Am J Physiol Endocrinol Metab 293: E1810-E1819, 2007.
First published October 2, 2007; doi:10.1152/ajpendo.00295.2007
0193-1849/07 $8.00
Increased TNF
and CCAAT/enhancer-binding protein homologous protein with aging predispose preadipocytes to resist adipogenesis
Tamara Tchkonia,1,*
Tamar Pirtskhalava,1,*
Thomas Thomou,1
Mark J. Cartwright,1
Barton Wise,1
Iordanes Karagiannides,1
Alexander Shpilman,1
Timothy L. Lash,1
J. David Becherer,2 and
James L. Kirkland1
1Evans Department of Medicine and Department of Biochemistry, Boston University Medical Center, Boston, Massachusetts; and 2GlaxoSmithKline, Research Triangle, North Carolina
Submitted 15 May 2007
; accepted in final form 28 September 2007
 |
ABSTRACT
|
|---|
Fat depot sizes peak in middle age but decrease by advanced old age. This phenomenon is associated with ectopic fat deposition, decreased adipocyte size, impaired differentiation of preadipocytes into fat cells, decreased adipogenic transcription factor expression, and increased fat tissue inflammatory cytokine generation. To define the mechanisms contributing to impaired adipogenesis with aging, we examined the release of TNF
, which inhibits adipogenesis, and the expression of CCAAT/enhancer-binding protein (C/EBP) homologous protein (CHOP), which blocks activity of adipogenic C/EBP family members, in preadipocytes cultured from young, middle-aged, and old rats. Medium conditioned by fat tissue, as well as preadipocytes, from old rats impeded lipid accumulation by preadipocytes from young animals. More TNF
was released by preadipocytes from old than young rats. Differences in TNF
-converting enzyme, TNF
degradation, or the presence of macrophages in cultures were not responsible. TNF
induced rat preadipocyte CHOP expression. CHOP was higher in undifferentiated preadipocytes from old than younger animals. Overexpression of CHOP in young rat preadipocytes inhibited lipid accumulation. TNF
short interference RNA reduced CHOP and partially restored lipid accumulation in old rat preadipocytes. CHOP normally increases during late differentiation, potentially modulating the process. This late increase in CHOP was not affected substantially by aging: CHOP was similar in differentiating preadipocytes and fat tissue from old and young animals. Hypoglycemia, which normally causes an adaptive increase in CHOP, was less effective in inducing CHOP in preadipocytes from old than younger animals. Thus increased TNF
release by undifferentiated preadipocytes with elevated basal CHOP contributes to impaired adipogenesis with aging.
adipocytes; CCAAT/enhancer-binding protein-
; growth arrest and DNA damage 153; differentiation; stress response; hypoglycemia
FAT DEPOTS ENLARGE through middle age and then become smaller in advanced old age (34, 38). Declining depot size in old age is associated with ectopic fat deposition in liver, muscle, marrow, and other sites, decreased fat cell size and function, and increased fat tissue TNF
(51). Fat cells turn over, with new fat cells developing from preadipocytes, which are present in fat depots throughout life (3, 4, 37, 59). Aging is associated with reduced preadipocyte capacity for differentiation into fat cells and decreased expression of the key adipogenic transcription factors CCAAT/enhancer-binding protein-
(C/EBP
) and peroxisome proliferator-activated receptor-
(PPAR
) (24, 30, 35, 38, 64). TNF
can impede adipogenesis through several mechanisms: causing impaired insulin/insulin-like growth factor I responsiveness, increasing CUG triplet repeat-binding protein activity [leading to increased production of C/EBPβ-liver-enriched inhibitory peptide (LIP), an antiadipogenic factor (31)], impairing PPAR
expression through NF-
B-mediated mechanisms (8, 71), and activating the cellular stress response. Preadipocytes can mount an innate immune response, producing inflammatory cytokines and chemokines in response to lipopolysaccharide (12). Thus, in addition to macrophages, the preadipocytes that constitute 15–50% of cells in fat tissue are capable of releasing TNF
.
Together with C/EBP
, other C/EBP family members regulate adipogenesis, including C/EBPβ, C/EBP
, and C/EBP homologous protein 10 (CHOP), also known as C/EBP
, DNA damage inducible transcript 3 (Ddit3), and growth arrest and DNA damage 153 (GADD153). Adipogenic C/EBP family members bind as homo- or heterodimers to C/EBP sites in differentiation-dependent promoters (45, 57). An increase in C/EBPβ expression on induction of differentiation promotes PPAR
and C/EBP
expression, driving adipogenesis (11, 13, 70, 72). Although increases in C/EBP
and PPAR
expression during adipogenesis are blunted with aging, the earlier increase in C/EBPβ mRNA is not (30). This implies that mechanisms that contribute to impaired differentiation with aging act at a point between the increase in C/EBPβ transcription and subsequent increases in C/EBP
and PPAR
.
One regulator that can operate at this point is CHOP, a cellular stress-response protein (2, 66). When CHOP forms heterodimers with adipogenic C/EBP family members, it impairs their ability to activate preadipocyte differentiation-dependent promoters. CHOP blocks promotion of adipogenesis by full-length C/EBPβ in the 3T3-L1 murine preadipocyte cell line (56). The tyrosine kinase inhibitor genistein increases CHOP expression, impeding C/EBPβ transactivating activity, expression of C/EBP
and PPAR
, and adipogenesis in these cells (22). Similarly, the calpain protease inhibitor N-acetyl-Leu-Leu-norleucinal, which increases CHOP, blocks adipogenesis in 3T3-L1 cells (61). Very little is known about CHOP in primary preadipocytes, which differ in many respects from cell lines. For example, a round of replication, an event involving changes in CHOP abundance, is required in 3T3-L1 cells before adipogenesis proceeds (61). However, replication is not required before differentiation can proceed in primary preadipocytes (15).
TNF
increases in fat tissue with aging, macrophages and preadipocytes can produce TNF
, TNF
induces cellular stress responses, CHOP is increased by stress responses, and impaired adipogenesis with aging comes at a point in the transcription factor cascade at which CHOP intercedes. Therefore, we tested the hypothesis that TNF
and CHOP increase with aging in cultured undifferentiated preadipocytes, predisposing to impaired adipogenesis.
 |
METHODS
|
|---|
Preadipocyte cultures.
Specific pathogen-free male Brown Norway rats [3 (young), 15–17 (middle-aged), and 24–31 (old) mo of age] were obtained from the Harlan Sprague Dawley (Indianapolis, IN) colony maintained under contract by the National Institute on Aging (median survival 32 mo, maximum survival 43 mo). Animals were given NIH 31 chow and water ad libitum and were acclimatized in a 12:12-h light-dark constant-environment facility separately from other animals for 7 days before experiments. All studies were approved by the Boston University Institutional Animal Care and Use Committee. After euthanasia with CO2, epididymal or perirenal fat depots were removed under sterile conditions. Fat tissue was minced into fragments, digested in 1 mg of collagenase per milliliter of Hanks' balanced salt solution for 60 min at 37°C, and filtered through a 100-µm nylon mesh (35–37, 67). After centrifugation of the digests, the pellets were resuspended in a basal medium (
-MEM containing 10% FBS and antibiotics) and plated at
4 x 104 cells/cm2. After 12 h, a period before replication occurs (14), adherent preadipocytes were washed, trypsinized, and replated at a density of 4 x 104 cells/cm2. We found that replating 1) reduces mesothelial cell and macrophage contamination and 2) results in accurate plating densities [plating density affects capacity of preadipocytes to differentiate (68)]. Using these methods, we demonstrated that preadipocyte recoveries are similar among age groups and that our isolation procedures result in >90%-pure populations of preadipocytes, irrespective of animal age (35). Markers of macrophages [F4/80 (emr1), scya4, cd11β, and cd45 (ptprc)], endothelial cells [vegfr (flk1), vegfr2 (kdr), cd46 (mcp), and von Willebrand], and multipotent mesenchymal progenitors (cd34, connexin 43, sox2, and smad4) indicated that age-related shifts in abundance of these cell types in preadipocyte cultures did not account for our results. Brown fat preadipocytes are not present in epididymal cultures, since uncoupling protein 1 is not evident in these cultures after treatment with isoproterenol but is observed in interscapular preadipocyte positive controls (36, 41). To induce differentiation, confluent preadipocyte cultures were exposed to a serum-free differentiation-inducing medium (DM) containing 5 µg/ml insulin, 10 µg/ml transferrin, and 200 pM triiodothyronine in 1:1 DMEM-Ham's F-12 (20). Media were changed every 2 days.
Coculture and conditioned medium.
For fat tissue coculture studies, 500-mg perirenal fat tissue aliquots from rats of different ages isolated in parallel were placed in Transwell inserts with 0.24-µm pores. The inserts were placed in wells in six-well plates that contained confluent perirenal preadipocytes from 3-mo-old rats. DM was added to the wells containing the inserts for 7 days. For preadipocyte conditioned medium studies, confluent undifferentiated preadipocytes from 3- and 24-mo-old rats cultured in parallel were washed twice and incubated with Krebs-Ringer phosphate (KRP) buffer for 24 h. The medium was removed and centrifuged at 1,000 g for 10 min. The conditioned medium was added to confluent perirenal preadipocytes that had been treated with DM for 48 h for a further 24 h.
Western immunoblot analyses.
Cultures were washed with PBS, scraped into RIPA buffer (73), and subjected to SDS-PAGE (44). The gels were stained for visualization of banding, or the protein was transferred to Immobilon P polyvinylidene difluoride membranes for probing. Blotting paper was blocked for 1 h at room temperature in Tris-buffered saline containing 5% milk, 0.5% BSA, and 0.1% Tween 20. Blots were incubated for 1 h at room temperature with primary antibody {catalog nos. 793 (CHOP) and sc-6416 [TNF
-converting enzyme (TACE)], Santa Cruz Biotechnology, Santa Cruz, CA} (49) and for 30 min at room temperature with secondary antibody conjugated to horseradish peroxidase. Binding of the horseradish peroxidase-conjugated secondary antibody was visualized by chemiluminescense. Loading of 40 µg of protein in each lane gave results in the linear range for detection of CHOP. Total protein contents (pg/cell) were 337 ± 32, 347 ± 35, and 361 ± 39 in undifferentiated epididymal preadipocytes from 3-, 17-, and 30-mo-old rats, respectively (n = 16 in each group). Densitometry data are expressed as a function of cell number. Data are expressed as a percentage of mean intensities within each replication of experiments and shown as means ± SE. For example, if n = 6, the result in young preadipocytes is the mean ± SE of replications 1–6, where the value for replication 1 is young1/(young1 + middle-aged1 + old1) expressed as a percentage after correction for cell number.
ELISA.
Confluent, undifferentiated preadipocytes were held at confluence for 48 h and then washed twice with PBS. KRP buffer was added for a further 48 h (3 ml per T-25 flask). TNF
was assayed by ELISA (catalog no. KRC3014, BioSource International).
TNF
degradation.
Preadipocytes that had been confluent for 48 h were washed twice with PBS. 125I-labeled TNF
(0.16 µCi/ml) in KRP buffer containing 4% BSA was added for 24 h (3 ml per T-25 flask). After 24 and 48 h, 50-µl aliquots were run on 12% polyacrylamide gels, with 1 µl (0.002 µCi) of undiluted stock run for controls. After electrophoresis, gels were exposed to X-ray film for 24 h at –80°C. Cells were harvested, and aliquots were assayed for DNA (43).
RNA analysis.
Total RNA was extracted from preadipocytes using the guanidinium thiocyanate-phenol method (10). RNA integrity was verified using 1% formaldehyde-containing denaturing agarose gels. Total RNA (1 µg) was reverse transcribed with Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) and random oligonucleotides (Amersham, Piscataway, NJ). mRNA was measured by real-time (see below) or relative quantitative RT-PCR, in which target genes were coamplified with an internal 18S rRNA control sequence (63). The quantitative nature of this approach was confirmed by measurement of CHOP mRNA in serially diluted samples. RNA preparations were checked for DNA contamination by amplification of control aliquots that had not been reverse transcribed. The following primers were used for CHOP: 5' GCGGCTCAACGAGGAAATCG 3' (sense) and 5' AAGCCCCTCTCTCCTTTGGTCTAC 3' (antisense; accession no. U30186). Real-time PCR were performed using an ABI 7500 real-time PCR system and software (Applied Biosystems, Foster City, CA). Amplification was performed in a final volume of 20 µl containing 1 µl of cDNA from the reverse-transcribed reaction mixture. CHOP and TNF
mRNA expression was analyzed during the exponential phase of amplification using the TaqMan fluorogenic 5'-nuclease PCR assay (Applied Biosystems) for each target gene (23) [Applied Biosystems Assay catalog nos. Rn00492098 (for CHOP) and Rn00562055 (for TNF
)]. 18S rRNA was used as an endogenous control and was detected using a dual-labeled fluorogenic (5'VIC/3'TAMRA) probe (catalog no. 4310893E, Applied Biosystems). Data are expressed as ratio of target mRNA to 18S rRNA.
DNA transfection.
Preadipocytes were cotransfected using the calcium phosphate precipitation method (69) with plasmid mCHOP10.pCDNA1 (provided by D. Ron) and pMSV-β-Gal (Invitrogen) at a molar ratio of 5:1 (transcription factor-reporter construct) to ensure that the pMSV-β-Gal-transfected cells detected by staining for β-galactosidase (β-Gal) would also express CHOP. Approximately 15% of transfected cells were positive for β-Gal. Mock-control cells were transfected with a plasmid, PVG 9607(GAPDH) (42), that expresses GAPDH and had no effect on lipid accumulation compared with untransfected cells, also at a 5:1 molar ratio. After 48 h of culture in DM, cells were fixed in 3% formaldehyde and stained with the chromatographic β-Gal substrate X-Gal for identification of transfected cells (58). Observers unaware of cell origin assessed extent of lipid accumulation by examining transfected cells for the presence of doubly refractile lipid inclusions by low-power phase-contrast microscopy (31, 35, 67). The lipid nature of these inclusions was confirmed by staining with oil red O (62, 67). In previous experiments, we demonstrated that inclusions of this type appear only in differentiating preadipocytes, and not in other cell types (e.g., lung fibroblasts), in the DM we used. The proportion of such cells correlates with the adipogenesis markers glycerol-3-phosphate dehydrogenase activity and the fatty acid-binding protein aP2 (fatty acid-binding protein 4) expression (35, 62, 67). This assay permits delineation of lipid accumulation in the individual cells that are transfected as evident by β-Gal staining. The proportion of transfected cells containing such inclusions was compared with that of parallel mock-control cultures.
Short interference RNA-mediated TNF
knockdown.
TNF
short interference RNA (siRNA) was synthesized (catalog no. M-100312-00, Dharmacon, Lafayette, CO). TNF
siRNA was labeled with a Cy3 labeling kit (Mirus, Madison, WI). The labeled siRNA was transfected into epididymal rat preadipocytes at 75% confluence with the RNAifect transfection reagent (Qiagen, Valencia, CA). As a control, transfection with nonsilencing, fluorescein-labeled siRNA was carried out under the same conditions (catalog no. 1022079, Qiagen). After 6 h, the cells were washed with PBS, and
-MEM containing 10% FBS was added. Undifferentiated cells were harvested after 12 h for determination of CHOP and TNF
mRNA. For studies of adipogenesis, differentiation was initiated 12 h after the siRNA transfection for up to 8 days. Medium was changed every other day.
Statistical analysis.
Values are means ± SE. Each n represents sets of cultures from separate groups of animals. Significance was determined by t-tests or single-factor ANOVA, as appropriate (29, 32). Appropriate post hoc tests were used to determine differences among groups. In transfection and siRNA experiments, numbers of transfectants containing lipid inclusions were compared with control cells by logistic regression analysis, with P values determined from log-likelihood ratios (39). P < 0.05 was considered significant.
 |
RESULTS
|
|---|
Fat tissue and preadipocytes from old rats inhibit lipid accumulation by preadipocytes from young animals.
To test the hypothesis that factors released by fat tissue from old rats impede lipid accumulation by preadipocytes from young animals, fat tissue fragments of equal weight from 3-, 18-, and 31-mo-old rats were cocultured with target preadipocytes from young animals. DM was added. Less lipid was accumulated by the target preadipocytes from young animals by exposure to fat tissue from old animals than exposure to fat tissue from young animals (Fig. 1A). To test whether factors released by preadipocytes from old animals contribute to this inhibition of adipogenesis, conditioned medium was prepared by incubation of preadipocytes from young or old animals in Krebs buffer for 24 h. Treatment of differentiating young rat preadipocytes with the conditioned medium from old rat preadipocytes inhibited lipid accumulation to a greater extent than treatment with conditioned medium from young rat preadipocytes (Fig. 1B). Preadipocytes from old animals also impeded adipogenesis in target preadipocytes from young rats in coculture experiments (not shown). In these experiments, Transwell inserts with confluent preadipocytes from young or old animals were placed into wells containing target cells from young animals and then treated with DM for 48 h (n = 5).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 1. Fat tissue and preadipocytes from old rats inhibit adipogenesis. A: representative photomicrograph of target preadipocytes exposed to 3-, 18-, or 31-mo-old rat fat for 7 days. Equal aliquots of perirenal fat tissue isolated from 3-, 18-, and 31-mo-old rats were placed in Transwell inserts, which were placed into 6-well plates containing confluent target preadipocytes from 3-mo-old rats, and differentiation-inducing medium was added. Fat tissue from 31-mo-old rats resulted in less target preadipocyte lipid accumulation than fat from 3-mo-old rats (n = 3, P < 0.05). B: conditioned medium prepared from preadipocytes isolated from old animals impedes lipid accumulation by preadipocytes from young animals. Krebs-Ringer phosphate buffer was incubated with equal numbers of undifferentiated preadipocytes from 3- and 24-mo-old rats for 24 h, removed, and added to differentiated rat preadipocytes. Scale bar, 20 µm. Photomicrographs represent results from 5 experiments.
|
|
Preadipocyte TNF
release increases with aging.
TNF
was assayed in medium in which confluent, undifferentiated perirenal and epididymal preadipocytes from 3- and 24-mo-old rats had been cultured for 48 h (Fig. 2A). Cellular TNF
production by preadipocytes from old animals was greater than that by preadipocytes from young animals (n = 22, P < 0.0001 for effect of age, by ANOVA). More TNF
was released by epididymal than by perirenal preadipocytes (n = 12, P < 0.001 for effect of depot, by ANOVA), consistent with the greater capacity for lipid accumulation and differentiation-dependent marker expression by perirenal than epididymal cells (14, 35, 36). By 24 h, conditioned medium TNF
concentrations were 471 ± 75 pg/ml from 24-mo-old rat epididymal preadipocytes and 158 ± 33 pg/ml from 3-mo-old cells (n = 20, P < 0.0005, by t test). The increased TNF
in medium from preadipocytes cultured from old animals is not likely a consequence of increased release of membrane-bound TNF
by TACE, since TACE protein was similar in preadipocytes from old and young animals and was not affected appreciably by depot origin or adipogenesis (Fig. 2B; P = 0.96, by ANOVA). TNF
is labile. To test whether decreased degradation accounts for increased TNF
in medium with aging, labeled TNF
was added to medium in which preadipocytes from young, middle-aged, or old animals were cultured. Degradation was similar across the age groups (Fig. 2C). Thus preadipocyte TNF
release is among the mechanisms potentially contributing to impaired adipogenesis with aging in preadipocyte primary cultures.
TNF
increases primary rat preadipocyte CHOP.
To test whether TNF
induces primary preadipocyte CHOP, undifferentiated, confluent epididymal preadipocytes from young rats were exposed for 24 h to rat TNF
at 500 pM, which is close to concentrations in conditioned medium from preadipocytes cultured from old animals. TNF
increased cellular CHOP (Fig. 3; n = 3, P < 0.05, by t-test).
Undifferentiated preadipocyte CHOP increases with aging.
Since TNF
increases CHOP and TNF
production increases with aging, we tested the hypothesis that preadipocyte CHOP increases with aging. CHOP levels were measured in undifferentiated epididymal preadipocytes cultured in parallel from young, middle-aged, and old rats 48 h after reaching confluence (Fig. 4). Preadipocytes from the old rats expressed more CHOP than cells from middle-aged or young rats (n = 6, P < 0.05, old vs. young or middle aged, by Duncan's multiple range test), as occurred in preadipocytes from young rats exposed to TNF
.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 4. CHOP is higher in undifferentiated preadipocytes from old than younger animals. CHOP levels were measured in confluent preadipocytes cultured in parallel from young (3-mo-old), middle-aged (15-mo-old), and old (27-mo-old) rats that had been maintained at confluence for 48 h. Top: Western immunoblot representative of 6 separate experiments. Bottom: densitometric analyses of CHOP abundance. Values (means ± SE) represent percentage of summed optical densities (OD) across age groups within each experiment. *P < 0.05 vs. 3- or 15-mo-old rats.
|
|
CHOP impedes primary preadipocyte lipid accumulation.
To establish whether, as in preadipocyte cell lines, CHOP blocks adipogenesis in euploid, primary cultured preadipocytes, we overexpressed CHOP in perirenal preadipocytes isolated from young animals (Fig. 5). CHOP and β-Gal expression vectors were cotransfected at a 5:1 molar ratio, so that cells transfected with CHOP would be detected by β-Gal staining (30, 62). Control cells were transfected with a GAPDH expression vector, also with the β-Gal expression vector at a 5:1 molar ratio. The transfected cells were treated with DM for 48 h. The proportions of β-Gal-expressing cells that contained the doubly refractile lipid inclusions visible by low-power phase-contrast microscopy [characteristic of differentiating preadipocytes (35)] were determined in CHOP- and control-transfected cultures by observers who were unaware of culture treatments. CHOP transfection prevented lipid accumulation. More preadipocytes transfected with the control vector accumulated lipid than cells transfected with the CHOP construct (odds ratio = 2.5, 95% confidence interval = 1.8–3.5, n = 4 rats, 100 CHOP- and 100 mock-transfected cells/rat, 33 ± 7% of mock-transfected cells acquired doubly refractile lipid inclusions vs. 17 ± 6% of CHOP-transfected cells, P < 0.05, by t-test). Thus lipid accumulation in primary rat preadipocytes is inhibited by overexpression of CHOP, as occurs in cell lines.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 5. CHOP overexpression blocks adipogenesis in preadipocytes from young rats. Perirenal preadipocytes from 3-mo-old rats were cotransfected with CHOP and β-galactosidase (β-Gal) expression vectors at a 5:1 molar ratio to ensure that cells staining for β-Gal were transfected with CHOP. CHOP expression reduced the proportion of cells that contained lipid droplets large enough to be doubly refractile by low-power phase-contrast microscopy (n = 4, P < 0.05). Scale bar, 20 µm.
|
|
Reducing TNF
decreases old rat preadipocyte CHOP and increases lipid accumulation.
Lowering TNF
mRNA by treating preadipocytes from old animals with TNF
siRNA decreased CHOP to <25% of levels in control cultures (Fig. 6A; n = 5, P < 0.005 for decreased TNF
and P < 0.0005 for decreased CHOP, by t-test). Furthermore, introducing fresh culture medium decreased CHOP, as occurs in 3T3-L1 cells (6, 25), consistent with a contribution of gain or loss of autocrine factors (e.g., TNF
), metabolites, or nutrients to increased CHOP in preadipocytes from old rats. Epididymal primary preadipocytes from young animals were kept in medium for 48 h after confluence without medium change (control cultures), or medium was changed in parallel cultures every 2 h three times before protein isolation. Changing medium reduced CHOP abundance to 56.7 ± 9.5% of that in control cultures (n = 4, P < 0.05, by t-test), with a similar decrease in old rat preadipocyte CHOP after the medium changes (59.1 ± 10.3%). Additionally, TNF
siRNA treatment enhanced lipid accumulation in differentiating perirenal preadipocytes from old rats (Fig. 6B). The proportion of cells containing doubly refractile lipid inclusions was 2.15 times larger in TNF
siRNA-treated cells than in cells treated with a control nucleotide (95% confidence interval = 1.26–3.67, n = 4 animals; logistic regression analysis). Thus TNF
increases primary preadipocyte CHOP and reduction of preadipocyte TNF
reduces CHOP in undifferentiated preadipocytes and augments subsequent lipid accumulation.
Increase in CHOP late during differentiation does not change substantially with aging.
In 3T3-L1 cells, CHOP increases after the differentiation-dependent increase in C/EBP
(6). This late differentiation-dependent increase changed little with aging (Fig. 7A). CHOP levels 48 h after initiation of differentiation in preadipocytes cultured in parallel from 3- and 27-mo-old rats were similar (Fig. 7B; n = 7, P = 0.37, by t-test). The differentiation-dependent increase in CHOP was reflected in fat tissue, with CHOP mRNA abundance being similar in freshly isolated whole fat tissue from the inguinal depots of young and old rats (Fig. 7C; n = 4, P = 0.9, by t-test). Thus CHOP is increased in undifferentiated preadipocytes with aging, predisposing to impaired adipogenesis, but is not increased in differentiated fat cells.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7. Profile of CHOP expression during differentiation is not substantially affected by aging. A: CHOP levels were assayed in perirenal preadipocytes from 3- and 24-mo-old rats at confluence (C) or 8–72 h after addition of differentiation-inducing medium. Although CHOP expression was more readily detectable before and early during differentiation in preadipocytes from old than young rats, timing of the subsequent differentiation-dependent increase was similar. Results are representative of 5 experiments. B: by 48 h after initiation of differentiation, CHOP abundance is similar in preadipocytes from old (27M) and young (3M) animals (P = 0.37 for effect of aging, n = 7). CHOP abundance was directly compared in samples from young and old animals run on the same gels. Top: representative Western immunoblot. Bottom: densitometric analyses of CHOP abundance. Values are means ± SE. C: CHOP is similar in inguinal fat tissue from 3-mo-old (3M) and 24-mo-old (24M) rats (P = 0.9 for effect of aging, n = 4). Top: representative gel. Bottom: densitometric analyses of CHOP mRNA as a function of the 18S rRNA (18S) PCR internal control. Values are means ± SE.
|
|
Primary preadipocyte CHOP increases in response to hypoglycemia.
Primary preadipocyte CHOP was sensitive to low glucose (Fig. 8), as are 3T3-L1 cells (6). In 3-mo-old undifferentiated epididymal preadipocytes, CHOP was more abundant after 24 h of exposure to 0.5 than 6 mM glucose (23 ± 2 vs. 6 ± 3 arbitrary units, n = 3, P < 0.05, by t-test). In preadipocytes from 24-mo-old animals, low glucose was not as effective at inducing CHOP (20 ± 2 and 12 ± 3 arbitrary units after exposure to 0.5 and 6 mM glucose, respectively, n = 3, P = 0.14, by t-test). The blunted response to hypoglycemia with aging may be related to higher baseline CHOP expression (in the 6 mM glucose-treated cells) in the preadipocytes from the 24- than 3-mo-old rats (12 ± 3 vs. 6 ± 3 arbitrary units, n = 3, P < 0.05, by t-test).

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 8. Representative Western immunoblot showing that induction of CHOP by hypoglycemia in preadipocytes is blunted with aging. Confluent undifferentiated epididymal preadipocytes from 3- and 24-mo-old rats were exposed to basal medium containing 0.5–6 mM glucose for 24 h. Hypoglycemia induced CHOP in preadipocytes from young animals (P < 0.05, n = 3) but was less effective in cells from old rats (P = 0.14). Basal CHOP was higher in preadipocytes from old than young animals in 6 mM (physiological) glucose (P < 0.05).
|
|
 |
DISCUSSION
|
|---|
Aging is associated with increased fat tissue TNF
, impaired preadipocyte differentiation into fat cells, decreased adipogenic transcription factor expression in fat tissue and cultured preadipocytes, and ectopic lipid deposition with systemic lipotoxicity and increased predilection for metabolic disease (7, 21, 24, 33, 38, 50). TNF
inhibits adipogenesis through multiple mechanisms, including generation of antiadipogenic regulators, such as CHOP (as shown here) and C/EBPβ-LIP (31). Other inflammatory mediators, including IL-6 and nitric oxide (through inducible nitric oxide synthase), as well as chemokines that attract macrophages and other inflammatory cells, are produced by preadipocytes (12). These inflammatory mediators and chemokines could also impair adipogenesis and increase with aging.
Most fat tissue TNF
is likely produced by macrophages. Fat tissue macrophage abundance increases in subcutaneous, but probably not visceral, fat depots with aging (28). Our data suggest that preadipocytes, a cell type with expression profiles closer macrophages than to fat cells (9), also produce TNF
. TNF
release per preadipocyte increases over threefold with aging. Preadipocyte numbers per fat depot also increase with aging (37), magnifying their potential contribution to fat tissue TNF
production. Under culture conditions in which macrophages were absent, preadipocytes from old animals produced sufficient TNF
to inhibit their own adipogenesis, as evident from the TNF
siRNA experiments. Thus preadipocytes could make a more substantial contribution to generation by fat tissue, which acts in an autologous fashion, than has previously been appreciated, especially in old age. Furthermore, preadipocyte TNF
release is depot dependent, consistent with the contention that age-related changes in fat tissue function occur at different rates in different fat depots (7). In combination with age-related changes in diet, activity, hormonal milieu, fat tissue macrophages, and other processes extrinsic to preadipocytes or fat cells, inherent processes, some of which act through increased inflammatory mediator generation, appear to contribute to fat tissue dysfunction with aging.
TNF
at concentrations close to those in conditioned medium from old rat preadipocyte cultures increased CHOP expression. This is different from effects of TNF
on CHOP in brown fat preadipocytes, in which CHOP expression is very low and not increased detectably by TNF
(53). The extent of the CHOP increase in white fat preadipocytes in response to these concentrations of TNF
was similar to the increase in basal CHOP expression in old compared with young rat preadipocytes. CHOP blocks adipogenesis in primary rat preadipocytes, as found in the murine 3T3-L1 cell line (2). CHOP expression is increased in undifferentiated preadipocytes from old animals, in which the capacity to differentiate is impaired. Lipid accumulation was partially restored by reducing CHOP through introduction of TNF
siRNA into preadipocytes from old animals before induction of adipogenesis. Decreasing preadipocyte TNF
likely blunts other potentially antiadipogenic processes as well. These findings support the hypothesis that increased CHOP expression, partly in response to increased autologous TNF
, contributes to the predisposition of undifferentiated preadipocytes from old animals to resist adipogenesis.
CHOP inhibits differentiation by forming heterodimers with adipogenic C/EBP family members, particularly C/EBPβ (1, 56). The truncated, alternatively translated C/EBPβ-LIP isoform also forms heterodimers with adipogenic C/EBP family members, blocking differentiation (31, 65). Activity of CUG-binding protein, which promotes C/EBPβ-LIP translation, increases in undifferentiated preadipocytes with aging, contributing to increased C/EBPβ-LIP during adipogenesis in preadipocytes from old animals (30, 31). Similar to CHOP, CUGBP is stress responsive and increases after treatment with TNF
. Thus CHOP and C/EBPβ-LIP are increased with aging, inhibiting adipogenic C/EBP family members. Furthermore, aging is associated with decreased C/EBP
induction during early adipogenesis (30). C/EBPβ/
heterodimers are especially effective in inducing PPAR
(70). Hence, redundant pathways likely predispose preadipocytes to resist adipogenesis with aging. This redundancy may account for the partial, rather than full, restoration of function by individual interventions, such as blocking TNF
production.
After an initial decline, CHOP expression increases as primary preadipocyte differentiation proceeds, as occurs in preadipocyte cell lines (6, 61). This is not substantially affected by aging, nor is subsequent expression of CHOP in fat tissue. The late differentiation-dependent increase in CHOP expression may be involved in regulating progression of adipogenesis but is not required for adipogenesis to proceed in 3T3-L1 cells (6, 56). Perhaps effects of absence of CHOP on fat tissue function only become apparent under certain conditions, for example, after activation of stress responses, during tissue remodeling, or with hypoglycemia. One could argue that using interventions to reduce CHOP in preadipocytes from old rats would further test the prediction that lowering CHOP would restore adipogenesis. However, the lack of an effect of decreasing the late differentiation-dependent increase in CHOP on adipogenesis, the impact of C/EBPβ-LIP and other redundant antiadipogenic pathways, and the biphasic nature of CHOP expression during normal adipogenesis would make such an experiment difficult to interpret.
We found that primary rat preadipocyte CHOP expression is stress responsive (TNF
, hypoglycemia, and infrequent medium changes), as in 3T3- L1 cells (6, 17, 66). In preadipocytes cultured from old animals, basal expression of CHOP is increased. Increased basal CHOP has also been reported in primary hepatocytes cultured from old compared with young rats (26, 27, 48), suggesting that this may be a general phenomenon. Elevated CHOP predisposes to apoptosis in response to further stress in primary hepatocytes from old animals (48) and in other cell types (5, 16, 19, 40, 74). Consistent with this increased predilection to apoptosis, we found increased susceptibility to fatty acid-induced apoptosis in preadipocytes from old rats (21).
Although basal CHOP expression is increased in preadipocytes with aging, further adaptive increases in response to glucose deprivation are blunted, despite lack of change in capacity of preadipocytes to utilize exogenous glucose with aging (21). An analogous increase in basal expression of various stress-response proteins, with blunting of further adaptive stress-induced increases, has been observed with aging in other cell types (18). Basal NF-
B DNA-binding activity increases with aging in spleen and liver cells (54, 60), whereas acute activation of its expression by extracellular signals in T cells is blunted (52). Similarly, basal expression of certain heat shock proteins increases with aging (46, 47), but heat shock protein induction in response to acute stress is attenuated (55). Thus there may be a general increase in basal activity of stress-responsive pathways with aging but a diminished ability to respond vigorously to acute insults. Increased basal CHOP expression, with reduced preadipocyte capacity for adipogenesis, could impede fat tissue expansion in response to nutrients, regeneration of fat tissue, and adaptive responses to starvation or hypoglycemia. Our findings support the contention that basal stress-response pathway activation, combined with reduced capacity of these pathways to respond to additional stress, may contribute to reduced plasticity and resilience of tissues with aging.
 |
GRANTS
|
|---|
This work was supported by National Institutes of Health Grants AG-13925 and DK-56891 and a Glenn/American Federation for Aging Research Scholarship to B. Wise.
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful for the helpful advice of D. Ron and J. Armstrong and the technical assistance of Andrew Cartwright and Gabriel Chan.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: J. L. Kirkland, Boston Univ. Medical Center, 88 E. Newton St., Robinson 2, Boston, MA 02118
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* T. Tchkonia and T. Pirtskhalava contributed equally to this work. 
 |
REFERENCES
|
|---|
- Adelmant G, Gilbert JD, Freytag SO. Human translocation liposarcoma-CCAAT/enhancer binding protein (C/EBP) homologous protein (TLS-CHOP) oncoprotein prevents adipocyte differentiation by directly interfering with C/EBPβ function. J Biol Chem 273: 15574–15581, 1998.[Abstract/Free Full Text]
- Batchvarova N, Wang XZ, Ron D. Inhibition of adipogenesis by the stress-induced protein CHOP (Gadd153). EMBO J 14: 4654–4661, 1995.[Web of Science][Medline]
- Bertrand HA, Lynd FT, Masoro EJ, Yu BP. Changes in adipose mass and cellularity through the adult life of rats fed ad libitum or a life-prolonging restricted diet. J Gerontol 35: 827–835, 1980.
- Bertrand HA, Masoro EJ, Yu BP. Increasing adipocyte number as the basis for perirenal depot growth in adult rats. Science 201: 1234–1235, 1978.[Abstract/Free Full Text]
- Brenner B, Koppenhoefer U, Weinstock C, Linderkamp O, Lang F, Gulbins E. Fas- or ceramide-induced apoptosis is mediated by a Rac-1-regulated activation of Jun N-terminal kinase/p38 kinases and GADD153. J Biol Chem 272: 22173–22181, 1997.[Abstract/Free Full Text]
- Carlson SG, Fawcett TW, Brartlett JD, Bernier M, Holbrook NJ. Regulation of the C/EBP-related gene gadd153 by glucose deprivation. Mol Cell Biol 13: 4736–4744, 1993.[Abstract/Free Full Text]
- Cartwright MJ, Tchkonia T, Kirkland JL. Aging in adipocytes: potential impact of inherent, depot-specific mechanisms. Exp Gerontol 42: 463–471, 2007.[CrossRef][Web of Science][Medline]
- Chae GN, Kwak SJ. NF-
B is involved in the TNF-
-induced inhibition of the differentiation of 3T3-L1 cells by reducing PPAR
expression. Exp Mol Med 35: 431–437, 2003.[Web of Science][Medline] - Charriere G, Cousin B, Arnaud E, Andre M, Bacou F, Penicaud L, Casteilla L. Preadipocyte conversion to macrophage. J Biol Chem 278: 9850–9855, 2003.[Abstract/Free Full Text]
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.[Web of Science][Medline]
- Christy RJ, Kaestner KH, Geiman DE, Lane MD. CCAAT/enhancer binding protein gene promoter: binding of nuclear factors during differentiation of 3T3-L1 preadipocytes. Proc Natl Acad Sci USA 88: 2593–2597, 1991.[Abstract/Free Full Text]
- Chung S, Lapoint K, Martinez K, Kennedy A, Boysen Sandberg M, McIntosh MK. Preadipocytes mediate lipopolysaccharide-induced inflammation and insulin resistance in primary cultures of newly differentiated human adipocytes. Endocrinology 147: 5340–5351, 2006.[Abstract/Free Full Text]
- Darlington GJ, Ross SE, MacDougald OA. The role of C/EBP genes in adipocyte differentiation. J Biol Chem 273: 30057–30060, 1998.[Free Full Text]
- Djian P, Roncari DAK, Hollenberg CH. Influence of anatomic site and age on the replication and differentiation of rat adipocyte precursors in culture. J Clin Invest 72: 1200–1208, 1983.[Web of Science][Medline]
- Entenmann G, Hauner H. Relationship between replication and differentiation in cultured human adipocyte precursor cells. Am J Physiol Cell Physiol 270: C1011–C1016, 1996.[Abstract/Free Full Text]
- Eymin B, Dubrez L, Allouche M, Solary E. Increased gadd153 messenger RNA level is associated with apoptosis in human leukemic cells treated with etoposide. Cancer Res 57: 686–695, 1997.[Abstract/Free Full Text]
- Fawcett T, Eastman H, Martindale J, Holbrook N. Physical and functional association between GADD153 and CCAAT/enhancer-binding protein β during cellular stress. J Biol Chem 271: 14285–14289, 1996.[Abstract/Free Full Text]
- Finkel T, Holbrook N. Oxidants, oxidative stress and the biology of ageing. Nature 408: 239–247, 2000.[CrossRef][Medline]
- Friedman A. GADD153/CHOP, a DNA damage-inducible protein, reduced CAAT/enhancer binding protein activities and increased apoptosis in 32D c13 myeloid cells. Cancer Res 56: 3250–3256, 1996.[Abstract/Free Full Text]
- Garcia E, Lacasa M, Agli B, Giudicelli Y, Lacasa D. Modulation of rat preadipocyte adipose conversion by androgenic status: involvement of C/EBPs transcription factors. J Endocrinol 161: 89–97, 1999.[Abstract]
- Guo W, Pirtskhalava T, Tchkonia T, Xie W, Thomou T, Han J, Wang T, Wong S, Cartwright A, Hegardt FG, Corkey BE, Kirkland JL. Aging results in paradoxical susceptibility of fat cell progenitors to lipotoxicity. Am J Physiol Endocrinol Metab 292: E1041–E1051, 2007.[Abstract/Free Full Text]
- Harmon AW, Patel YM, Harp JB. Genistein inhibits CCAAT/enhancer-binding protein β (C/EBPβ) activity and 3T3-L1 adipogenesis by increasing C/EBP homologous protein expression. Biochem J 367: 203–208, 2002.[CrossRef][Web of Science][Medline]
- Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilizing the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 88: 7276–7280, 1991.[Abstract/Free Full Text]
- Hotta K, Bodkin NL, Gustafson TA, Yoshioka S, Ortmeyer HK, Hansen BC. Age-related adipose tissue mRNA expression of ADD1/SREBP1, PPAR
, lipoprotein lipase, and GLUT4 glucose transporter in rhesus monkeys. J Gerontol A Biol Sci Med Sci 54: B183–B188, 1999.[Abstract] - Huang H, Lane MD, Tang QQ. Effect of serum on the down-regulation of CHOP-10 during differentiation of 3T3-L1 preadipocytes. Biochem Biophys Res Commun 338: 1185–1188, 2005.[CrossRef][Web of Science][Medline]
- Ikeyama S, Kokkonen G, Martindale JL, Wang XT, Gorospe M, Holbrook NJ. Effects of aging and calorie restriction of Fischer 344 rats on hepatocellular response to proliferative signals. Exp Gerontol 38: 431–439, 2003.[CrossRef][Web of Science][Medline]
- Ikeyama S, Wang XT, Li J, Podlutsky A, Martindale JL, Kokkonen G, van Huizen R, Gorospe M, Holbrook NJ. Expression of the pro-apoptotic gene gadd153/chop is elevated in liver with aging and sensitizes cells to oxidant injury. J Biol Chem 278: 16726–16731, 2003.[Abstract/Free Full Text]
- Jerschow E, Anwar S, Barzilai N, Rosenstreich D. Macrophages accumulation in visceral and subcutaneous adipose tissue correlates with age (Abstract). J Allergy Clin Immunol 119 Suppl 1: S179, 2007.
- Kachigan SK. Statistical Analysis. New York: Radius, 1986.
- Karagiannides I, Tchkonia T, Dobson DE, Steppan CM, Cummins P, Chan G, Salvatori K, Hadzopoulou-Cladaras M, Kirkland JL. Altered expression of C/EBP family members results in decreased adipogenesis with aging. Am J Physiol Regul Integr Comp Physiol 280: R1772–R1780, 2001.[Abstract/Free Full Text]
- Karagiannides I, Thomou T, Tchkonia T, Pirtskhalava T, Kypreos KE, Cartwright A, Dalagiorgou G, Lash TL, Farmer SR, Timchenko NA, Kirkland JL. Increased CUG triplet repeat binding protein-1 predisposes to impaired adipogenesis with aging. J Biol Chem 281: 23025–23033, 2006.[Abstract/Free Full Text]
- Keppel G. Design and Analysis: A Researcher's Handbook. Englewood Cliffs, NJ: Prentice-Hall, 1973.
- Kirkland JL, Corkey BE, Tchkonia T. Current views of the fat cell as an endocrine cell: lipotoxicity. Endocr Updates 26: 105–118, 2006.
- Kirkland JL, Dobson DE. Preadipocyte function and aging: links between age-related changes in cell dynamics and altered fat cell function. J Am Geriatr Soc 45: 959–967, 1997.[Web of Science][Medline]
- Kirkland JL, Hollenberg CH, Gillon WS. Age, anatomic site, and the replication and differentiation of adipocyte precursors. Am J Physiol Cell Physiol 258: C206–C210, 1990.[Abstract/Free Full Text]
- Kirkland JL, Hollenberg CH, Gillon WS. Effects of fat depot site on differentiation-dependent gene expression in rat preadipocytes. Int J Obes 20: S102–S107, 1996.[Web of Science]
- Kirkland JL, Hollenberg CH, Kindler S, Gillon WS. Effects of age and anatomic site on preadipocyte number in rat fat depots. J Gerontol B Psychol Sci Soc Sci 49: B31–B35, 1994.
- Kirkland JL, Tchkonia T, Pirtskhalava T, Han J, Karagiannides I. Adipogenesis and aging: Does aging make fat go MAD? Exp Gerontol 37: 757–767, 2002.[CrossRef][Web of Science][Medline]
- Kleinbaum D, Kupper L, Muller K. Applied Regression Analysis and Other Multivariate Methods. Belmont, CA: Duxbury, 1998.
- Kogel D, Schomburg R, Schurmann T, Reimertz C, Konig HG, Poppe M, Eckert A, Muller WE, Prehn JH. The amyloid precursor protein protects PC12 cells against endoplasmic reticulum stress-induced apoptosis. J Neurochem 87: 248–256, 2003.[CrossRef][Web of Science][Medline]
- Kozak VC, Kozak LP. Norepinephrine-dependent selection of brown adipocyte cell lines. Endocrinology 134: 906–913, 1994.[Abstract/Free Full Text]
- Kypreos K, Teusink B, Van Dijk K, Havekes L, Zannis V. Analysis of the structure and function relationship of the human apolipoprotein E in vivo, using adenovirus-mediated gene transfer. FASEB J 15: 1598–1600, 2001.[Free Full Text]
- Labarca C, Paigen K. A simple, rapid, and sensitive DNA assay procedure. Anal Biochem 102: 344–352, 1980.[CrossRef][Web of Science][Medline]
- Laemmli UK. Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227: 680–685, 1970.[CrossRef][Medline]
- Lane MD, Tang QQ, Jiang MS. Role of the CCAAT enhancer binding proteins (C/EBPs) in adipocyte differentiation. Biochem Biophys Res Commun 266: 677–683, 1999.[CrossRef][Web of Science][Medline]
- Lee C, Klopp R, Weindruch R, Prolla T. Gene expression profile of aging and its retardation by caloric restriction. Science 285: 1390–1393, 1999.[Abstract/Free Full Text]
- Lee C, Weidruch R, Prolla T. Gene-expression profile of the ageing brain in mice. Nat Genet 25: 294–297, 2000.[CrossRef][Web of Science][Medline]
- Li J, Holbrook NJ. Elevated gadd153/chop expression and enhanced c-Jun N-terminal protein kinase activation sensitizes aged cells to ER stress. Exp Gerontol 39: 735–744, 2004.[CrossRef][Web of Science][Medline]
- Majumdar S. Protein kinase C isotypes and signaling in neutrophils. J Biol Chem 266: 9285–9294, 1991.[Abstract/Free Full Text]
- Morin CL, Gayles EC, Podolin DA, Wei Y, Xu M, Pagliassotti MJ. Adipose tissue-derived tumor necrosis factor activity correlates with fat cell size but not insulin action in aging rats. Endocrinology 139: 4998–5005, 1998.[Abstract/Free Full Text]
- Morin CL, Pagliassotti MJ, Windmiller D, Eckel RH. Adipose tissue-derived tumor necrosis factor-
activity is elevated in older rats. J Gerontol A Biol Sci Med Sci 52: B190–B195, 1997.[Abstract] - Ponnappan U. Regulation of transcription factor NF
B in immune senescence. Front Biosci 1: D152–D168, 1998. - Porras A, Zuluaga S, Black E, Valladares A, Alvarez AM, Ambrosino C, Benito M, Nebreda AR. p38
Mitogen-activated protein kinase sensitizes cells to apoptosis induced by different stimuli. Mol Cell Biol 15: 922–933, 2004. - Poynter M, Daynes R. Peroxisome proliferator-activated receptor
activation modulates cellular redox status, represses nuclear factor-
B signaling, and reduces inflammatory cytokine production in aging. J Biol Chem 273: 32833–32841, 1998.[Abstract/Free Full Text] - Richardson A, Holbrook N. In:Cellular Aging and Cell Death, edited by Holbrook N, Martin G, Lockshin R. New York: Wiley, 1996.
- Ron D, Habener JK. CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factor C/EBP and LAP and functions as a dominant-negative inhibitor of gene expression. Genes Dev 6: 439–453, 1992.[Abstract/Free Full Text]
- Rosen ED. The transcriptional basis of adipocyte development. Prostaglandin Leukot Essent Fatty Acids 73: 31–34, 2005.[CrossRef][Web of Science][Medline]
- Sanes JR, Rubenstein JLR, Nicolas JF. Use of a recombinant retrovirus to study post-implantation cell lineage in mouse embryos. EMBO J 5: 3133–3142, 1986.[Web of Science][Medline]
- Strawford A, Antelo F, Christiansen M, Hellerstein MK. Adipose tissue triglyceride turnover, de novo lipogenesis, and cell proliferation in humans measured with 2H2O. Am J Physiol Endocrinol Metab 286: E577–E588, 2004.[Abstract/Free Full Text]
- Supakar P, Jung M, Song C, Chatterjee B, Roy A. Nuclear factor
B functions as a negative regulator for the rat androgen receptor gene and NF-
B activity increases during the age-dependent desensitization of the liver. J Biol Chem 270: 837–842, 1995.[Abstract/Free Full Text] - Tang QQ, Lane MD. Role of C/EBP homologous protein (CHOP-10) in the programmed activation of CCAAT/enhancer binding protein-β during adipogenesis. Proc Natl Acad Sci USA 97: 12446–12450, 2000.[Abstract/Free Full Text]
- Tchkonia T, Giorgadze N, Pirtskhalava T, Tchoukalova Y, Karagiannides I, Forse RA, DePonte M, Stevenson M, Guo W, Han J, Waloga G, Lash TL, Jensen MD, Kirkland JL. Fat depot origin affects adipogenesis in primary cultured and cloned human preadipocytes. Am J Physiol Regul Integr Comp Physiol 282: R1286–R1296, 2002.[Abstract/Free Full Text]
- Tchkonia T, Giorgadze N, Pirtskhalava T, Thomou T, DePonte M, Koo A, Forse RA, Chinnappan D, Carmen Martin-Ruiz C, von Zglinicki T, Kirkland JL. Fat depot-specific characteristics are retained in strains derived from single human preadipocytes. Diabetes 55: 2571–2578, 2006.[Abstract/Free Full Text]
- Tchkonia T, Karagiannides I, Hadzopoulou-Cladaras M, Dobson DE, Farmer SR, Sierra A, Kirkland JL. Decreased PPAR
expression results in impaired adipogenesis with aging (Abstract). Obes Res 9 Suppl 3: 145S, 2001. - Timchenko NA, Welm AL, Lu X, Timchenko LT. CUG repeat binding protein (CUGBP1) interacts with the 5' region of C/EBPβ mRNA and regulates translation of C/EBPβ isoforms. Nucleic Acids Res 27: 4517–4525, 1999.[Abstract/Free Full Text]
- Ubeda M, Wang XZ, Zinszner H, Wu I, Habener JF, Ron D. Stress-induced binding of the transcriptional factor CHOP to a novel DNA control element. Mol Cell Biol 16: 1479–1489, 1996.[Abstract]
- Wang H, Kirkland JL, Hollenberg CH. Varying capacities for replication of rat adipocyte precursor clones and adipose tissue growth. J Clin Invest 83: 1741–1746, 1989.[Web of Science][Medline]
- Wiederer O, Löffler G. Hormonal regulation of the differentiation of rat adipocyte precursor cells in primary culture. J Lipid Res 28: 649–658, 1987.[Abstract]
- Wigler M, Pellicer A, Silverstein S, Axel R. Biochemical transfer of single-copy eucaryotic genes using total cellular DNA as donor. Cell 14: 725–731, 1978.[CrossRef][Web of Science][Medline]
- Wu Z, Bucher NLR, Farmer SR. Induction of peroxisome proliferator-activated receptor
during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBPβ, C/EBP
and glucocorticoids. Mol Cell Biol 16: 4128–4136, 1996.[Abstract] - Xing H, Northrop JP, Grove JR, Kilpatrick KE, Su JL, Ringold GM. TNF
-mediated inhibition and reversal of adipocyte differentiation is accompanied by suppressed expression of PPAR
without effects on Pref-1 expression. Endocrinology 138: 2776–2783, 1997.[Abstract/Free Full Text] - Yeh WC, Cao M, Classon M, McKnight SL. Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev 9: 168–181, 1995.[Abstract/Free Full Text]
- Zapata JM, Takahashi R, Salvesen GS, Reed JC. Granzyme release and caspase activation in activated human T-lymphocytes. J Biol Chem 273: 6916–6920, 1998.[Abstract/Free Full Text]
- Zinszner H, Kuroda M, Wang XZ, Batchvarova N, Lightfoot RT, Remotti H, Stevens JL, Ron D. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev 12: 982–995, 1998.[Abstract/Free Full Text]
Copyright © 2007 by the American Physiological Society.