed that hepatic SR-BI mRNA, protein, and uptake of cholesterol from HDL were halved following 48 h of exposure to 22.4 vs. 5.6 mM glucose. As in the case of the cell culture model, hepatic expression of SR-BI was lower in diabetic rats than in euglycemic rats. Transcriptional activity of the human SR-BI promoter paralleled endogenous expression of the gene, and this activity was dependent upon the dose of glucose. Next, we used inhibitors of select signal transduction pathways to demonstrate that glucose suppression of SR-BI was sensitive to the p38 MAPK inhibitor. Expression of a constitutively active p38 MAPK inhibited SR-BI promoter activity in the presence or absence of glucose. A dominant-negative p38 MAPK abolished the inhibitory effect of glucose on promoter activity. Deletional analysis located a 50-bp fragment of the promoter that mediated the effects of glucose. Within this DNA fragment there were several specificity protein-1 (Sp1) binding sites, and cellular knockdown of Sp1 abrogated its suppression by glucose. Together, these results indicate that the glucose suppression of SR-B1 expression is partially mediated by the activation of the p38 MAPK-Sp1 pathway and raise the possibility that the inhibition of hepatic SR-BI expression under high-glucose conditions provides a mechanism for accelerated atherosclerosis in diabetics.

high-density lipoprotein; diabetes; atherosclerosis


EPIDEMIOLOGICAL DATA from the Framingham Study (34) and the Multiple Risk Factor Intervention Trial (50) indicate that the risk for cardiovascular death is increased two- to threefold in patients with type 2 diabetes mellitus (DM). Hyperglycemia is a major risk for cerebrovascular disease (43), and selected key pathways, factors, and mechanisms have been implicated, such as oxidant stress (4), advanced glycation end products (9), aldose reductase (23), reductive stress (24), carbonyl stress (5), and protein kinase C (PKC) activity (31), including the p38 mitogen-activated protein kinase (MAPK) pathway. The p38 MAPK protein is a member of the mitogen-activated serine/threonine protein kinase family that is activated following dual phosphorylation of Thr180 and Tyr182 by an upstream MAPK kinase. In endothelial cells, this pathway is activated by stress-inducing stimuli, including reactive oxygen species, hyperglycemia, and proinflammatory cytokines, such as tumor necrosis factor (TNF) (51). Activation of p38 MAPK regulates genes that mediate inflammation and the recruitment of other inflammatory signaling pathways such as nuclear factor-{kappa}B and arachidonate-signaling (13). Thus, activation of the p38 MAPK pathway by hyperglycemia could contribute significantly to the development of the vascular complications of diabetes (45).

Mouse scavenger receptor class B type I (SR-BI) mediates selective uptake of the high-density lipoprotein (HDL) cholesterol ester (CE) into transfected chinese hamster ovary cells. This finding (1, 33, 35) provides an important link between a specific cell surface receptor and the uptake of HDL. Our previous report (2529, 40) shows that the human homolog of SR-BI (hSR-BI), CD36 and LIMPII analogous-1 (CLA-1), like the mouse homologue, functions as a receptor for HDL. Overexpression of SR-BI in mouse liver dramatically decreases plasma HDL (35, 56) and increases hepatic, gallbladder, and biliary cholesterol concentrations (35, 48). SR-BI is a well-characterized HDL receptor that is highly expressed in the liver and in steroidogenic tissues in rodents (54). Its human orthologue CLA-1 (hSR-BI) has also been shown (40) as a receptor for HDL. Despite the fact that hSR-BI has not been studied as extensively as rodent SR-BI, the physiological role of hSR-BI is generally assumed to be similar to that of rodent SR-BI.

Several studies (3, 16, 53) have established the role of high plasma cholesterol and triglyceride levels, and of low plasma HDL levels, as risk factors for atherosclerosis in DM. HDL plays a critical role in cholesterol metabolism because it mediates a normal physiological process, namely reverse cholesterol transport (20, 52). In this process, HDL particles shuttle cholesterol from extrahepatic tissues to the liver for further metabolism and excretion (20). Several studies (36) have indicated that hSR-BI/CLA-1 stimulates hepatic uptake of HDL free cholesterol and its transport into bile. This information prompted us to speculate whether glucose further regulates hSR-BI. We expect that answers to this query may shed more light on the high risk of atherosclerotic disease in the presence of DM.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. Wortmannin, LY-294002, bisindolylmaleimide I, and SB-203580 were purchased from Calbiochem. {alpha}-Amanitin was purchased from Sigma (St. Louis, MO) and used at 2 µg/ml.

Cell culture. Human hepatoma HepG2 cells (obtained from Riken Cell Bank, Ibaragi, Japan) were grown in DMEM (Life Technologies, Tokyo, Japan) supplemented with 10% heat-inactivated fetal bovine serum (Dainippon Pharmaceutical, Osaka, Japan).

Western blot analysis. An antibody directed against the extracellular domain of hSR-BI between amino acid residues 185 and 300 of the reported sequence of the isomer containing 509 amino acid residues (10) was generated. The corresponding cDNA fragment was amplified from THP-1 cDNA by PCR. The amplified fragment was inserted into a pGEX-2T vector (Pharmacia) and sequenced, and the protein was expressed in Escherichia coli. The fusion protein was isolated with glutathione-Sepharose 4B beads (Pharmacia) and used to generate an antiserum in guinea pigs as described previously (40). The membranes were blocked with 0.1% Tween-20 in PBS containing anti-hSR-BI antibody (diluted 1/3,000 from whole antiserum) (40) or anti-GAPDH antibody (diluted 1/1,000; Biomol Research, Plymouth Meeting, PA).

Northern blot analysis. A full-length cDNA of hSR-BI was synthesized by PCR using reverse-transcribed RNA from HepG2 cells and labeled with [32P]dCTP (3,000 Ci/mmol) by the random priming method (Takara, Tokyo, Japan). Electrophoresis and hybridization were performed as described (41). Blots were also probed with human GAPDH to ensure equal loading of the RNA samples (41).

Real-time reverse transcriptase-polymerase chain reaction. Polymerase chain reactions (PCR) were performed in LightCycler (Roche, Mannheim, Germany) glass capillaries. The reaction mixture consisted of 2 µl of LightCycler-FastStart DNA Master SYBR Green I (Roche), 2 µl of the cDNA template for each gene of interest, and 1 µl of 10 µM each primer. The sequences of the forward and reverse hSR-BI primers were 5'-TTGAACTTCTGGGCAAATG-3' and 5'-TGGGGATGCCTTCAAACAC-3', respectively. The cycling program consisted of initial denaturation for 600 s at 95°C followed by 55 cycles of 95°C for 5 s, 62°C for 5 s, and 72°C for 15 s, with 20°C/s slope. Known amounts of DNA were then diluted to provide standards and a regression curve of crossing points vs. concentration generated with the LightCycler. β-Actin was used as housekeeping standard.

HDL-selective CE uptake. Human HDL (d = 1.070–1.20 g/ml) was isolated by preparative ultracentrifugation from fresh plasma collected in EDTA (1 mg/ml) as described (22). HDL was passed through a heparin-Sepharose affinity column to remove particles containing apolipoprotein E (39). The isolated lipoproteins were iodinated by the Pierce iodogen method to a specific activity of 400–600 cpm/ng protein for HDL. For specific uptake studies, the lipid moiety of human HDL was labeled with [3H]cholesterol ester ([3H]CE) and the apoA-I with 125I. The former ([3H]CE) was prepared from [3H]cholesterol and oleic anhydride, as described previously (42). Human apolipoprotein A-I was purified from HDL, labeled with 125I, and then exchanged into the [3H]HDL by a 24-h incubation at 37°C (42). The values for the selective uptake of HDL CE were obtained as previously described (40).

Transfection of HepG2 cells and luciferase reporter gene assay. The reporter construct contained the hSR-BI/CLA-1 gene sequence spanning the region from –1,200 to +2, as determined from the published sequence (11). The segment of interest was amplified using PCR and cloned into the luciferase reporter gene (pCLA-LUC). Three constructs, pCLA2-LUC, pCLA4-LUC, and pCLA6-LUC containing promoter segments –950, –476, and –209 to +2, respectively, were synthesized using the parent pCLA-LUC as a template in separate polymerase chain reactions. Purified reporter plasmid (0.5 µg/transfection) was transfected into HepG2 cells (at 60% confluence) using a conventional cationic liposome transfection method (Lipofectamine, Life Technologies, Gaithersburg, MD). All assays were corrected for β-galactosidase activity, and total amount of protein in each reaction was identical.

Immunoblotting of p38 MAPK. Cells were lysed for 10 min in ice-cold buffer A (50 mM Tris·HCl, pH 7.5, 1 mM EDTA, 1 mM EGTA, 0.5 mM Na3VO4, 0.1% 2-mercaptoethanol, 1% Triton X-100, 50 mM NaF, 5 mM sodium pyrophosphate, 10 mM Na-glycerophosphate, 0.1 mM PMSF, 1 µM microcystin, and 1 µg/ml each pepstatin, aprotinin, and leupeptin). Levels of phosphorylated and total p38 MAPK were detected with a 1:1,000 dilution of each specific antiserum (Wako).

Electrophoretic mobility shift analysis. HepG2 cells were treated with various concentration of glucose for 24 h, and nuclear extracts were prepared according to a technique described previously (41). Synthetic DNA duplexes spanning 425–395 (AATGCAACGAAACTTTGAGGCGGGGATGTGAG; synthesized by Life Technologies) from the hSR-BI gene (Nihon Bioservice, Asagiri, Japan) used in these studies were radiolabeled as described previously (41).

Plasmid preparation. An expression vector encoding a constitutively active p38 MAPK ({alpha}, β, {gamma}) and a dominant-negative mutant of p38 MAPK β (p38-DN) were kindly provided by Dr. Z. Wu (Hong Kong University of Science & Technology). An expression vector encoding specificity protein-1 (Sp1) was described previously (47).

Transfection of siRNA. The siRNAs were designed to target the following cDNA sequences: scrambled, 5'-CCGTTCTGTACAGGGAGTACT-3'; and Sp1 siRNA, 5'-AATGGCGTGCACTTTCTGCAG-3' (Santa Cruz Biotechnology, Santa Cruz, CA). Transfection of Sp1 siRNA was performed using siPORT Amine (Ambion, CA).

Protocol for diabetic animals. Four-week-old male Long-Evans Tokushima Otsuka (LETO) rats (n = 4) and Otsuka Long-Evans Tokushima Fatty (OLETF) rats (n = 4) were supplied by Tokushima Research Institute (Otsuka Pharmaceutical, Tokushima, Japan). All rats were kept in specific pathogen-free conditions at Kagawa University Animal Center in rooms controlled for both temperature and light (on from 8:00 AM to 8:00 PM). The experiments were approved by the local animal ethics committee. Some rats (LETO n = 4, OLETF n = 4) were provided with sucrose (20% sucrose solution as drinking water) for 4–20 wk of age. In OLETF rats (n = 4), food intake was restricted to 70% of average daily consumption for 8–16 wk of age. Otherwise, the rats had free access to tap water and a diet of standard chow (Clea Japan, Tokyo, Japan).

Statistical analysis. Statistical comparisons were made by one-way analysis of variance and Student's t-test, with P < 0.05 considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Effects of high-glucose conditions on hSR-BI expression in HepG2 cells. We measured the endogenous expression of SR-BI in HepG2 cells by Western blot analysis to determine whether glucose affected hSR-BI expression. There was an inverse correlation between hSR-BI expression and the concentration of glucose to which the cells were exposed. hSR-BI in the cells treated for 24 h with 22.4 mM glucose decreased to approximately one-half of that in the cells treated with the control medium containing 5.6 mM glucose (Fig. 1A); however, no such effect was observed in the cells treated with the osmotic control, i.e., mannitol.


Figure 1
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 1. Effects of glucose on human homolog of scavenger receptor class B type I (hSR-BI) expression in HepG2 cells. A: dose-dependent suppression of hSR-BI protein by glucose. HepG2 cells were seeded in 6-well plates and exposed to the indicated amounts of glucose for 24 h. hSR-BI in the total cell lysate was detected by Western blot analysis probed with an anti-hSR-BI antibody. Abundance of GAPDH served as the control and is shown at the bottom of each lane. The hSR-BI/GAPDH ratio is shown as %control in the figure. Each data point shows the mean ± SE of 3 separate experiments. *Significant difference (P < 0.01). B: hyperglycemia decreases hSR-BI mRNA expression. hSR-BI mRNA was quantified by Northern blot analysis and normalized to GAPDH mRNA. A graph showing the mean ± SE of 3 experiments for each treatment group is shown. *Significant difference (P < 0.01). C: hSR-BI mRNA stability under high-glucose treatment and the effect of high glucose on the rate of decay of hSR-BI mRNA in HepG2 cells. HepG2 cells were incubated in the medium with 5.6 mM glucose for 24 h (starting time 0 h) followed by incubation in 5.6 or 22.4 mM glucose for the indicated periods of time in the presence of 2 µg/ml of {alpha}-amanitin. RNA at each point of time was analyzed by real-time PCR methods, and relative hSR-BI mRNA abundance (normalized to β-actin mRNA) was expressed as %hSR-BI mRNA present at 0 (%maximum value), 6, 12, and 24 h. {circ}, 5.6 mM glucose + {alpha}-amanitin; bullet, 22.4 mM glucose + {alpha}-amanitin. Each data point shows the mean ± SE of 3 separate experiments.

 
To further confirm this observation, we used Northern blot analysis to assess hSR-BI/CLA-1 mRNA in the cells. Results (Fig. 1B) showed a marked decrease in the abundance of hSR-BI mRNA following treatment with 22.4 mM glucose (Fig. 1B); however, GAPDH expression remained unaltered. To understand how hSR-BI expression was downregulated by high glucose concentrations, we examined whether mRNA stability was altered (Fig. 1C). hSR-BI mRNA stability was examined in the absence or presence of high glucose concentrations after mRNA synthesis had been blocked by {alpha}-amanitin, an RNA polymerase II inhibitor. High glucose concentrations did not affect hSR-BI mRNA stability, indicating that downregulation of hSR-BI mRNA is not due to accelerated mRNA degradation. Previous reports, including reports from our laboratory (40, 42), showed that cells take up CE from HDL by a selective nonendocytotic pathway. To test whether high glucose concentration-mediated inhibition of hSR-BI expression affected this process, we measured the kinetics of CE uptake using doubly labeled HDL. Results showed that cellular HDL-CE uptake (Fig. 2) following high-glucose treatment was decreased compared with the control cells. These findings support the idea that high-glucose treatment inhibits the surface expression and function of hSR-BI in hepatocytes.


Figure 2
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 2. Selective uptake of HDL cholesterol ester (CE). The cells treated with the indicated glucose concentrations were incubated at 37°C for 1.5 h with 10 µg/ml of [125I,3H]HDL, followed by processing to determine HDL CE selective uptake. Values represent the mean of triplicate determinations. *Significant difference (P < 0.01).

 
Since glucose lowered the abundance of both hSR-BI protein and mRNA in HepG2 cells, we speculated whether glucose regulated transcriptional activity of the hSR-BI promoter in HepG2 cells. For these studies, we measured luciferase activity in the HepG2 cells transfected with pCLA-LUC and exposed to varying concentrations of glucose (Fig. 3A). In agreement with the protein and mRNA levels, high-glucose treatment also inhibited the activity of the promoter. Together these results clearly show that glucose suppresses the activity of the hSR-BI/CLA-1 gene in HepG2 cells.


Figure 3
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 3. Effect of hyperglycemia on hSR-BI transcriptional activity in HepG2 cells. A: hyperglycemia decreases hSR-BI gene transcription. HepG2 cells were transfected with 1 µg of pCLA-LUC and treated with the indicated glucose concentrations for 24 h prior to cell harvesting. All assays were corrected for β-galactosidase activity, and the total amount of protein in every reaction was identical. The results were expressed as relative luciferase activity compared with the control cells arbitrarily set at 100. Each data point shows the mean ± SE of 4 separate transfections that were performed on separate days. *Significant difference (P < 0.01 or 0.05). B: a p38 MAPK inhibitor blocks the actions of hyperglycemia; effects of the phosphatidylinositol 3-kinase inhibitors Wortmannin (WM) or LY-294002 (LY), the PKC inhibitor bisindolylmaleimide I (BIS), and the p38 MAPK inhibitor SB-203580 (SB) with 5.6 or 22.4 mM glucose on hSR-BI transcriptional activity in HepG2 cells. Vehicle: 0.1% DMSO. Each data point shows the mean ± SE of 3 separate transfections that were performed on separate days. *Significant difference (P < 0.05).

 
p38 MAPK signaling mediated high glucose-induced hSR-BI suppression. To further examine how glucose suppressed the activity of the hSR-BI gene, we postulated the potential involvement of signaling pathways. Therefore, we tested the effects of known signaling cascade inhibitors on glucose suppression of hSR-BI promoter activity. In this study, HepG2 cells were exposed to 22.4 mM glucose plus either a phosphatidylinositol 3-kinase (PI3K) inhibitor (10 µM wortmannin, WM; LY-294002), a PKC inhibitor (10 µM bisindolylmaleimide I), or a p38 MAPK inhibitor (1 µM SB203580). Results showed that the inhibitory effect of glucose on hSR-BI promoter activity persisted in the presence of PKC and PI3K inhibitors (Fig. 3B). Unexpectedly, glucose failed to suppress hSR-BI promoter activity in the presence of SB203580, a p38 MAPK inhibitor. This finding suggests that p38 MAPK may mediate high glucose-induced suppression of hSR-BI promoter activity.

Kinetics of p38 MAPK phosphorylation by high-glucose treatment. The preceding studies have shown that p38 MAPK may be required for the inhibitory effects of glucose on hSR-BI. Assuming this is true, glucose should induce p38 MAPK activity that is measurable by analyzing the kinetics of Thr180 phosphorylation by Western blot analysis. This phosphorylation is a prerequisite for induction of p38 MAPK catalytic activity. Results showed that p38 MAPK phosphorylation was evident within 15 min and peaked at 30 min following exposure of the HepG2 cells to 22.4 mM glucose (Fig. 4). These findings provide additional support that glucose induces p38 MAPK catalytic activity.


Figure 4
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 4. Hyperglycemia stimulates the phosphorylation of p38 MAPK. Cells were exposed to 22.4 mM glucose for 0, 5, 15, 30, 60, and 120 min. Abundance of phosphorylated p38 MAPK was detected by Western blot analysis of total cell protein using a phosphospecific p38 MAPK antibody (phosph-p38; top). To show equal loading of the protein in each lane, the same blot was probed a second time with a p38 MAPK-specific antibody. The phospho-p38 MAPK/p38 MAPK ratio is shown as %basal in the figure. Each data point shows the mean ± SE of 3 separate experiments.

 
p38 MAPK regulates hSR-BI promoter activity. Assuming that glucose activates p38 MAPK, which, in turn, suppresses hSR-BI promoter activity, the use of constitutively active forms of p38 MAPK should mimic the effects of glucose. To test this hypothesis, we expressed constitutively active forms of p38 MAPK (p38{alpha}, -β, and -{gamma}) in HepG2 cells carrying pCLA-LUC. Results showed that the constitutively active form of p38 MAPK suppressed hSR-BI promoter activity in the HepG2 cells (Fig. 5A). The p38 MAPK β-isoform appeared to most potently suppress hSR-BI promoter activity. The converse of this study would be on a dominant-negative mutant of p38 MAPK-β (p38-DN) to block the actions of glucose on hSR-BI promoter activity (Fig. 5B). Consistent with previous results, high-glucose treatment inhibited hSR-BI promoter activity; however, the expression of p38-DN masked the ability of high glucose to suppress hSR-BI promoter activity. Together, these findings support the idea that the p38 MAPK pathway is required for glucose suppression of hSR-BI promoter activity in HepG2 cells.


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 5. Role of p38 MAPK signal transduction pathway on hSR-BI promoter activity under conditions of hyperglycemia. A: effects of p38 MAPK isoforms on hSR-BI promoter activity. HepG2 cells were transfected with pCLA-LUC and either an empty vector (control) or expression vectors of constitutive active forms of p38 MAPK (p38-{alpha}, -β, -{gamma}) for 24 h prior to cell harvesting. All assays were corrected for β-galactosidase activity, and the total amount of protein in every reaction was identical. The results are expressed as relative luciferase activity compared with the control cells arbitrarily set at 100. Each data point shows the mean ± SE of 4 separate transfections that were performed on separate days. *Significant difference (*P < 0.01, **P < 0.005). B: dominant-negative p38 MAPK (p38-DN) blocks hyperglycemia-induced inhibition of hSR-BI transcription. HepG2 cells were transfected with pCLA-LUC and either the empty vector or p38-DN and then treated with 22.4 mM glucose for 24 h prior to cell harvesting. The results are expressed as relative luciferase activity compared with the control cells arbitrarily set at 100. Each data point shows the mean ± SE of 4 separate transfections that were performed on separate days. *Significant difference (P < 0.01). N.S., no significant difference.

 
A DNA motif mediated glucose suppression of hSR-BI promoter activity. Since the preceding data point to the hSR-BI promoter as the site of action of the p38 MAPK cascade, we searched for a cis-acting site(s) within the DNA that may mediate the effects of high glucose. Therefore, templates were created by serial deletions of the hSR-BI promoter contained within pCLA-LUC. Constructs arising from the removal of 250, 725, and 992 base pairs from pCLA-LUC yielded the templates pCLA2-LUC, pCLA4-LUC, and pCLA6-LUC, respectively. Glucose suppression of the activity of pCLA-LUC, and of the pCLA2-LUC, and pCLA4-LUC deletion constructs was indistinguishable at 40 ± 4, 50 ± 7, and 55 ± 5%, respectively (Fig. 6). However, glucose could not suppress the activity of the pCLA6-LUC deletion construct (–209 to +2). Together, these observations show that glucose suppression of hSR-BI promoter activity requires the –476 to –210 fragment of the promoter.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 6. Deletion of the –476 to –210 fragment of the hSR-BI promoter abolished the response to hyperglycemia. HepG2 cells were transfected with 1 µg of several constructs [empty vector (vector), pCLA-LUC (CLA), pCLA2-LUC (CLA2), pCLA4-LUC (CLA4), or pCLA6-LUC (CLA6)] and treated with 22.4 mM glucose for 24 h prior to cell harvesting. All assays were corrected for β-galactosidase activity, and the total amount of protein in every reaction was identical. The results are expressed as relative luciferase activity compared with the control cells arbitrarily set at 100. Each data point shows the mean ± SE of 4 separate transfections that were performed on separate days. *Significant difference (P < 0.01).

 
Sp1 mediated high glucose-induced suppression of hSR-BI gene expression. Previous studies (47) have shown that the transcription factor Sp1 may mediate the actions of glucose on hSR-BI promoter activity. Therefore, we conducted a DNA homology search that revealed the presence of six putative Sp1 binding sites within the hSR-BI promoter. To determine whether Sp1 mediates the actions of glucose on hSR-BI promoter activity, we began by measuring the abundance of the Sp1 protein in HepG2 cells by Western blot analysis following treatment with varying concentrations of glucose. Results showed that glucose induced the abundance of Sp1 in a dose-dependent manner (Fig. 7). In contrast, basal transcriptional factor TFIID was affected to a very small extent by glucose (Fig. 7A).


Figure 7
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 7. Transcriptional factor specificity protein-1 (Sp1) is involved in high-glucose treatment-induced suppression of hSR-BI transcriptional activity. A: dose-dependent induction of Sp1 protein in nuclear protein by glucose. HepG2 cells were exposed to the indicated amounts of glucose for 24 h. Sp1 in nuclear protein was detected by Western blot analysis probed with an anti-Sp1 antibody. Abundance of TFIID served as the control and is shown at the bottom of each lane. The Sp1/TFIID ratio is shown as %control in the figure. Each data point shows the mean ± SE of 3 separate experiments. *Significant difference (P < 0.01). B: effects of glucose on Sp1 binding to the Sp1 probe. Cells were exposed to varying concentrations of glucose as indicated (lane 1, only the probe; lane 2, 5.6 mM glucose; lane 3, 11.2 mM glucose; lane 4, 22.4 mM glucose) for 24 h before the nuclear extracts were prepared. The binding activity of Sp1 was examined by EMSA, as described in MATERIALS AND METHODS. Abundance of OCT1 served as the control and is shown at the bottom of each lane. An identical experiment that was independently performed yielded similar results. C: deletion of the –476 to –210 fragment of the hSR-BI promoter abolished the response to Sp1. HepG2 cells were transfected with 1 µg of several constructs (vector, CLA, CLA2, CLA4, or CLA6) and cotransfected with the Sp1 expression vector. All assays were corrected for β-galactosidase activity, and the total amount of protein in every reaction was identical. The results were expressed as relative luciferase activity compared with the control cells arbitrarily set at 100. Each data point shows the mean ± SE of 4 separate transfections that were performed on separate days. *Significant difference (P < 0.01). D: effects of Sp1 knockdown on hSR-BI promoter activity in HepG2 cells. siRNA for Sp1 or scramble siRNA (sc) was transfected into HepG2 cells with the pCLA-LUC plasmid for 24 h prior to cell harvesting. Top: efficiency of siRNA on Sp1 expression by Western blot analysis. All assays were corrected for β-galactosidase activity, and the total amount of protein in every reaction was identical. The results are expressed as relative luciferase activity compared with the control cells arbitrarily set at 100. Each data point shows the mean ± SE of 4 separate transfections that were performed on separate days. *Significant difference (P < 0.01).

 
To confirm this observation, electrophoretic mobility shift analysis (EMSA) with a specific Sp1 binding motif was performed. The Sp1 binding activities were assayed in the nuclear extracts prepared from the HepG2 cells exposed to 5.6, 11.2, or 22.4 mM glucose for 12 h. Results showed that glucose stimulated Sp1 DNA binding activity (Fig. 7B). In contrast, the DNA binding activity of the transcription factor OCT1 to its motif was not affected by glucose.

To determine whether Sp1 affects the transcriptional activity of the hSR-BI promoter and to locate the site that mediates the actions of Sp1, we cotransfected the above deletion constructs into the HepG2 cells along with the Sp1 expression vector. Results (Fig. 7C) showed that Sp1 expression inhibited the activity of pCLA-LUC, pCLA2-LUC, and pCLA4-LUC but not of pCLA6-LUC. To further explore the role of Sp1 in glucose suppression of hSR-BI promoter activity, we used siRNA to block Sp1 expression. Results showed that Sp1 expression was attenuated by a specific Sp1 siRNA but not by a scrambled siRNA (Fig. 7D). Next, the HepG2 cells were exposed to Sp1-specific or scrambled siRNA and then treated with 22.4 mM glucose. Results (Fig. 7D) showed that hSR-BI promoter activity was inhibited in the cells exposed to the control siRNA following treatment with 22.4 mM glucose. However, the inhibitory activity of 22.4 mM glucose was attenuated in the cells carrying Sp1 siRNA. These findings are in accordance with the idea that the glucose suppression of hSR-BI gene expression requires Sp1.

Effect of high glucose on hSR-BI expression in vivo. Although in vitro experiments on cultured cells, as mentioned above, have helped to elucidate the action of glucose, it remains unknown whether glucose has the same effect on an in vivo model. To answer this question, we used OLETF rats, an animal model of DM, and their lean nondiabetic counter parts, LETO rats. Sucrose feeding markedly increased blood glucose levels in OLETF rats (18.2 ± 1.2 mmol/l) compared with that in LETO rats (6.8 ± 0.4 mmol/l), as previously reported (32). We speculated whether hyperglycemia in the sucrose-fed animals would decrease hSR-BI mRNA and protein, as observed in the in vitro model. First, we measured the levels of endogenous SR-BI mRNA expression in the liver of these animals by a real-time PCR method. As expected, hepatic SR-BI mRNA in OLETF rats was decreased compared with that in the euglycemic controls (Fig. 8A). Furthermore, the abundance of the SR-BI protein also decreased in OLETF rats (Fig. 8B). These findings show that, in rats, hyperglycemia decreases hepatic SR-BI expression, and this finding is similar to the observations of the in vitro study on cultured HepG2 cells.


Figure 8
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 8. Decreased level of SR-BI in diabetic rats. Graph shows the level of rat SR-BI mRNA (A) and protein (B) in diabetic Otsuka Long-Evans Tokushima Fatty (OLETF) rats compared with the chow-fed control Long-Evans Tokushima Otsuka (LETO) rats by a real-time PCR method and Western blot analysis, respectively. A graph showing the mean ± SE of 3 experiments for each treatment group is shown. *Significant difference (P < 0.01).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In this report, we summarized the results of the studies on glucose suppression of hSR-BI gene transcription. The suppressive effects of glucose on hSR-BI promoter activity in the HepG2 cells require the participation of the p38 MAPK cascade and the transcription factor Sp1. More importantly, the observations in vitro were extended to an in vivo diabetic rat model to demonstrate that hyperglycemia suppresses hSR-BI mRNA expression. Controversially, Milliat et al. (38). had reported that early and strong enhancement of hepatic SR-BI expression was observed in streptozotocin-induced diabetes in hypercholesterolemic rats. The discrepancy between our findings and those of that previous report may be due to the differences in the experimental methods and the rat species used. Further investigations will be needed to clarify the regulation of SR-BI by glucose in vivo.

Recent reports show that the p38 MAPK pathway is activated in response to hyperglycemia and in models of DM. In vascular smooth muscle cells, exposure to high glucose concentrations induces the activation of p38 MAPK (6). Another report (30) indicated that high glucose causes a fourfold increase in p38 MAPK in rat aortic smooth muscle cells. p38 MAPK activity was increased in the glomeruli of diabetic rats compared with the controls. In the same cells, the investigator observed increased phosphorylation of heat shock protein 25, a downstream substrate of p38 MAPK (15). Although the published findings pointed toward the involvement of the p38 MAPK cascade in mediating the actions of glucose, more direct and detailed evidence was needed to further define its role. In the current study, we demonstrate clearly the intermediary role of p38 MAPK in glucose suppression of hSR-BI promoter activity by using both constitutively active and dominant-negative forms of p38 MAPK on hSR-BI promoter activity (Fig. 5). Our data support the model that hyperglycemia activates p38 MAPK, which, in turn, triggers a series of steps to suppress hSR-BI promoter activity. In agreement with this hypothesis, the constitutively active form of p38 MAPK mimics the inhibitory action of hyperglycemia on hSR-BI promoter activity, whereas its dominant-negative mutant blocks the effect of glucose. Although we have pointed out the role of p38 MAPK on hSR-BI expression, a recent report (49) indicated that PI3K activation posttranslationally stimulates hepatic SR-BI function by regulating subcellular localization of SR-BI in a PI3K-dependent manner. Further studies will be needed to determine the detailed regulatory mechanisms of hepatic SR-BI expression.

Sp1 plays a vital role in the regulation of transcription from TATA-less promoters that commonly encode housekeeping genes (12). Cellular Sp1 activity and concentration are regulated during development, cellular proliferation, apoptosis, and other cellular processes (8, 17). Sp1 is involved in mediating responses to various stimuli, including induction of the transforming grwoth factor-β receptor gene (7), epidermal growth factor-mediated expression of the gastrin gene (13), and cAMP-dependent induction of the CYP11A gene (2). A recent report (37) showed that p38 MAPK participates in the LPS-induced activation of Sp1, which, in turn, regulates the transcription of the hIL-10 gene. Another report detailed the relationship between p38 MAPK and Sp1 in that the activation of the p38 MAPK cascade enhances Sp1 phosphorylation and mediates the interaction of Sp1 with p38 MAPK. These processes are essential for force-induced filamin expression in fibroblasts (14).

On the basis of several reports that have detailed the connection between p38 MAPK and Sp1, we speculated whether p38 MAPK and Sp1 were components of the pathway leading to glucose suppression of hSR-BI promoter activity. Deletional studies on the hSR-BI promoter led to the identification of a 266-bp DNA fragment (–476 to –210) that is required for the effects of p38 MAPK, and embedded within this sequence were six putative Sp1 binding sites. This finding stands in contrast with the feature of other cellular genes, i.e., the fact that they are regulated by multiple transcription factors. Our studies do not exclude the participation of other factors that may cooperate with Sp1 to regulate hSR-BI transcription. Such factors may remain masked in transient transfections because this approach is known to generate high plasmid copy numbers and bring about the accumulation of aberrant chromatin structure in these cells.

Efflux of cellular free cholesterol from peripheral cells to the acceptor HDL particles is the first step in reverse cholesterol transport and requires the binding of HDL to the hepatocyte membrane. Several reports (1, 35) have suggested that rodent SR-BI is functionally related to hSR-BI, and this protein is likely to be the receptor that selectively takes up the HDL cholesterol ester. SR-BI is believed to act as a docking receptor for HDL (52).

Hepatic overexpression of SR-BI causes increased biliary secretion of cholesterol without a concomitant increase in the secretion of phospholipids or bile salts (48). SR-BI enhances the exchange of cholesterol between the surface of HDL and the cell. SR-BI deficiency did not affect the expression of the key regulators of hepatic cholesterol homeostasis, including HMG-CoA reductase, the low-density lipoprotein (LDL) receptor, and cholesterol 7-{alpha}-hydroxylase (18). However, SR-BI deficiency reduced the cholesterol content in bile by ~40%. Rigotti et al. (44) generated mice with a targeted null mutation in the SR-BI gene and showed that plasma cholesterol concentrations were increased because of the formation of large apolipoprotein A-I containing particles in heterozygous and homozygous mutants relative to the wild-type controls. The plasma concentration of apolipoprotein A-I, the major protein in HDL, remained unchanged in the mutants. These data, in conjunction with the increased lipoprotein size, suggested that the higher plasma cholesterol concentration in the mutants was due to decreased selective cholesterol uptake. These results suggest that SR-BI may stimulate hepatic uptake of HDL free cholesterol and its transport into bile.

Several potential links between diabetes and atherosclerosis have been identified, and many clinical observations point toward the correlation between the risk of vascular complications in diabetes and poor glycemic control. A primarily important step in the development of atherosclerosis is the uptake of modified plasma LDL by monocyte-derived macrophages in the vascular wall (55). This process is largely mediated by the cell surface scavenger receptor CD36. Griffin et al. (21) recently reported a fivefold increase in macrophage CD36 expression after prolonged exposure to high glucose concentrations (11 and 33 mmol/l) in vitro, leading to increased translational efficiency of CD36 mRNA. It is possible that the increased monocyte CD36 expression observed in DM could be due to this mechanism. A previous report (46) indicated a significant increase in the baseline expression of the monocyte-macrophage LDL scavenger receptor CD36 on peripheral venous monocytes of patients with type 2 DM. Both good "HDL" and bad "modified LDL" metabolism may be affected by a hyperglycemic state, such as in DM.

In summary, the results of this study show that hyperglycemia inhibits hepatic endogenous hSR-BI expression. This inhibitory effect of hyperglycemia on hSR-BI promoter activity is mediated by the p38 MAPK/Sp1 signaling cascade. These findings raise the possibility that hyperglycemia may affect reverse cholesterol transport by controlling hSR-BI expression in diabetic patients.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by Grant-in-Aid for Scientific Research 14770601 (K. Murao) and Grant-in-Aid for Scientific Research 15590944 (T. Ishida and K. Murao).


    ACKNOWLEDGMENTS
 
We thank Kazuko Yamaji and Kiyo Ueeda for their technical assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. Murao, Div. of Endocrinology and Metabolism, Dept. of Internal Medicine, Faculty of Medicine, Kagawa University, 1750-1, Miki-cho, Kita-gun, Kagawa, 761-0793, Japan (e-mail: mkoji{at}kms.ac.jp)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. ActonS, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science 271: 518–520, 1996.[Abstract]
  2. AhlgrenR, Suske G, Waterman MR, Lund J. Role of Sp1 in cAMP-dependent transcriptional regulation of the bovine CYP11A gene. J Biol Chem 274: 19422–19428, 1999.[Abstract/Free Full Text]
  3. BallantyneCM, Herd JA, Ferlic LL, Dunn JK, Farmer JA, Jones PH, Schein JR, Gotto AM Jr. Influence of low HDL on progression of coronary artery disease, and response to fluvastatin therapy. Circulation 99: 736–743, 1999.[Abstract/Free Full Text]
  4. BaynesJW. Role of oxidative stress in development of complications in diabetes. Diabetes 40: 405–412, 1991.[Abstract]
  5. BaynesJW, Thorpe SR. Role of oxidative stress in diabetic complications: a new perspective on an old paradigm. Diabetes 48: 1–9, 1999.[Abstract]
  6. BegumN, Ragolia L. High glucose and insulin inhibit VSMC MKP-1 expression by blocking iNOS via p38 MAPK activation. Am J Physiol Cell Physiol 278: C81–C91, 2000.[Abstract/Free Full Text]
  7. BontempsY, Vuillermoz B, Antonicelli F, Perreau C, Danan JL, Maquart FX, Wegrowski Y. Specific protein-1 is a universal regulator of UDP-glucose dehydrogenase expression: its positive involvement in transforming growth factor-beta signaling and inhibition in hypoxia. J Biol Chem 278: 21566–21575, 2003.[Abstract/Free Full Text]
  8. BouwmanP, Philipsen S. Regulation of the activity of Sp1-related transcription factors. Mol Cell Endocrinol 195: 27–38, 2002.[CrossRef][Web of Science][Medline]
  9. BrownleeM, Cerami A, Vlassara H. Advanced glycosylation end products in tissue and the biochemical basis of diabetic complications. N Engl J Med 318: 1315–1321, 1988.[Web of Science][Medline]
  10. CalvoD, Vega MA. Identification, primary structure, and distribution of CLA-1, a novel member of the CD36/LIMPII gene family. J Biol Chem 268: 18929–18935, 1993.[Abstract/Free Full Text]
  11. CaoWM, Murao K, Imachi H, Yu X, Dobashi H, Yoshida K, Muraoka T, Kotsuna N, Nagao S, Wong NC, Ishida T. Insulin-like growth factor-I regulation of hepatic scavenger receptor class BI. Endocrinology 145: 5540–5547, 2004.[Abstract/Free Full Text]
  12. ChuS, Ferro TJ. Sp1: regulation of gene expression by phosphorylation. Gene 348: 1–11, 2005.[CrossRef][Web of Science][Medline]
  13. ChupretaS, Du M, Todisco A, Merchant JL. EGF stimulates gastrin promoter through activation of Sp1 kinase activity. Am J Physiol Cell Physiol 278: C697–C708, 2000.[Abstract/Free Full Text]
  14. D'AddarioM, Arora PD, Ellen RP, McCulloch CA. Interaction of p38 and Sp1 in a mechanical force-induced, beta 1 integrin-mediated transcriptional circuit that regulates the actin-binding protein filamin-A. J Biol Chem 277: 47541–47550, 2002.[Abstract/Free Full Text]
  15. DunlopME, Muggli EE. Small heat shock protein alteration provides a mechanism to reduce mesangial cell contractility in diabetes and oxidative stress. Kidney Int 57: 464–475, 2000.[Web of Science][Medline]
  16. DurringtonPN. Triglycerides are more important in atherosclerosis than epidemiology has suggested. Atherosclerosis 141: S57–S62, 1998.[CrossRef][Web of Science][Medline]
  17. DynanWS, Tjian R. The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35: 79–87, 1983.[CrossRef][Web of Science][Medline]
  18. ElferinkRP, Tytgat GN, Groen AK. Hepatic canalicular membrane 1: The role of mdr2 P-glycoprotein in hepatobiliary lipid transport. FASEB J 11: 19–28, 1997.[Abstract]
  19. EvansJL, Goldfine ID, Maddux BA, Grodsky GM. Oxidative stress and stress-activated signaling pathways: a unifying hypothesis of type 2 diabetes. Endocr Rev 23: 599–622, 2002.[Abstract/Free Full Text]
  20. FieldingCJ, Fielding PE. Molecular physiology of reverse cholesterol transport. J Lipid Res 36: 211–228, 1995.[Abstract]
  21. GriffinE, Re A, Hamel N, Fu C, Bush H, McCaffrey T, Asch AS. A link between diabetes and atherosclerosis: Glucose regulates expression of CD36 at the level of translation. Nat Med 7: 840–846, 2001.[CrossRef][Web of Science][Medline]
  22. HavelRJ, Eder HA, Bragdon JH. The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum. J Clin Invest 34: 1345–1353, 1955.[Web of Science][Medline]
  23. HottaN. New approaches for treatment in diabetes: aldose reductase inhibitors. Biomed Pharmacother 49: 232–243, 1995.[CrossRef][Medline]
  24. IdoY, Kilo C, Williamson JR. Cytosolic NADH/NAD+, free radicals, and vascular dysfunction in early diabetes mellitus. Diabetologia 40: S115–S117, 1999.[CrossRef]
  25. ImachiH, Murao K, Sato M, Hosokawa H, Ishida T, Takahara J. CD36 LIMPII analogous-1, a human homolog of the rodent scavenger receptor B1, provides the cholesterol ester for steroidogenesis in adrenocortical cells. Metabolism 48: 627–630, 1999.[CrossRef][Web of Science][Medline]
  26. ImachiH, Murao K, Sayo Y, Hosokawa H, Sato M, Niimi M, Kobayashi S, Miyauchi A, Ishida T, Takahara J. Evidence for a potential role for HDL as an important source of cholesterol in human adrenocortical tumors via the CLA-1 pathway. Endocr J 46: 27–34, 1999.[Web of Science][Medline]
  27. ImachiH, Murao K, Hiramine C, Sayo Y, Sato M, Hosokawa H, Ishida T, Kodama T, Quehenberger O, Steinberg D, Takahara J. Human scavenger receptor B1 is involved in recognition of apoptotic thymocytes by thymic nurse cells. Lab Invest 80: 263–270, 2000.[Web of Science][Medline]
  28. ImachiH, Murao K, Cao WM, Ohyama T, Sato M, Sasaguri Y, Ishida T, Takahara J. Expression of HDL receptor, CLA1 in human smooth-muscle cells and effect of interferon-gamma on its regulation. Horm Metab Res 33: 389–393, 2001.[CrossRef][Web of Science][Medline]
  29. ImachiH, Murao K, Cao W, Tada S, Taminato T, Wong NC, Takahara J, Ishida T. Expression of human scavenger receptor B1 on and in human platelets. Arterioscler Thromb Vasc Biol 23: 898–904, 2003.[Abstract/Free Full Text]
  30. IgarashiM, Wakasaki H, Takahara N, Ishii H, Jiang ZY, Yamauchi T, Kuboki K, Meier M, Rhodes CJ, King GL. Glucose or diabetes activates p38 mitogen-activated protein kinase via different pathways. J Clin Invest 103: 185–195, 1999.[Web of Science][Medline]
  31. IshiiH, Koya D, King GL. Protein kinase C activation and its role in the development of vascular complications in diabetes mellitus. J Mol Med 76: 21–31, 1998.[CrossRef][Web of Science][Medline]
  32. IwaseM, Uchizono Y, Tashiro K, Goto D, Iida M. Islet hyperperfusion during prediabetic phase in OLETF rats, a model of type 2 diabetes. Diabetes 51: 2530–2535, 2002.[Abstract/Free Full Text]
  33. JiY, Jian B, Wang N, Sun Y, Moya ML, Phillips MC, Rothblat GH, Swaney JB, Tall AR. Scavenger receptor BI promotes high density lipoprotein-mediated cellular cholesterol efflux. J Biol Chem 272: 20982–20985, 1997.[Abstract/Free Full Text]
  34. KannelWB, McGee DL. Diabetes and cardiovascular disease. The Framingham Study. JAMA 241: 2035–2038, 1979.[Abstract/Free Full Text]
  35. KozarskyKF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 387: 414–417, 1997.[CrossRef][Medline]
  36. KriegerM. Scavenger receptor class B type I is a multiligand HDL receptor that influences diverse physiologic systems. J Clin Invest 108: 793–797, 2001.[CrossRef][Web of Science][Medline]
  37. MaW, Lim W, Gee K, Aucoin S, Nandan D, Kozlowski M, Diaz-Mitoma F, Kumar A. The p38 mitogen-activated kinase pathway regulates the human interleukin-10 promoter via the activation of Sp1 transcription factor in lipopolysaccharide-stimulated human macrophages. J Biol Chem 276: 13664–13674, 2001.[Abstract/Free Full Text]
  38. MilliatF, Gripois D, Blouquit ME, Ferezou J, Serougne C, Fidge NH, Lutton C. Short and long-term effects of streptozotocin on dietary cholesterol absorption, plasma lipoproteins and liver lipoprotein receptors in RICO rats. Exp Clin Endocrinol Diabetes 108: 436–446, 2000.[CrossRef][Web of Science][Medline]
  39. MurakamiM, Horiuchi S, Takata K, Morino Y. Distinction in the mode of receptor-mediated endocytosis between high density lipoprotein and acetylated high density lipoprotein: evidence for high density lipoprotein receptor-mediated cholesterol transfer. J Biochem (Tokyo) 101: 729–741, 1987.[Abstract/Free Full Text]
  40. MuraoK, Terpstra V, Green SR, Kondratenko N, Steinberg D, Quehenberger O. Characterization of CLA1, a human homologue of rodent scavenger receptor BI, as a receptor for high density lipoprotein and apoptotic thymocytes. J Biol Chem 272: 17551–17557, 1997.[Abstract/Free Full Text]
  41. MuraoK, Wada Y, Nakamura T, Taylor AH, Mooradian AD, Wong NC. Effects of glucose and insulin on rat apolipoprotein A-I gene expression. J Biol Chem 273: 18959–18965, 1998.[Abstract/Free Full Text]
  42. PittmanRC, Knecht TP, Rosenbaum MS, Taylor CA Jr. A nonendocytotic mechanism for the selective uptake of high density lipoprotein-associated cholesterol esters. J Biol Chem 262: 2443–2450, 1987.[Abstract/Free Full Text]
  43. PuglieseG, Tilton RG, Williamson JR. Glucose-induced metabolic imbalances in the pathogenesis of diabetic vascular disease. Diabetes Metab Rev 7: 35–59, 1991.[Web of Science][Medline]
  44. RigottiA, Trigatti BL, Penman M, Rayburn H, Herz J, Krieger M. A targeted mutation in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger receptor class B type I reveals its key role in HDL metabolism. Proc Natl Acad Sci USA 94: 12610–12615, 1997.[Abstract/Free Full Text]
  45. RousseauS, Houle F, Landry J, Huot J. p38 MAP kinase activation by vascular endothelial growth factor mediates actin reorganization, and cell migration in human endothelial cells. Oncogene 15: 2169–2177, 1997.[CrossRef][Web of Science][Medline]
  46. SampsonMJ, Davies IR, Braschi S, Ivory K, Hughes DA. Increased expression of a scavenger receptor (CD36) in monocytes from subjects with Type 2 diabetes. Atherosclerosis 167: 129–134, 2003.[CrossRef][Web of Science][Medline]
  47. SamsonSL, Wong NC. Role of Sp1 in insulin regulation of gene expression. J Mol Endocrinol 29: 265–279, 2002.[Abstract]
  48. SehayekE, Ono JG, Shefer S, Nguyen LB, Wang N, Batta AK, Salen G, Smith JD, Tall AR, Breslow JL. Biliary cholesterol excretion: a novel mechanism that regulates dietary cholesterol absorption. Proc Natl Acad Sci USA 95: 10194–10199, 1998.[Abstract/Free Full Text]
  49. ShettyS, Eckhardt ER, Post SR, van der Westhuyzen DR. Phosphatidylinositol-3-kinase regulates scavenger receptor class B type I subcellular localization and selective lipid uptake in hepatocytes. Arterioscler Thromb Vasc Biol 26: 2125–2131, 2006.[Abstract/Free Full Text]
  50. StamlerJ, Vaccaro O, Neaton JD, Wentworth D. Diabetes, other risk factors, and 12-yr cardiovascular mortality for men screened in the Multiple Risk Factor Intervention Trial. Diabetes Care 16: 434–444, 1993.[Abstract]
  51. SurapisitchatJ, Hoefen RJ, Pi X, Yoshizumi M, Yan C, Berk BC. Fluid shear stress inhibits TNF-alpha activation of JNK but not ERK1/2 or p38 in human umbilical vein endothelial cells: Inhibitory crosstalk among MAPK family members. Proc Natl Acad Sci USA 98: 6476–6481, 2001.[Abstract/Free Full Text]
  52. TallAR. Plasma high density lipoproteins. Metabolism and relationship to atherogenesis. J Clin Invest 6: 379–384, 1990.
  53. TaskinenMR. Quantitative and qualitative abnormalities in diabetes mellitus. Diabetes 41: 12–17, 1992.[Abstract]
  54. TrigattiBL, Krieger M, Rigotti A. Influence of the HDL receptor SR-BI on lipoprotein metabolism and atherosclerosis. Arterioscler Thromb Vasc Biol 23: 1732–1738, 2003.[Abstract/Free Full Text]
  55. Van BerkelTJ, Van Eck M, Herijgers N, Fluiter K, Nion S. Scavenger receptor classes A and B. Their roles in atherogenesis and the metabolism of modified LDL and HDL. Ann NY Acad Sci 902: 113–126, 2000.[Web of Science][Medline]
  56. WangN, Arai T, Ji Y, Rinninger F, Tall AR. Liver-specific overexpression of scavenger receptor BI decreases levels of very low density lipoprotein ApoB, low density lipoprotein ApoB, and high density lipoprotein in transgenic mice. J Biol Chem 273: 32920–32926, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
Z. Ravid, M. Bendayan, E. Delvin, A. T. Sane, M. Elchebly, J. Lafond, M. Lambert, G. Mailhot, and E. Levy
Modulation of intestinal cholesterol absorption by high glucose levels: impact on cholesterol transporters, regulatory enzymes, and transcription factors
Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G873 - G885.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/1/E78    most recent
00023.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murao, K.
Right arrow Articles by Ishida, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murao, K.
Right arrow Articles by Ishida, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.