AJP - Endo Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 294: E61-E68, 2008. First published October 30, 2007; doi:10.1152/ajpendo.00358.2007
0193-1849/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/1/E61    most recent
00358.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harada, N.
Right arrow Articles by Inagaki, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harada, N.
Right arrow Articles by Inagaki, N.

A novel GIP receptor splice variant influences GIP sensitivity of pancreatic β-cells in obese mice

Norio Harada,1 Yuichiro Yamada,1 Katsushi Tsukiyama,1 Chizumi Yamada,1 Yasuhiko Nakamura,1 Eri Mukai,1,2 Akihiro Hamasaki,1 Xibao Liu,1 Kentaro Toyoda,1 Yutaka Seino,1,3 and Nobuya Inagaki1,4

1Department of Diabetes and Clinical Nutrition, Kyoto University Graduate School of Medicine, Kyoto; 2Japan Association for the Advancement of Medical Equipment, Tokyo; 3Kansai Electric Power Hospital, Osaka; and 4Core Research for Evolutional Science and Technology of Japan Science and Technology, Kyoto, Japan

Submitted 11 June 2007 ; accepted in final form 11 October 2007


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Gastric inhibitory polypeptide (GIP) is an incretin that potentiates insulin secretion from pancreatic β-cells by binding to GIP receptor (GIPR) and subsequently increasing the level of intracellular adenosine 3',5'-cyclic monophosphate (cAMP). We have identified a novel GIPR splice variant in mouse β-cells that retains intron 8, resulting in a COOH-terminal truncated form (truncated GIPR). This isoform was coexpressed with full-length GIPR (wild-type GIPR) in normal GIPR-expressing tissues. In an experiment using cells transfected with both GIPRs, truncated GIPR did not lead to cAMP production induced by GIP but inhibited GIP-induced cAMP production through wild-type GIPR (n = 3–4, P < 0.05). Wild-type GIPR was normally located on the cell surface, but its expression was decreased in the presence of truncated GIPR, suggesting a dominant negative effect of truncated GIPR against wild-type GIPR. The functional relevance of truncated GIPR in vivo was investigated. In high-fat diet-fed obese mice (HFD mice), blood glucose levels were maintained by compensatory increased insulin secretion (n = 8, P < 0.05), and cAMP production (n = 6, P < 0.01) and insulin secretion (n = 10, P < 0.05) induced by GIP were significantly increased in isolated islets, suggesting hypersensitivity of the GIPR. Total GIPR mRNA expression was not increased in the islets of HFD mice, but the expression ratio of truncated GIPR to total GIPR was reduced by 32% compared with that of control mice (n = 6, P < 0.05). These results indicate that a relative reduction of truncated GIPR expression may be involved in hypersensitivity of GIPR and hyperinsulinemia in diet-induced obese mice.

gastric inhibitory polypeptide; gastric inhibitory polypeptide receptor; alternative splicing; dominant negative effect; obesity

OBESITY LEADS TO INSULIN RESISTANCE, characterized by fasting hyperinsulinemia and excessive insulin secretion after meal ingestion in the attempt to maintain euglycemia (25). Obesity is an important risk factor in progression to type 2 diabetes mellitus (14) and also in cardiovascular disease (16), and reduction of obesity can normalize hyperinsulinemia and impede the progression of diabetes and arteriosclerosis.

Incretins are a group of peptide hormones released from the gastrointestinal tract into the circulation in response to meal ingestion that potentiate glucose-stimulated insulin secretion and include gastric inhibitory polypeptide (GIP), also called glucose-dependent insulinotropic polypeptide (24). GIP is secreted from the K cells of the duodenum and proximal jejunum upon meal ingestion and binds to the GIP receptor (GIPR) on the surface of pancreatic β-cells, adipose tissues, and osteoblasts to stimulate insulin secretion (21), fat accumulation (20), and bone formation (30) by increasing the level of intracellular adenosine 3',5'-cyclic monophosphate (cAMP).

Previously, we found that GIPR-deficient mice exhibit insufficient compensatory insulin secretion upon high-fat loading (21), indicating that GIP plays a critical role in maintaining the blood glucose level by inducing hypersecretion of insulin in diet-induced obesity. Increased GIP signaling in obesity might be due to hypersecretion of GIP from K cells or hypersensitivity of GIPR to GIP at the β-cells. An increased blood GIP level in obesity has been reported in some studies (3, 6) but is controversial (27, 28), and altered GIPR sensitivity in obesity has not been investigated.

GIPR is the G protein-coupled receptor (GPCR) that belongs to the secretin-vasoactive intestinal peptide receptor family (31, 33). The gene encoding the human GIPR contains 14 exons (33); the rat and mouse GIPR-encoding genes contain 15 exons (2, 21). Alternative splicing is a frequent occurrence in the transcriptome in higher eukaryotic cells and can alter the structure of the encoded protein and dramatically increase the efficiency of the proteome in regulating cell function. In the present study, we report a novel splice variant GIPR expressed in mouse pancreatic β-cells and the investigation of its functional significance in hypersensitivity of GIPR in high-fat diet-induced obese mice.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals. Male C57BL/6 mice (7 wk old) were obtained from Shimizu (Kyoto, Japan). The animals were fed control fat chow (CFD; 10% fat, 20% protein, and 70% carbohydrate by energy) or high-fat chow (HFD; 45% fat, 20% protein, and 35% carbohydrate by energy) for 10 wk. The energy density of both diets was 3.57 kcal/g. After a 16-h fast, oral glucose tolerance tests (OGTTs) (2 g/kg body wt) were performed in CFD and HFD mice. Blood glucose and plasma insulin levels were measured in samples taken at the indicated times. Blood glucose levels were determined by the glucose oxidase method. Plasma insulin levels were determined using enzyme immunoassay (Shibayagi, Gumma, Japan). Animal care and procedures were approved by the Animal Care Committee of Kyoto University.

Isolation and measurement of GIPR mRNA. Total RNA was extracted from tissues (pancreatic islets, proximal jejunum, and adipose tissues) of C57/BL6 mice and Wistar rats (Shimizu) and mouse pancreatic β-cell line MIN6 cells with RNeasy mini kit (Qiagen, Valencia, CA). Islets were isolated by collagenase digestion (29). The extracted RNA was treated with DNase (Qiagen), and the cDNA was prepared by reverse transcription (Superscript II; Invitrogen, Grand Island, NY) with an oligo(dT) primer. To detect mouse full-length GIPR, COOH-terminal and NH2-terminal primers of GIPR were designed as follows: forward, 5'-CTTTTCAAGGATGCCCCTGCGGTTGC-3'; reverse, 5'-CCTTTACCTAGCAGTAACTTTTCCAAGA-3'. The cDNA was amplified through 35 cycles with denaturation at 96°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 2 min. To clearly detect splice variants of GIPR, a pair of GIPR primers was designed as follows: mouse GIPR forward, 5'-CTGCCTGCCGCACGGCCCAGAT-3'; reverse, 5'-CAAATGGCTTTGACTTCGTTG-3'; rat GIPR forward, 5'-CTGCCTGCCGCACAGCCCAGAT-3'; reverse, 5'- CAAATGGCTTTGACTTCGTTG -3'. The cDNA was amplified through 40 cycles with denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 30 s. The PCR products were fractioned on 2% agarose gels. Negative controls of cDNAs of tissues were prepared in the absence of reverse transcriptase at the reverse transcription step.

GIPR mRNA levels in the islets were measured by quantitative RT-PCR using ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). The mouse sequences of forward and reverse primers to evaluate total GIPR expression were 5'-CCTCCACTGGGTCCCTACAC-3' and 5'-GATAAACACCCTCCACCAGTAG-3', respectively, whereas the sequences of forward and reverse primers to evaluate truncated GIPR expression were 5'-CCTACCCCGTGGAACCAG-3' and 5'-GTGGTGGGGAGCCAAGAT-3', respectively. SYBR Green PCR Master Mix (Applied Biosystems) was prepared for PCR run. The thermal cycling conditions were denaturation at 95°C for 10 min followed by 50 cycles at 95°C for 15 s and 60°C for 1 min. Total GIPR mRNA levels were corrected for GAPDH (Applied Biosystems) mRNA levels.

Plasmid construction. The cDNA fragments of mouse wild-type GIPR, truncated GIPR, and Gs{alpha} protein were obtained from mouse (C57BL/6) islets by RT-PCR. The cDNA fragment of wild-type GIPR was cloned into pCMV-6c vector and pFLAG-CMV-5b vector (wild-type GIPR-FLAG; Sigma, St. Louis, MO). The cDNA fragment of truncated GIPR was cloned into pCMV-6c vector and pAcGFP-N1 vector (truncated GIPR-GFP; Takara, Tokyo, Japan). The two GIPR constructs were FLAG- or green fluorescent protein (GFP)-tagged at the COOH terminus. The cDNA fragment of mouse Gs{alpha} protein was cloned into pCMV-6c vector.

Cell culture and transfection. COS-7 cells were seeded in 10-cm dishes and cultured in Dulbeco's modified Eagle's medium supplemented with 10% fetal bovine serum. Expression plasmids of wild-type GIPR, truncated GIPR, wild-type GIPR-FLAG, and truncated GIPR-GFP were transfected into COS-7 cells using FuGENE 6 transfection reagent (Roche, Basel, Switzerland). Plasmid (5 µg/well) was diluted into serum-free medium, and FuGENE 6 reagent was added and incubated at room temperature for 30 min. After incubation, the mixture was added to COS-7 cells.

Measurement of intracellular cAMP level in GIPR-expressing COS-7 cells. COS-7 cells were transfected with the wild-type GIPR expression plasmid and the truncated GIPR expression plasmid using the amounts indicated in figure legends, passaged after 24 h into 12-well plates (1 x 105 cells/well), and cultured for an additional 48 h. The cells were washed twice with phosphate-buffered saline (PBS), and the reaction was started in 0.5 ml of Krebs-Ringer bicarbonate buffer (KRBB) containing 0.1 mM 3-isobutyl-1-methylxanthine (IBMX) with various concentrations of mouse GIP (provided by Sanwakagaku Kenkyusho, Mie, Japan) and then incubated at 37°C for 30 min. Incubation buffers were removed and the cells lysed by addition of 0.1 M HCl (0.5 ml/well) to each well (15). Plates were incubated at room temperature for 15 min with gentle rotation. The samples were centrifuged for 10 min at 600 g. cAMP levels were measured by enzyme immunoassay (cAMP low pH EIA kit; R&D Systems, Minneapolis, MN). Data were expressed as the increment with GIP treatment from basal cAMP levels.

Fluorescence microscopy. Immunofluorescence staining was performed using COS-7 cells either transfected with the wild-type GIPR-FLAG expression plasmid (2 µg) or the truncated GIPR-GFP expression plasmid (2 µg) or cotransfected with the two plasmids (1 µg each) with Gs{alpha} protein expression plasmid (2 µg). We used Gs{alpha} protein expression plasmid for structural stability of wild-type GIPR on plasma membrane (11). The cells were cultured on coverslips for 72 h, washed twice with PBS, and treated with acetone-methanol (1:1) for 4 min. After being washed sequentially with PBS containing 1% bovine serum albumin (BSA), the cells were incubated at room temperature for 24 h with anti-GFP monoclonal mouse antibody (Sigma) and anti-FLAG polyclonal rabbit antibody (Sigma) or anti-calnexin rabbit polyclonal antibody (Stressgen, San Diego, CA) in PBS containing 1% BSA. After being washed three times with PBS, the cells were immunostained at room temperature for 1 h using Cy3-conjugated anti-rabbit IgG (Sigma) or Alexa fluor 488 anti-mouse IgG (Molecular Probes, Eugene, OR) (23). Fluorescent images were analyzed using a confocal laser microscope LSM510 Meta (Carl Zeiss, Heidelberg, Germany).

Binding assay. Binding assay was performed using COS-7 cells either transfected with the wild-type GIPR expression plasmid (1 µg) or the truncated GIPR expression plasmid (1 µg) or cotransfected with the two plasmids (1 µg each) (total amount of plasmid DNA used for transfection was adjusted to 5 µg by adding pCMV-6c vector). After 72 h of incubation the cells were washed twice with PBS, and the collected cells were incubated with 125I-labeled GIP (50,000 counts/min; Amersham Biosciences, Piscataway, NJ) in 1 ml of buffer containing 50 mM Tris (pH 7.4), 0.2 mM sucrose, 5 mM MgCl2, and 1 mg/ml bacitracin at 22°C for 1 h in the absence or presence of 10–6 M nonradioactive GIP. Samples were filtered through Whatman GF/C filters (24 mm) and rapidly washed three times with ice-cold PBS. The radioactivity of the filters was measured in a {gamma}-counter (22). Competitive binding assay was also performed using COS-7 cells transfected with the wild-type GIPR expression plasmid (1 µg) or cotransfected with the two plasmids (1 µg each). Various concentrations of nonradioactive GIP, ranging from 10–12 to 10–6 M, were used as competitors. Specific binding of radioactive GIP was calculated by subtracting binding of radioactive GIP in the presence of nonradioactive GIP. Protein content was measured by Bradford method. Data were expressed as specific binding to each of the GIPR-expressing cells after subtraction of the specific binding to cells transfected with pCMV-6c vector.

Immunoprecipitation and Western blot analysis. We performed Western blot analysis using COS-7 cells either transfected with the wild-type GIPR-FLAG expression plasmid (2 µg) or the truncated GIPR-GFP expression plasmid (2 µg) or cotransfected with the two plasmids (1 µg each). After 72 h of incubation, the collected cells were washed twice with PBS containing protease inhibitor (Complete; Roche) and suspended in 1 ml of PBS containing protease inhibitor. The cells were homogenized and centrifuged at 800 g for 5 min. The supernatant was centrifuged at 10,000 g for 10 min. The supernatant was further centrifuged at 100,000 g for 30 min to separate the endoplasmic reticulum (ER)-enriched fraction and the supernatant. The ER-enriched fraction was solubilized in 1 ml of PBS containing protease inhibitor and 2% Triton X-100 on ice for 15 min and centrifuged at 15,000 g for 10 min. The supernatant was incubated at 4°C for 2 h with mixing for immunoprecipitation using anti-FLAG M2 affinity beads (Sigma). The beads collected by centrifugation were washed three times with 1 ml PBS containing protease inhibitor, suspended in 20 µl of sample buffer (0.2 M Tris, 10% sucrose, 10% SDS, and 5 mM EDTA), and incubated at 98°C for 5 min. After centrifugation, the supernatants were electrophoresed through 5–16% polyacrylamide gradient gels. The gels were subjected to immunoblotting using anti-FLAG polyclonal rabbit antibody (Sigma) or anti-GFP polyclonal rabbit antibody (Sigma) and anti-rabbit or anti-mouse IgG horseradish peroxdase-linked antibody (Amersham Biosciences). The immunoblots were visualized by electrochemiluminescence (Amersham Biosciences).

To determine whether the two GIPRs insert into the ER membrane, the ER-enriched fraction of COS-7 cells cotransfected with the two plasmids (1 µg each) were incubated in PBS containing 0.2 M sucrose in the absence or presence of 0.1 M Na2CO3 (pH 10.5) for 1 h on ice. After centrifugation at 100,000 g for 30 min, Western blot was performed with the supernatant and pellet using an antibody against FLAG or GFP.

Measurement of insulin secretion and intracellular cAMP production in isolated islets. Islets were isolated from mice and handpicked under a microscope. For insulin secretion studies, groups of 10 islets were preincubated at 37°C for 30 min in KRBB containing 2.8 mM glucose and 0.2% BSA and gassed with 95% O2 and 5% CO2. The islets were incubated at 37°C for 30 min in 0.5 ml of KRBB containing 2.8 mM or 11.1 mM glucose and 0.2% BSA in the absence or presence of high potassium (30 mM KCl). The islets were also incubated at 37°C for 30 min in 0.5 ml of KRBB containing 11.1 mM glucose and 0.2% BSA with or without mouse GIP (10–9 or 10–7 M) or 5 µM forskolin. Aliquots of the sample buffer were subjected to RIA assay for insulin. To determine insulin content, the islets were homogenized in 0.4 ml acid-ethanol and extracted at 4°C overnight. The acidic extracts were dried and subjected to insulin measurement.

For cAMP production studies, 20 preincubated islets were incubated at 37°C for 30 min in 0.3 ml of KRBB containing 11.1 mM glucose, 0.2% BSA, 1 mM IBMX, and 10 mM HEPES (pH 7.4) with or without 10–9 M GIP, 10–7 M GIP, or 5 µM forskolin. The incubation was stopped by the addition of 60 µl of 2 M HClO4. The samples were immediately mixed and sonicated in ice-cold water for 4 min. The samples were centrifuged for 4 min at 3,000 g, and aliquots (240 µl) were neutralized by 60 µl of 1 M Na2CO3 and diluted with 60 µl of 2 M HEPES (pH 7.4). cAMP levels were measured by EIA assay.

Statistical analysis. Values are expressed as means ± SE. Statistical analyses were performed using ANOVA and unpaired student's t-test. P values <0.05 were considered significant.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Identification of truncated GIPR. PCR amplification and sequencing of full-length GIPR from mouse islet cDNA revealed expression of two isoforms (Fig. 1A). The upper band (1.6 kbp) is characterized by unsplicing of intron 8 (0.2 kbp). As a result of the addition, the predicted amino acid reading frame is shifted within the region encoding transmembrane domain 4 and an in-frame stop codon is produced, generating a COOH-terminal truncated form of 263 amino acids designated as truncated GIPR. The lower band (1.4 kbp) corresponds to full-length GIPR of 460 amino acids designated as wild-type GIPR. To estimate truncated GIPR expression in different tissues, RT-PCR was performed using a different detection primer pair (Fig. 1B). Truncated GIPR was expressed not only in mouse islets but also in mouse proximal jejunum and adipose tissue. Truncated GIPR was also expressed in a mouse pancreatic β-cell line (MIN6), rat islets, proximal jejunum, and adipose tissue.


Figure 1
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 1. Structure and expression of the splice variant gastric inhibitory polypeptide (GIP) receptor (GIPR). A: the structure of 2 splice variant GIPRs. PCR amplification of mouse (C57BL/6) islet cDNA was performed using COOH-terminal and NH2-terminal primers of GIPR. The upper band (1.6 kbp) encodes a truncated GIPR isoform that retained the sequence of intron 8 (0.2 kbp) during RNA processing. The lower band (1.4 kbp) encodes wild-type GIPR isoform (full-length GIPR). A minus lane is negative control of mouse islet. The specific primer pair was designed to clearly detect 2 bands of GIPR by RT-PCR (arrows). The primer pair for quantitative RT-PCR to analyze total GIPR expression and truncated GIPR expression is indicated as open arrowhead and filled arrowhead, respectively. Intron 8 is indicated as gray box. B: tissue distribution of truncated GIPR in mice, rats, and MIN6 cells. The 0.25-kbp band shows the amplified DNA fragment of wild-type GIPR; the 0.45-kbp band shows that of truncated GIPR. cDNA was prepared from mouse (a–d) and rat (e–f) tissues, and RT-PCR was performed (a, MIN6 cells; b and e, adipose tissue; c and f, islets; d and g, proximal jejunum). A minus lane is negative control of each tissue.

 
Function of truncated GIPR. To determine the functional properties of truncated GIPR, COS-7 cells were transfected with wild-type and truncated GIPR expression plasmid separately and stimulated with GIP (Fig. 2). In wild-type GIPR-expressing cells, GIP increased cAMP levels in a concentration-dependent manner. In contrast, GIP failed to stimulate cAMP induction in truncated GIPR-expressing cells. COS-7 cells were then cotransfected with wild-type and truncated GIPR expression plasmids. As the amount of truncated GIPR expression plasmid was increased from 0.5 to 2 µg in the presence of 1 µg of wild-type GIPR expression plasmid, maximal cAMP production induced by GIP was reduced, indicating that truncated GIPR had a dominant negative effect against wild-type GIPR. We examined whether truncated GIPR influenced glucagon-like peptide-1 (GLP-1)-induced cAMP production using GLP-1 receptor-expressing COS-7 cells. GLP-1-induced cAMP production was not decreased in the presence of truncated GIPR (data not shown), indicating that the dominant negative effect of truncated GIPR is specific to GIPR.


Figure 2
View larger version (16K):
[in this window]
[in a new window]

  		Fig. 2. Dose response analysis of GIP-induced cAMP production in GIPR-expressing COS-7 cells. Top: the ratios of the 2 GIPRs were as follows: wild-type GIPR expression plasmid DNA (µg) to truncated GIPR expression plasmid DNA (µg) = 1:0 (bullet; A), 1:0.5 ({circ}; B), 1:1 ({blacksquare}; C), 1:2 ({square}; D), and 0:1 ({triangleup}; E). The total amount of plasmid DNA used for each transfection was adjusted to 5 µg by adding pCMV-6c vector. Values are means ± SE. Bottom: cAMP induced by 10–6 M GIP is shown (n = 3–4). All ED50 values of GIP response curves were ~3.0 nM. Values are means ± SE. *P < 0.05; **P < 0.01 vs. cAMP induction of wild-type GIPR expression.

 
To determine how truncated GIPR affects wild-type GIPR in COS-7 cells, we constructed a COOH-terminal FLAG-tagged wild-type GIPR expression plasmid (wild-type GIPR-FLAG) and a COOH-terminal GFP-tagged truncated GIPR expression plasmid (truncated GIPR-GFP). When each of these expression plasmids was transfected into COS-7 cells (Fig. 3A, a and b), wild-type GIPR-FLAG was expressed on the cell surface whereas truncated GIPR-GFP expression was limited to the ER, as resolved by anti-calnexin antibody. When both wild-type GIPR-FLAG and truncated GIPR-GFP were coexpressed in COS-7 cells (Fig. 3A, c), the expression of wild-type GIPR-FLAG on the cell surface decreased and remained highly within the ER. To determine whether the tags of the receptor influenced receptor trafficking, we constructed tag-changed plasmids [a COOH-terminal GFP-tagged wild-type GIPR expression plasmid (wild-type GIPR-GFP) and a COOH-terminal FLAG-tagged truncated GIPR expression plasmid (truncated GIPR-FLAG)] and transfected them into COS-7 cells. Truncated GIPR-FLAG also was located in the ER and decreased wild-type GIPR-GFP trafficking from the ER to the cell membrane (data not shown). We performed a GIP binding assay using COS-7 cells transfected with nontagged wild-type and truncated GIPR. The GIP binding ability of wild-type GIPR was significantly decreased in the presence of truncated GIPR (Fig. 3B, a). Analysis of GIP binding curves by performing a competitive binding assay showed similar IC50 values of both curves (Fig. 3B, b).


Figure 3
View larger version (44K):
[in this window]
[in a new window]

  		Fig. 3. Cellular localization and interaction of wild-type GIPR and truncated GIPR in GIPR-expressing COS-7 cells. A: immunofluorescence staining of the GIPR-expressing COS-7 cells. COS-7 cells were transfected with wild-type GIPR-FLAG (a) or truncated GIPR-green fluorescent protein (GFP) (b). To estimate localization of truncated GIPR-GFP, anti-calnexin antibody was used as endoplasmic reticulum (ER) maker (green, truncated GIPR-GFP; red, calnexin; yellow, merge). Cotransfection of the 2 GIPRs (c) was performed (red, wild-type GIPR-FLAG; green, truncated GIPR-GFP; yellow, merge). Localization of the GIPRs was analyzed by dual wavelength confocal microscopy. We repeated these experiments using 1 x 105 cells 3 times. B: binding assay analysis using GIPR-expressing COS-7 cells (n = 4; a). Competitive GIP binding curves using COS-7 cells transfected with wild-type GIPR (bullet) or cotransfected with two GIPRs ({blacktriangleup}) (wild-type GIPR to truncated GIPR = 1:1 µg, n = 5; b). The IC50 values of binding curves were 5.6 x 10–8 and 7.2 x 10–8 M, respectively. Data are expressed as specific binding to each of the GIPR-expressing cells after subtraction of the specific binding to cells transfected with pCMV-6c vector. Values are means ± SE. *P < 0.05; **P < 0.01. C: immunoprecipitation and Western blot analysis of ER-enriched fractions of GIPR-expressing COS-7 cells. Immunoprecipitation was performed using anti-FLAG M2 affinity beads. Wild-type GIPR was detected in COS-7 cells transfected with wild-type GIPR alone and cotransfected with the 2 GIPRs using anti-FLAG polyclonal antibody. Truncated GIPR was detected only in COS-7 cells cotransfected with the 2 GIPRs using anti-GFP polyclonal antibody. D: Western blot analysis of ER-enriched fractions of the 2 GIPRs-expressing COS-7 cells with or without Na2CO3 treatment.

 
Immunoprecipitation was performed on the prepared ER-enriched fractions of COS-7 cells transfected with the two GIPRs to determine whether truncated GIPR interacts with wild-type GIPR (Fig. 3C). In the ER-enriched fraction of cotransfected cells, immunoreactive truncated GIPR-GFP could be detected after immunoprecipitation with the FLAG-tagged wild-type GIPR, indicating that truncated GIPR interacts with wild-type GIPR on the ER membrane. Western blot analysis was performed using the ER-enriched fraction treated by Na2CO3 to determine whether the two GIPRs are inserted into the ER membrane (Fig. 3D). With Na2CO3 treatment peripheral membrane proteins are solubilized into the buffer, whereas integral membrane proteins are insoluble. Two GIPRs were detected in the pellet of the ER-enriched fraction untreated by Na2CO3. The two GIPRs were also detected in the pellet of the ER-enriched fraction treated by Na2CO3, indicating that the two GIPRs are stably inserted into the ER membrane. Thus, truncated GIPR influenced trafficking of wild-type GIPR from the ER to the cell surface by interacting with wild-type GIPR in the ER.

GIPR sensitivity in islets of HFD mice. To analyze the functional significance of truncated GIPR in vivo, we investigated GIPR sensitivity of β-cells in obese mice induced by high-fat diet. Mice were fed high-fat chow or control fat chow for 10 wk. Body weight was significantly higher in HFD mice compared with CFD mice (37.9 ± 1.8 and 32.3 ± 0.83 g, respectively, P < 0.05). To determine the effect of high-fat diet on glucose homeostasis, we carried out OGTTs. Blood glucose levels were similar in HFD and CFD mice (Fig. 4A). We then measured plasma insulin levels at the indicated times during OGTTs. Plasma insulin levels were twofold higher in HFD mice at 15 min (1.4 ± 0.2 and 2.7 ± 0.3 ng/ml, respectively, P < 0.05), and the area under the curve of insulin secretion during OGTT was significantly increased in HFD mice compared with CHD mice (191.6 ± 21.2 and 130.8 ± 15.8 ng·ml–1·min–1, respectively, P <0.05) (Fig. 4B). These results suggest compensatory hyperinsulinemia in an attempt to maintain blood glucose levels in high-fat diet-induced obese mice.


Figure 4
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 4. Oral glucose tolerance tests (OGTTs) in control fat chow (CFD) and high-fat chow (HFD) mice. A: blood glucose levels during OGTTs in CFD ({square}) and HFD ({blacksquare}) mice (n = 8). B: plasma insulin levels during OGTTs in CFD ({square}) and HFD ({blacksquare}) mice (n = 8). Area under the curves of the insulin secretion during OGTTs in CFD mice (open bar) and HFD mice (filled bar) were also represented. Values are means ± SE. *P < 0.05 vs. CFD mice.

 
To determine sensitivity to GIP in the islets of HFD mice, GIP-induced insulin secretion from isolated islets of these mice was examined in the presence of 11.1 mM glucose, in which incretin can potentiate insulin secretion. Insulin secretion stimulated by 11.1 mM glucose was similar in the islets of CHD and HFD mice (Fig. 5A). The islets of HFD mice showed significantly increased insulin secretion in response to 10–9 or 10–7 M GIP compared with those of CFD mice. On the other hand, forskolin, an adenylate-cyclase activator, increased insulin secretion in islets of CFD and HFD mice to a similar extent. In the presence of 2.8 and 11.1 mM glucose, insulin secretion stimulated by high potassium (30 mM) was also similar in the islets of CFD and HFD mice, respectively (Table. 1). The insulinotropic effect of GIP requires an increase in the level of intracellular cAMP in the β-cells, and cAMP production in the islets of HFD mice was significantly higher than that in CFD mice in the presence of GIP (Fig. 5B). However, forskolin increased intracellular cAMP production in the islets of CFD and HFD mice to a similar extent. Thus, GIPR sensitivity to GIP was increased specifically in the islets of HFD mice.


Figure 5
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 5. Insulin secretion and cAMP production induced by GIP in isolated islets of CFD and HFD mice.Insulin secretion (n = 10; A) and intracellular cAMP levels (n = 6; B) in isolated islets of CFD (open bars) and HFD mice (filled bars) were examined in response to 10–9 or 10–7 M GIP in the presence of 11.1 mM glucose. The isolated islets of these mice were incubated with 5 µM forskolin to assess maximal insulin secretion and cAMP production. Values are means ± SE. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. CFD mice.

 

View this table:
[in this window]
[in a new window]

  		Table 1. Insulin secretion induced by glucose and high potassium (30 mM KCl) in the isolated islets of CFD and HFD mice

 
Expression of total and truncated GIPR in islets of HFD mice. To confirm differences in GIPR expression in islets between HFD and CFD mice, quantitative RT-PCR was performed. Total GIPR expression in the islets of HFD mice was similar to that of CFD mice (Fig. 6A). The relative expression level of truncated GIPR was then compared in the islets of HFD and CFD mice. The ratio of truncated GIPR to total GIPR expression in the islets of HFD mice was decreased by 32% compared with that in CFD mice (Fig. 6B).


Figure 6
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 6. Total and truncated GIPR expression in islets of CFD and HFD mice. Quantitative RT-PCR of total GIPR (A) and truncated GIPR (B) were assessed in islets of CFD (n = 6) and HFD mice (n = 6). The ratio of truncated GIPR to total GIPR (B) was calculated by quantitative RT-PCR of total GIPR and truncated GIPR. The data on HFD mice are shown relative to CFD mice. Values are means ± SE. *P < 0.05 vs. CFD mice.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In the present study, we have identified a novel splice variant GIPR expressed in mouse pancreatic β-cells and characterized its effect on GIPR sensitivity in high-fat diet-induced obese mice.

We (21) previously investigated GIP-induced insulin secretion using GIPR–/– mice under high-fat feeding. The plasma insulin levels after meal ingestion were increased in high-fat diet-fed GIPR+/+ mice compared with those in control diet-fed GIPR+/+ mice, resulting in similar glucose levels. However, the postprandial glucose levels were increased by the lack of GIP-induced compensatory insulin secretion in high-fat diet-fed GIPR–/– mice, suggesting that increased insulin secretion due to enhanced GIP signaling is required to maintain glucose homeostasis in the obese state. In the present study, we have demonstrated hypersensitivity of GIPR to GIP in β-cells of high-fat-induced obese mice. Increased sensitivity of GIPR to GIP might result from increased expression of GIPR or hypersensitivity of intracellular GIP signal transduction. Some (9, 18) studies have reported that GIPR expression is an important factor in altering the GIP sensitivity of β-cells. In the study of diabetic Zucker fatty rats, GIPR mRNA expression and protein were decreased in islets compared with that of lean rats, which led to diminished GIPR sensitivity to GIP (17). Here, we found that total GIPR expression was not decreased and that GIPR sensitivity to GIP was increased in isolated islets of our HFD mice due to decreased expression of truncated GIPR, in contrast to the findings in diabetic obese rats. Our HFD mice were mild obese and mild hyperinsulinemia induced by high-fat feeding rather than by genetic factors. In addition, our obese mice did not have diabetes. Thus, differences of the expression of GIPR and subsequent GIPR sensitivity to GIP may be due to the different phenotypes of diabetic obese rats and HFD mice.

We had previously obtained the extra band of this GIPR variant as well as the band of wild-type GIPR when we amplified mouse islet cDNA to detect wild-type GIPR using NH2-terminal and COOH-terminal primers of GIPR. We analyzed the cDNA sequence of the extra band and identified it as a splice variant of GIPR that was not produced by PCR error. Indeed, certain GIPR splice variants resulting in truncation have been reported in previous studies (7, 32). These splice variants were detected from cDNA libraries of human islets and insulinoma. However, the variants were not examined in regard to their regulatory role in GIPR sensitivity. In the present study, by evaluating the function of truncated GIPR in transfected COS-7 cells, we have shown that truncated GIPR has a dose-dependent dominant negative effect against wild-type GIPR.

GPCRs were generally thought to function as monomers, but recent studies (5, 12, 13) have reported that GPCRs can form homodimeric or heterodimeric complexes with receptors in the ER and that these complexes are important in receptor folding and trafficking to the plasma membrane. In the present study, we investigated the mechanism of negative action of truncated GIPR against wild-type GIPR function using immunochemistry and immunoprecipitation of cotransfected cells. Truncated GIPR interacted with wild-type GIPR in the ER and influenced wild-type receptor trafficking to the cell membrane. Some GPCRs have specific motifs for dimerization that are required for transport of the receptors from the ER to the cell surface (1, 8, 19, 26). Mutations in these motifs prevent dimerization with wild-type receptors and inhibit their trafficking to the cell membrane, indicating a dominant negative effect against the wild-type receptor (19, 26). Although these specific motifs are not found in GIPR, truncated GIPR might have formed from complexes with wild-type GIPR in our experiments.

To evaluate the functional relevance of truncated GIPR in vivo, we investigated the expression of truncated GIPR in β-cells. The relative abundance of truncated GIPR expression was decreased in islets of HFD mice. The decreased dominant negative effect due to reduced expression of truncated GIPR might well be involved in augmented intracellular cAMP production and insulin secretion in response to GIP in islets in diet-induced obesity. Altered selective splicing in response to metabolic changes of the insulin receptor in β-cells was also reported (10), and hyperglycemia not only decreased total insulin receptor expression but also altered the relative expression ratio of the two insulin receptor isoforms in human islets, resulting in attenuation of insulin signal transduction. Although the mechanism of mRNA selective splicing of GIPR is unclear, insulin is reported (4) to influence the activity of the mRNA slicing regulator ASF/SF2, a serine/arginine-rich protein (SR protein). Further study is necessary to clarify the mechanism of GIPR mRNA selective splicing in response to metabolic changes.

In conclusion, we have identified a splice variant GIPR in mouse islets that has a dominant negative effect against the wild-type receptor by interacting in translocation of wild-type GIPR from the ER to the cell surface. Thus, reduced expression of truncated GIPR due to selective splicing and subsequent GIPR hypersensitivity to GIP may be involved in increased insulin secretion in response to GIP in metabolic states such as obesity.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This study was supported by Scientific Research Grants from the Ministry of Education, Culture, Sports, Science, and Technology (Japan); Health and Labor Sciences Research Grants for Comprehensive Research on Aging and Health from the Ministry of Health, Labor, and Welfare (Japan); and the 21st Century Center of Excellence Program (Japan).


   ACKNOWLEDGMENTS
 
We thank K. Yamada and Dr. M. Sasaki for technical help.


   FOOTNOTES
 

Address for reprint requests and other correspondence: Y. Yamada, Dept. of Internal Medicine, Div. of Endocrinology, Diabetes, and Geriatric Medicine, Akita University School of Medicine, 1-1-1, Hondo, Akita 010-8543, Japan (e-mail: yamada{at}gipc.akita-u.ac.jp)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. AnderssonH, D'Antona AM, Kendall DA, Von Heijne G, Chin CN. Membrane assembly of the cannabinoid receptor 1: impact of a long N-terminal tail. Mol Phamacol 64: 570–577, 2003.[Abstract/Free Full Text]
  2. BoylanMO, Jepeal LI, Wolfe MM. Structure of the rat glucose-dependent insulinotropic polypeptide receptor gene. Peptides 20: 219–228, 1999.[CrossRef][Web of Science][Medline]
  3. CreuzfeldtW, Ebert R, Willms B, Frerichs H, Brown JC. Gastric inhibitory polypeptide (GIP) and insulin in obesity: increased response to stimulation and defective feedback control of serum levels. Diabetologia 14: 15–24, 1983.[CrossRef]
  4. DiamondRH, Du K, Lee VM, Mohn KL, Haber BA, Tewari DS, Taub R. Novel delayed-early and highly insulin-induced growth response genes. Identification of HRS, a potential regulator of alternative pre-mRNA splicing. J Biol Chem 268: 15185–15192, 1993.[Abstract/Free Full Text]
  5. DuvernayMT, Filipeanu CM, Wu G. The regulatory mechanisms of export trafficking of G protein-coupled receptors. Cell Signal 17: 1457–1465, 2005.[CrossRef][Web of Science][Medline]
  6. FlattPR, Bailey CJ, Kwasowski P, Swanston-Flatt SK, Marks V. Abnormalities of GIP in spontaneous syndromes of obesity and diabetes in mice. Diabetes 32: 433–435, 1983.[Abstract]
  7. GremlichS, Porret A, Hani EH, Cherif D, Vionnet N, Froguel P, Thorens B. Cloning, functional expression, and chromosomal localization of the human pancreatic islet glucose-dependent insulinotropic polypeptide receptor. Diabetes 44: 1202–1208, 1995.[Abstract]
  8. HagueC, Uberti MA, Chen Z, Hall RA, Minneman KP. Cell surface expression of {alpha}1D-adrenergic receptors is controlled by heterodimerization with {alpha}1B-adrenergic receptors. J Biol Chem 279: 15541–15549, 2004.[Abstract/Free Full Text]
  9. HolstJJ, Gromada J, Nauck MA. The pathogenesis of NIDDM involves a defective expression of the GIP receptor. Diabetologia 40: 984–986, 1997.[CrossRef][Web of Science][Medline]
  10. HribalML, Perego L, Lovari S, Andreozzi F, Menghini R, Perego C, Finzi G, Usellini L, Placidi C, Capella C, Guzzi V, Lauro D, Bertuzzi F, Davalli A, Pozza G, Pontiroli A, Federici M, Lauro R, Brunetti A, Folli F, Sesti G. Chronic hyperglycemia impairs insulin secretion by affecting insulin receptor expression, splicing, and signaling in RIN beta cell line and human islets of Langerhans. FASEB J 17: 1340–1342, 2003.[Abstract/Free Full Text]
  11. IshiharaT, Nakamura S, Kaziro Y, Takahashi T, Takahashi K, Nagata S. Molecular cloning and expression of a cDNA encoding the secretin receptor. EMBO J 7: 1635–1641, 1991.
  12. JonesKA, Tamm JA, Craig DA, Durkin MM, Dai M, Yao WJ, Johnson M, Gunwaldsen C, Huang LY, Tang C, Shen Q, Salon JA, Morse K, Laz T, Smith KE, Nagarathnam D, Noble SA, Branchek TA, Gerald C. GABA(B) receptors function as a heteromeric assembly of the subunits GABA(B)R1 and GABA(B)R2. Nature 396: 674–679, 1998.[CrossRef][Medline]
  13. JordanBA, Trapaidze N, Gomes I, Nivarthi R, Devi LA. Oligomerization of opioid receptors with β2-adrenergic receptors: a role in trafficking and mitogen-activated protein kinase activation. Proc Natl Acad Sci USA 98: 343–348, 2001.[Abstract/Free Full Text]
  14. KahnBB, Flier JS. Obesity and insulin resistance. J Clin Invest 106: 473–481, 2000.[Web of Science][Medline]
  15. KubotaA, Yamada Y, Hayami T, Yasuda K, Someya Y, Ihara Y, Kagimoto S, Watanabe R, Taminato T, Tsuda K, Seino Y. Identification of two missense mutations in the GIP receptor gene: a functional study and association analysis with NIDDM: no evidence of association with Japanese NIDDM subjects. Diabetes 45: 1701–1705, 1996.[Abstract]
  16. LemieuxI, Pascot A, Couillard C, Lamarche B, Tchernof A, Alméras N, Bergeron J, Gaudet D, Tremblay G, Prud'homme D, Nadeau A, Després JP. Hypertriglyceridemic waist: A marker of the atherogenic metabolic triad (hyperinsulinemia; hyperapolipoprotein B; small, dense LDL) in men? Circulation 102: 179–184, 2000.[Abstract/Free Full Text]
  17. LynnFC, Pamir N, Ng EH, McIntosh CH, Kieffer TJ, Pederson RA. Defective glucose-dependent insulinotropic polypeptide receptor expression in diabetic fatty Zucker rats. Diabetes 50: 1004–1011, 2001.[Abstract/Free Full Text]
  18. LynnFC, Thompson SA, Pospisilik JA, Ehses JA, Hinke SA, Pamir N, McIntosh CH, Pederson RA. A novel pathway for regulation of glucose-dependent insulinotropic polypeptide (GIP) receptor expression in beta cells. FASEB J 17: 91–93, 2003.[Abstract/Free Full Text]
  19. Margeta-MitrovicM, Jan YN, Jan LY. Function of GB1 and GB2 subunits in G protein coupling of GABA(B) receptors. Proc Natl Acad Sci USA 98: 14649–14654, 2001.[Abstract/Free Full Text]
  20. MiyawakiK, Yamada Y, Ban N, Ihara Y, Tsukiyama K, Zhou H, Fujimoto S, Oku A, Tsuda K, Toyokuni S, Hiai H, Mizunoya W, Fushiki T, Holst JJ, Makino M, Tashita A, Kobara Y, Tsubamoto Y, Jinnouchi T, Jomori T, Seino Y. Inhibition of gastric inhibitory polypeptide signaling prevents obesity. Nat Med 8: 738–742, 2002.[CrossRef][Web of Science][Medline]
  21. MiyawakiK, Yamada Y, Yano H, Niwa H, Ban N, Ihara Y, Kubota A, Fujimoto S, Kajikawa M, Kuroe A, Tsuda K, Hashimoto H, Yamashita T, Jomori T, Tashiro F, Miyazaki J, Seino Y. Glucose intolerance caused by a defect in the entero-insular axis: a study in gastric inhibitory polypeptide receptor knockout mice. Proc Natl Acad Sci USA 96: 14843–14847, 1999.[Abstract/Free Full Text]
  22. MukaiE, Ishida H, Kato S, Tsura Y, Fujimoto S, Takahashi A, Horie M, Tsuda K, Seino Y. Metabolic inhibition impairs ATP-sensitive K+ channel block by sulfonylurea in pancreatic β-cells. Am J Physiol Endocrinol Metab 274: E38–E44, 1998.[Abstract/Free Full Text]
  23. NakamuraY, Suzuki H, Sakaguchi M, Mihara K. Targeting and assembly of mitochondrial translocase of outer membrane 22 (TOM22) into the TOM complex. J Biol Chem 279: 21223–21232, 2004.[Abstract/Free Full Text]
  24. PedersonRA. GIP. Gut Peptides, edited by Walsh J and Dockray G. New York: Raven, 1993, p. 217–259.
  25. ReavenGM. Role of insulin resistance in human disease. Diabetes 37: 1066–1084, 1988.
  26. SalahpourA, Angers S, Mercier JF, Lagace M, Marullo S, Bouvier M. Homodimerization of the β2-adrenergic receptor as a prerequisite for cell surface targeting. J Biol Chem 279: 33390–33397, 2004.[Abstract/Free Full Text]
  27. ServiceFJ, Rizza RA, Westland RE, Hall LD, Gerich JE, Go VL. Gastric inhibitory polypeptide in obesity and diabetes mellitus. J Clin Endocrinol Metab 58: 1133–1140, 1984.[Abstract/Free Full Text]
  28. StockS, Leichner P, Wong AC, Ghatei MA, Kieffer TJ, Bloom SR, Chanoine JP. Ghrelin, peptide YY, glucose-dependent insulinotropic polypeptide, and hunger responses to a mixed meal in anorexic, obese, and control female adolescents. J Clin Endocrinol Metab 90: 2161–2168, 2005.[Abstract/Free Full Text]
  29. SuttonR, Peters M, McShane P, Gray DW, Morris PJ. Isolation of rat pancreatic islets by ductal injection of collagenase. Transplantation 42: 689–691, 1986.[Web of Science][Medline]
  30. TsukiyamaK, Yamada Y, Yamada C, Harada N, Kawasaki Y, Ogura M, Bessho K, Li M, Amizuka N, Sato M, Udagawa N, Takahashi N, Tanaka K, Oiso Y, Seino Y. Gastric inhibitory polypeptide as an endogenous factor promoting new bone formation following food ingestion. Mol Endocrinol 20: 1644–1651, 2006.[Abstract/Free Full Text]
  31. UsdinTB, Mezey E, Button DC, Brownstein MJ, Bonner TI. Gastric inhibitory polypeptide receptor, a member of the secretin-vasoactive intestinal peptide receptor family, is widely distributed in peripheral organs and the brain. Endocrinology 133: 2861–2870, 1993.[Abstract/Free Full Text]
  32. VolzA, Göke R, Lankat-Buttgereit B, Fehmann HC, Bode HP, Goke B. Molecular cloning, functional expression, and signal transduction of the GIP-receptor cloned from a human insulinoma. FEBS Lett 373: 23–29, 1995.[CrossRef][Web of Science][Medline]
  33. YamadaY, Hayami T, Nakamura K, Kaisaki PJ, Someya Y, Wang CZ, Seino S, Seino Y. Human gastric inhibitory polypeptide receptor: cloning of the gene (GIPR) and cDNA. Genomics 29: 773–776, 1995.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 FASEB J.Home page
Y. Sztainberg, Y. Kuperman, O. Issler, S. Gil, J. Vaughan, J. Rivier, W. Vale, and A. Chen
A novel corticotropin-releasing factor receptor splice variant exhibits dominant negative activity: a putative link to stress-induced heart disease
FASEB J, July 1, 2009; 23(7): 2186 - 2196.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/1/E61    most recent
00358.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harada, N.
Right arrow Articles by Inagaki, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harada, N.
Right arrow Articles by Inagaki, N.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.