AJP - Endo Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 293: E1756-E1763, 2007. First published September 11, 2007; doi:10.1152/ajpendo.00321.2007
0193-1849/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/6/E1756    most recent
00321.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antos, L. K.
Right arrow Articles by Potter, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antos, L. K.
Right arrow Articles by Potter, L. R.

Adenine nucleotides decrease the apparent Km of endogenous natriuretic peptide receptors for GTP

Laura K. Antos1 and Lincoln R. Potter2

1Department of Biochemistry, Molecular Biology and Biophysics, and 2Department of Pharmacology, University of Minnesota, Minneapolis, Minnesota

Submitted 23 May 2007 ; accepted in final form 5 September 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Natriuretic peptide receptors A (NPR-A) and B (NPR-B) mediate most effects of natriuretic peptides by synthesizing cGMP. ATP increases the activity of these receptors by an unknown mechanism. We recently reported that a nonhydrolyzable form of ATP, adenylyl imidodiphosphate (AMPPNP), stabilizes but is not required for the activation of NPR-A and NPR-B in membranes from highly overexpressing cells. Here, we repeated these studies on receptors expressed in endogenous settings. Kinetic analysis indicated that both AMPPNP and ATP dramatically decrease the apparent Km of both receptors for GTP but had little effect on the Vmax. The EC50 for AMPPNP decreased as substrate concentration increased whereas the magnitude of the effect was greater at lower GTP concentrations. ATP increased the activity of a mutant receptor containing glutamates substituted for all known phosphorylation sites similarly to the wild-type receptor, consistent with a phosphorylation independent mechanism. Finally, the putative ATP binding sites were investigated. Mutation of the ATP modulatory domain region had no effect, but mutation of K535A dramatically diminished ANP-dependent cyclase activity in a manner that was unresponsive to ATP. Mutation of the highly conserved 630-KSS to AAA (all alanines) resulted in an expressed receptor that had no detectable guanylyl cyclase activity. We conclude that ATP is not required for the initial activation of NPRs but does increase activity over time by reducing the apparent Km for GTP.

guanylyl cyclase; cyclic guanosine monophosphate; guanosine triphosphate; adenosine triphosphate; Michaelis-Menten constant; heart failure; hypertension; bone growth


THERE ARE THREE KNOWN MAMMALIAN natriuretic peptides: atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), and C-type natriuretic peptide (CNP) (31). ANP and BNP bind the transmembrane guanylyl cyclase known as natriuretic peptide receptor A (NPR-A) or guanylyl cyclase A, whereas CNP binds a related but distinct enzyme known as natriuretic peptide receptor B (NPR-B) or guanylyl cyclase B (31). ANP and BNP decrease blood pressure and inhibit cardiac hypertrophy and fibrosis. Blood pressure is reduced through the stimulation of natriuresis, diuresis, vasorelaxation, and increased endothelial permeability. CNP stimulates long bone growth, in part by activating cGMP-dependent protein kinase II (28), but the in vivo targets of this protein kinase are not known (31). In addition, CNP is a venodilator (47) and inhibits cardiac hypertrophy in rats (26).

Both NPR-A and NPR-B are members of a family of five human particulate guanylyl cyclases (29). Additional members include the retinal guanylyl cyclases GC-E and GC-F, also named, RetGC-1 and RetGC-2, as well as GC-C, or StaR, the receptor for the bacterial heat-stable enterotoxin, and the intestinal peptides guanylin and uroguanylin. Each receptor consists of an extracellular ligand-binding domain, single membrane-spanning domain, and an intracellular region made up of a kinase homology domain-regulatory, hinge-dimerization, and guanylyl cyclase-catalytic domains. Phosphorylation of the kinase homology domains of NPR-A and NPR-B is required for natriuretic peptide-dependent activation (30), and receptor dephosphorylation is associated with desensitization (21, 22, 30, 32, 33). Although all particulate guanylyl cyclases contain a domain with limited homology to protein kinases, only GC-E has been reported to possess intrinsic phosphotransferase activity (4).

NPR-A is activated by one molecule of natriuretic peptide binding to two molecules of receptor (27). The receptor is dimerized in a head-to-head or A-shaped configuration (11, 39). Hormone binding causes a conformational change that brings the extracellular juxtamembrane domains closer together (25). The ligand-dependent conformational changes that take place inside the cell are unknown, but it has been suggested that hormone binding relieves the normal repression exerted by the kinase homology domain because deletion of this domain results in a constitutively active form of the receptor (9).

ANP was first shown in 1984 to increase particulate but not soluble guanylyl cyclase activity two- to fourfold in an ATP-independent manner (46, 48). Subsequently, addition of exogenous ATP to the reaction was reported to further increase ANP-dependent guanylyl cyclase activity (8, 24, 41). Similar stimulatory effects of ATP were reported for the intestinal and retinal guanylyl cyclases as well (17, 42, 44). In the early 1990s, it was reported that adenine nucleotides are absolutely required for natriuretic peptide-dependent activation of NPR-A and NPR-B (10, 12). These data then led to a two-step activation model, which was left unchallenged until 2005, when we reported that ATP is not essential for activation of natriuretic peptide receptors in human embryonic kidney 293 cells highly overexpressing NPR-A or NPR-B (3, 35). Because ATP increased the guanylyl cyclase activity of these receptors only at longer but not shorter times, we concluded that ATP stabilizes these receptors but is not required for their activation. This observation is consistent with reports on GC-C, which indicate that ATP increases its activity only at later but not earlier periods of time (44, 45).

Two separate groups have recently challenged our findings because they were carried out in highly overexpressing synthetic cells (7, 20). Therefore, we investigated whether the same results would be obtained in membranes from cells that express these receptors endogenously. Here, we find that endogenously expressed NPR-A and NPR-B are strongly activated by natriuretic peptides in the absence of adenine nucleotides but that ATP increased activities at longer time periods. To further understand the role of ATP in the regulation of these receptors, we performed kinetic experiments in the presence or absence of ATP and the nonhydrolyzable ATP analog adenylyl imidodiphosphate (AMPPNP). We find that both ATP and AMPPNP decrease the apparent Michaelis-Menton constant (Km) of the enzyme, whereas ATP has no statistically significant effect on the maximal velocity (Vmax) of the enzyme. Finally, we investigated the role of two putative ATP binding sites in the kinase homology domain of NPR-A by using a site-directed mutagenesis approach. We find that mutation of the putative ATP regulatory domain (ARM) had no effect but that mutation of Lys535 to alanine disrupts ligand activation and yields an enzyme that is unaffected by the presence of ATP.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture and membrane preparation. Bovine aortic endothelial cells (BAEC) were acquired from the Lonza Group (www.lonzabioscience.com) and cultured in 1:1 F-12-DMEM containing 10% FBS and 1% penicillin-streptomycin. NIH3T3 fibroblast cells were cultured in DMEM containing 1% penicillin-streptomycin and 10% calf serum as previously described (38), and HEK 293 neo cells were grown in 10% FBS with 1% penicillin-streptomycin. HEK 293T cells stably expressing NPR-A were grown and maintained as previously described (1, 14). Crude membranes were prepared by washing cells at 4°C with phosphate-buffered saline and scraping off the plate in the presence of phosphatase inhibitor buffer (PIB; 25 mM HEPES, pH 7.4, 20% glycerol, 50 mM NaCl, 50 mM NaF, 2 mM EDTA, 0.25 µM microcystin, and 2.5x Roche protease inhibitor tablet). Suspended cells were sonicated for 1–2 s and centrifuged at 20,000 g for 10 min at 4°C. The supernatant was aspirated and the pellet resuspended in PIB. Guanylyl cyclase assays contained 0.05–0.3 mg of total membrane protein. For experiments shown in GoFig. 2, membranes were repeatedly resuspended in 1 ml of PIB and pelleted by centrifugation.


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 1. ATP-independent activation of natriuretic peptide receptors A and B (NPR-A and NPR-B). Membranes from bovine aortic endothelial cells (BAEC; top) or NIH3T3 cells (bottom) were prepared and assayed in the presence or absence of 1 mM concentrations of adenine nucleotide [ATP or adenylimidodiphosphate (AMPPNP)] and/or 1 µM concentrations of atrial natriuretic peptide (ANP; top) or C-type natriuretic peptide (CNP; bottom). Mn2+ and Triton X-100 was used as a synthetic activator of guanylyl cyclase activity. Data are shown as means ± SE and are representative of 3 separate experiments; n = 9 (top) and 12 (bottom). *P ≤ 0.0002 vs. water treatment. Statistics were performed between ligand alone and ligand ± adenine nucleotide, and differences were not significant.

 

Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
Fig. 2. Sequential washing of membranes does not sensitize NPRs to adenine nucleotide. Membranes from BAEC (top) or NIH3T3 cells (middle and bottom) were harvested and washed as indicated. Membranes were assayed in the presence or absence of 1 mM concentrations of adenine nucleotide (ATP or AMPPNP) and/or 1 µM concentrations of ANP (top) or CNP (middle). Mn2+ and Triton X-100 were used as synthetic activators of guanylyl cyclase activity. Bottom: ATP concentration (expressed as pmol ATP/mg protein) found in NIH3T3 cell extracts or membranes after successive washes. Data are shown as means ± SE and are representative of 3 separate experiments; n = 6. *,{dagger},#P < 0.001, 0.01, and < 0.005, respectively, vs. no-wash sample.

 
Guanylyl cyclase assays. Guanylyl cyclase activity for Figs. 1 and 2 were performed using 20 µl of membranes containing 1.5–3.5 mg/ml for the BAEC and 5–15 mg/ml for the NIH3T3 cells of total protein. The membranes were resuspended in PIB and treated with water, Mg2+-ATP, Mg2+-AMPPNP, ligand (ANP or CNP), or Mn2+-Triton, as indicated in the figure. Final reaction concentrations for the adenine nucleotides and ligands were 1 mM and 1 µM, respectively, except where indicated otherwise. The reactions were stimulated by addition of 50 µl of cocktail containing 4 mM magnesium, 1 mM GTP along with 25 mM HEPES, pH 7.4, 0.5 µM microcystin, 1 mM EDTA, and 0.75 mM 3-isobutyl-1-methylxanthine. For Figs. 3 and 4, 40 µl of membranes (1–3.5 mg/ml) was stimulated with 60 µl of the same cocktail as described above with or without 1 mM Mg-AMPPNP. Additionally, the cocktail in Fig. 3 contained 5 mM creatine phosphate and 0.1 µg/µl creatine phosphokinase, and membranes were prewarmed for 15 s before addition of cocktail. In Fig. 5, 25 µl of membranes was treated with 25 µl of the indicated amounts of AMPPNP and stimulated with 50 µl of a cocktail containing either 0.1 or 1 mM Mg-GTP. The reaction described in Fig. 6 contained 25 µl of membranes that contained either 25 µl of water and 4 mM Mg-ATP or Mg-AMPPNP and stimulated with cocktail containing varying amounts of GTP. In these experiments, 5 mM creatine phosphate and 0.1 µg/µl creatine phosphokinase were included in the reaction cocktail. All assays were stopped by adding 0.4 ml of 50 mM sodium acetate containing 5 mM EDTA buffer. Samples were then centrifuged for 10 min at 3,000 rpm, and a 100-µl aliquot was analyzed for cGMP by radioimmunoassay (PerkinElmer). In Fig. 5, top, membranes from HEK 293T cells stably expressing NPR-A cells were used as the enzyme source. Figure 7 was performed as described for Figs. 1 and 2 except that 300 µCi of [{alpha}-32P]GTP was added to cold GTP, and conversion of [{alpha}-32P]GTP to [32P]cGMP was measured as previously described (3).


Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 3. AMPPNP stabilizes the guanylyl cyclase activity of NPR-A and NPR-B. Membranes from BAEC (top) or NIH3T3 cells (bottom) were prepared and stimulated with 1 µM ANP (top) or CNP (bottom) in the presence or absence of 1 mM AMPPNP for indicated periods of time in reaction cocktail containing 0.1 µg/µl creatine phosphokinase and 5 mM creatine phosphate. Data are shown as means ± SE and are representative of 3 separate experiments; n = 6.

 

Figure 4
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 4. A constitutively phosphorylated version of NPR-A is regulated by AMPPNP. Membranes were prepared from 293T cells stably overexpressing a version of NPR-A containing glutamates substituted for all 6 of its known phosphorylation sites (NPR-A-6E) and stimulated with ANP in the presence or absence of ATP for indicated periods of time. Graph is a compilation of 4 experiments; n = 7. Data are means ± SE.

 

Figure 5
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 5. Concentration response of AMPPNP on NPR-A and NPR-B at high and low substrate concentrations. Membranes from BAEC (A and B) or NIH3T3 cells (C and D) were prepared and stimulated with 1 µM concentrations ANP (A and B) or CNP (C and D) with indicated concentrations of AMPPNP. GTP concentrations were either 0.1 (A and C) or 1 mM (B and D), as indicated. Data are presented as means ± SE and are representative of 3 separate experiments; n = 4. A–D were performed in the same assay but were separated for representation.

 

Figure 6
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 6. AMPPNP markedly decreases the apparent Km of NPRs. BAEC (top), NIH3T3 (middle), or 293 neo-transfected NPR-A-6E (bottom) cell membranes were prepared and assayed in the presence 1 µM ANP (top and bottom) or CNP (middle) with or without 1 mM AMPPNP or ATP. Data are shown as means ± SE and are representative of 3 separate experiments (n = 6) for middle and 2 separate experiments for top and bottom (n = 4).

 

Figure 7
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 7. Effect of putative ATP binding domain mutations on activity of NPR-A. HEK 293 neo cells were transfected with indicated NPR-A constructs or GFP control vector. Crude membranes from transfected cells were prepared and assayed for guanylyl cyclase activity for 15 min. WT, wild type; AAA, all alanines. Data are shown as means ± SE and are representative of 3 separate experiments; n = 6. Insets: Western blot analysis of NPR-A and β-actin (loading control) levels are shown.

 
Creation and transfection of NPR-A mutants. Mutants used in Fig. 6 were engineered with a Stratagene Quikchange Site-Directed Mutagenesis Kit using a pCMV3 wild-type NPR-A backbone (36) and 5' to 3' primers gctgaccctgagtgcgcgagcctccaattatggc, gcaaccttgtggctgtggcacgtgtgaaccggaaacg, and ccatttgttcccatgggaacctcgcggcagccaactgtgtggtagacg and their complements to generate GxG503-5AxA and AxG, K535A, and KSS630-3AAA mutants respectfully. Constructs were transfected into ~40% confluent HEK 293 neo cells grown on precoated poly(D) lysine plates using a calcium phosphate-HEPES-buffered saline protocol. Fresh medium was applied to plates 12–24 h later.

Western blots. Membrane proteins (15 µg) were fractionated by SDS-PAGE and electroblotted to a polyvinylidene fluoride membrane and probed with polyclonal antiserum from rabbit 6325 (2). NPR-A was visualized by enhanced chemiluminescence. β-Actin was used as a loading control and blotted with an anti-β-actin antibody purchased from Sigma.

ATP detection. One hundred microliters of membranes prepared as described above was tested for the presence of ATP using an ATPlite 1step luciferase detection kit purchased from PerkinElmer, and the assay was conducted according to the manufacturer's instructions.

Statistical analysis. Data were analyzed via a Student's unpaired t-test using Prism 4.0 GraphPad software. This software was also used to perform nonlinear regression analysis of kinetic data. All data are represented as mean ± SE.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
ATP is not required for activation of endogenous NPR-A and NPR-B. We have previously reported that adenine nucleotides are not required to activate NPR-A and NPR-B in membranes from 293T cells highly overexpressing NPR-A or NPR-B (3). However, whether or not these results reflect physiological activation has been called into question (7, 20). To address this issue, we tested guanylyl cyclase activity in membranes from BAEC or NIH3T3 fibroblast membranes that endogenously express NPR-A or NPR-B, respectively.

Addition of ANP to BAEC membranes increased guanylyl cyclase activities 7.6-fold over those observed under basal conditions when measured for a short 15 s time period (Fig. 1, top). Addition of ATP or AMPPNP to reactions containing ANP increased cyclase activity slightly, but these activities were not significantly different from those observed in reactions containing no adenine nucleotides. Similarly, CNP addition to NIH3T3 cell membranes resulted in a sixfold increase over basal guanylyl cyclase activities when measured for 15 s (Fig. 1, bottom). The inclusion of ATP or AMPPNP with CNP did not result in a significant increase in cGMP production compared with reactions lacking adenine nucleotides. These data indicate that in these physiological systems ligand alone is fully capable of activating NPR-A and NPR-B and that additional supplementation with adenine nucleotide does not increase initial guanylyl cyclase activities at early time periods.

Membrane washing does not decrease ATP-independent activity of NPRs. To rule out the possibility that ATP may still be present in the membranes due to cellular contamination, membranes were repeatedly washed and then tested for responsiveness to ligand stimulation. This procedure is likely to remove ATP, because the EC50 for ATP-dependent activation of NPR-A and NPR-B is ~0.1 mM (8, 18, 24), which is indicative of very weak binding. Hence, if natriuretic peptides are activating these receptors because the membranes contain residual cellular ATP, then with each successive wash the membranes should contain less ATP and the receptor should be less responsive to natriuretic peptide stimulation.

Our data indicate that natriuretic peptides are not activating NPR-A or NPR-B as a result of residual ATP, because even after four washes ANP alone increased guanylyl cyclase activity 3- to 4-fold, and CNP increased activity 7- to 13-fold over basal levels (Fig. 2). The addition of ATP or AMPPNP to membranes from the BAEC slightly increased cyclase activity, but it was not statistically significant after any wash (Fig. 2, top). Similarly, the addition of ATP increased the cyclase activity measured in membranes from the NIH3T3 cells about twofold, but it was only statistically significant when measured after two washes only (Fig. 2, middle). AMPPNP also increased activity about twofold, but the differences were not statistically significantly after any wash. The slight reduction in CNP-dependent activation with washing is most likely due to protein loss, as activities measured in the presence of manganese and Triton X-100 were reduced similarly. These data demonstrate that the ligand activation observed in Fig. 1 is not due to residual ATP contamination from the membrane preparation. Interestingly, we observed slightly higher activity in the presence of adenine nucleotide in the wash data than observed in straight stimulation activity in Fig. 1, bottom. The reason for this is not known, but one explanation is that the additional washes require the membranes to be left on ice for longer periods of time, which decreases the responsiveness of the enzyme and therefore could increase the requirement for adenine nucleotide.

To prove that ATP was being removed through membrane washing, we measured ATP levels in NIH3T3 cell membranes by use of a coupled ATP-luciferase assay. Figure 2 demonstrates that separation of membrane protein from the cytosolic fraction (crude to no-wash samples) dramatically decreases ATP concentrations. Washing the membranes once decreases ATP concentration by almost one-half, whereas samples washed two to four times showed no significant reduction in ATP concentration beyond the amount of ATP detected in the samples that were washed only once. Therefore, membrane washing effectively decreases the amount of ATP in our samples, although the vast majority of ATP is removed in the first and second washes.

Effect of adenine nucleotides on NPR-A and NPR-B as a function of time. To determine whether adenine nucleotides stabilize cyclase activity of endogenously expressed NPR-A and NPR-B as they do receptors overexpressed in 293T cells, ANP- or CNP-dependent guanylyl cyclase activity was measured in the presence or absence of AMPPNP as a function of time. AMPPNP was used instead of ATP to isolate the allosteric effect of the adenine nucleotide from its ability to serve as a substrate for the kinase that phosphorylates these receptors (15). Since GTP is more likely to be degraded in the longer assays, we included a cyclic nucleotide regeneration system (creatine phosphokinase and creatine phosphatase).

Our data indicate that, at short time points (<60 s), there is little difference between AMPPNP-treated and untreated BAEC or NIH3T3 cell membranes. However, at the longer time points, the presence of AMPPNP causes about a twofold increase in activity (Fig. 3, bottom). Hence, ATP is not required for long-term activation of the enzyme, but it does increase the amount of activity observed about twofold. These data closely resemble the previous time course data obtained in 293T-overexpressing cell membranes.

Effect of ATP on a dephosphorylation-resistant NPR-A mutant. To further separate the allosteric effects of ATP from its role as a substrate in the phosphorylation of NPR-A, membranes from a mutant form of NPR-A containing glutamates substituted for all six of its known phosphorylation sites were assayed for guanylyl cyclase activities in the presence and absence of ATP. Unlike a mutant receptor consisting of alanines for the known phosphorylation sites, this receptor is responsive to ANP stimulation and demonstrates a blunted desensitization response (34).

ATP had no effect at the early 5 s or 15 s time points but produced a significant increase at every time point thereafter (Fig. 4). The average fold increase in activity with AMPPNP is 5.6, but higher fold stimulations are observed at the midlevel time points (as high as 15-fold at 30 s), and lower-level stimulations are observed at the longer time points (~2- to 3-fold after 180 s).

Effect of AMPPNP on kinetic parameters of NPRs. To determine how AMPPNP elevates the enzymatic activity of NPR-A and NPR-B, we examined the ability of increasing concentrations of AMPPNP to increase ligand-dependent guanylyl cyclase activity in the presence of high (1 mM GTP) or low (0.1 mM GTP) substrate concentrations. These concentrations were chosen because our group typically uses the higher GTP levels, whereas groups that report different findings typically used lower GTP concentrations. As predicted by Michaelis-Menton kinetics, activities were higher in reactions containing 1 mM GTP vs. 0.1 mM GTP (Fig. 5). The EC50 of AMPPNP for the high and low GTP concentrations was 15 and 115 µM in BAEC membranes (Fig. 5, A and B) and 31 and 112 µM in membranes from NIH3T3 cells (Fig. 5, C and D). Interestingly, AMPPNP increased cyclase activity ~10- and 3-fold or 18- and 2.5-fold at the lower and higher GTP concentrations in BAEC and NIH3T3 membranes, respectively. These data are consistent with AMPPNP increasing the Km of the enzyme, since it has a greater effect at lower substrate concentrations. Finally, we found that concentrations of AMPPNP greater than 1.5 mM inhibited cGMP formation, which most likely results from competition at the substrate binding site.

To determine the effect of AMPPNP and ATP on the apparent Km and Vmax of NPR-A and NPR-B, natriuretic peptide-dependent guanylyl cyclase activities were measured in the presence of increasing amounts of GTP with or without 1 mM ATP or AMPPNP. We qualify the Km and Vmax obtained under these 15-min conditions as apparent, because in the absence of an adenine nucleotide, cGMP formation was not completely linear at that time period (Fig. 3). Fifteen minutes was chosen because the greatest differences between activities with or without adenine nucleotide were observed under these conditions. In membranes from both cell lines, ATP and AMPPNP dramatically decreased the apparent Km. This decrease was from 1,435 to 123.6 µM GTP with ATP or to 63.1 with AMPPNP for the BAEC membranes and from 2,314 to 243 µM GTP with ATP or to 213 with AMPPNP for the NIH3T3 cell membranes (Fig. 6). In contrast to previous reports, the Vmax was not statistically significantly affected by addition of adenine nucleotide. Similar to the endogenous cell line membranes, ATP decreased the Km of the glutamate-containing form of NPR-A from 7,384 to 730 µM GTP where AMPPNP decreased the Km to 852.3 µM GTP (Fig. 6, bottom). Therefore, the ability of AMPPNP or ATP to decrease the Km for NPR-A does not involve changes in the known phosphorylation sites.

Mutational analysis of putative ATP binding sites. Whether ATP binds directly to NPR-A and NPR-B is controversial. Initial reports suggested that the specific intracellular glycine region called the ARM within the kinase homology domain is required for adenine nucleotide regulation (12, 13, 19). However, a subsequent report indicated that this region is not involved in the regulation of NPR-A (22). More recently, the mutation of Lys516 in GC-C, which is conserved in all human receptor guanylyl cyclases (29), was shown to dramatically inhibit the activation of this receptor (5).

To address the putative ARM, we converted Gly503 and Gly505 in NPR-A to alanines (AxA). To address the role of the conserved lysine in the activation of NPR-A we mutated the amino acid homologous to Lys516 in GC-C to an alanine in NPR-A (K535A). We found that the glycine mutations had no effect on the ability of NPR-A to be activated by ANP or to be regulated by ATP. This agrees with previous mutational studies of this site performed by Koller et al. (22). Hence, we believe that the ARM is a misnomer because it is not required for ATP regulation of NPR-A; i.e., it is not an ATP regulatory motif. Conversely, mutation of Lys535 to alanine in NPR-A resulted in a dramatic decrease in ANP-dependent, but not detergent-dependent, guanylyl cyclase activity. Interestingly, ATP had no effect on the cyclase activity of this mutant (Fig. 7, top).

Recently, 8-azido-ATP was cross-linked to the kinase homology domain of NPR-A purified from bacteria (7). MALDI-TOF mass spectrometry analysis indicated that Cys634 in the sequence 630-KSSNCVVDGR-639 was photoaffinity modified. On the basis of these data, a mutant receptor was created by mutating both Cys634 and Val635 to tryptophan. Analysis of the ANP-dependent guanylyl cyclase activity of this double mutant indicated that activity was markedly reduced, although ATP was still able to increase activity about twofold. Interestingly, all human particulate guanylyl cyclase receptors contain the 630-KS motif, whereas NPR-A and NPR-B have an additional conserved serine. To test the role of this KSS region in the regulation of NPR-A, we constructed a triple mutant consisting of all alanines (AAA) substituted for the lysine and serines. Although this receptor was expressed at similar levels to the wild-type receptor based on Western blot analysis, the guanylyl cyclase activities obtained in membranes from cells transfected with this receptor were not greater than activities measure in cells transfected with a GFP plasmid that has no guanylyl cyclase activity (Fig. 7, bottom). Hence, since the triple mutant has no detergent-dependent cyclase activity, we believe that the mutation of KSS to AAA results in an improperly folded or destabilized receptor.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This report is the first to show that endogenous natriuretic peptide receptors are maximally stimulated in the absence of adenine nucleotides at early time periods but are modulated by ATP at longer time periods. We also separate the allosteric effect of ATP from its role in phosphorylating NPR-A by demonstrating marked increases in the ANP-dependent activity of a "constitutively phosphorylated" form of NPR-A. Kinetic analysis indicates for the first time that ATP and AMPPNP both dramatically decrease the Km of these receptors while having no significant effect on Vmax. The greater effect of adenine nucleotides observed at lower GTP concentrations may explain why previous investigators reported an absolute requirement of ATP for receptor activation, since they used lower GTP concentrations in their guanylyl cyclase assays (15). Mutagenesis studies indicate that the GxGxxxG region within NPR-A is completely dispensable for ATP regulation of these receptors whereas the mutation of K535 nearly abolishes the ability of ANP but not detergent to activate NPR-A. Finally, our data demonstrating that ATP increases the activity of NPR-A and NPR-B only at longer periods of time coincides with our previous results in overexpressing cells (3).

During the determination of the EC50 for AMPPNP, we found that higher concentrations of GTP result in a lower EC50 for AMPPNP and that the difference between maximum and minimum activities was higher at lower substrate concentrations; i.e., AMPPNP had a greater effect at lower GTP concentrations. Subsequent experiments indicated that both ATP and AMPPNP dramatically decrease the Km of NPR-A and NPR-B but have no significant affect the Vmax. Previous kinetic experiments performed on NPR-A (24, 49) and GC-C (17) reported no effect of ATP on the Km of either enzyme. One possibility for the discrepancy is that the membranes were not prepared in the presence of phosphatase inhibitors. Furthermore, previous investigators used different ATP analogs (caged ATP and ATP{gamma}S) instead of ATP or AMPPNP, which were used in our experiments. Since caged ATP has been shown to yield higher guanylyl cyclase activity than ATP in rat lung membranes in both the presence and absence of ANP, it may not be an accurate indicator of how ATP regulates these receptors (8). However, a recent report also observed a decrease in the Km upon addition of ATP in rat glomerular membranes (50).

Our investigation into the regions responsible for adenine nucleotide regulation clearly indicated that the glycine-rich putative ARM is not involved in the regulation of NPR-A. Our results further revealed that mutation of K535 to alanine resulted in a mutant receptor with reduced hormone-dependent, but not detergent-dependent, cyclase activity that is not affected by the presence of ATP. This is in contrast to wild-type NPR-A or the AxA mutation where the addition of ATP results in an approximately threefold increase over cyclase activities observed with ANP alone. These data are consistent with K535 being required for ATP-dependent modulation of NPR-A. Alternatively, it is possible that this mutation disrupts the normal conformation of the receptor and blocks the ability of ATP or an ATP-binding protein to interact with a separate region of the intracellular domain. Recently, Cys634 and Val635 were mutated to tryptophan in NPR-A (7). Why the bulky amino acid tryptophan was substituted for these amino acids was not described. These mutations caused a decrease in guanylyl cyclase activity as well as a twofold increase in the EC50 for ATP. Additionally, they cross-linked a [32P]8-azido-ATP probe to the kinase homology domain of NPR-A and identified a 9- and 26-amino acid peptide sequence that contained the Cys634 and Val635 by mass spectrometry analysis of trypsin-digested protein. They concluded that cysteine was covalently attached to the ATP analog. Although these mutations decreased activity, it is possible that the substitution of these amino acids with a substantially more bulky residue could have altered the structure of NPR-A without directly being the site of interaction. Furthermore, the fact that millimolar concentrations ATP were unable to effectively reduce the ability of micromolar concentrations of the ATP analog to cross-link to NPR-A suggests that this interaction is nonspecific. Those authors also concluded that there is an obligatory role of ATP in ANP-dependent activation of NPR-A because they saw only a 1.5- to 2-fold increase with ANP alone compared with a 12-fold increase seen with ANP and adenine nucleotide. Although it is not definitively clear why their results differ from ours, there are significant differences between our methods. For example, they did not indicate the inclusion of phosphatase inhibitors in the preparation of their membranes, they did not include microcystin in any of their buffers, and their reactions contained 10-fold less ANP and 3 mM unbound MgCl2, which increases the dephosphorylation of NPR-A (6).

A recent paper demonstrated that the cross-linking of 8-azido-3'-biotinyl-ATP to a cyclase deleted NPR-A construct (20). This labeling was significantly increased following treatment with ANP. Although labeling was reduced by 50% with addition of 550 µM ATP, it was never completely competed away, even after addition of 5 or 10 mM ATP. Further deletion of the kinase homology domain completely eradicated photolabeling with 8-azido-3'-biotinyl-ATP, which is consistent with ATP interacting with this domain. Exactly where the ATP analog bound to the receptor was not reported.

In conclusion, we report that endogenously expressed NPR-A and NPR-B are maximally activated in the absence of adenine nucleotides at short time periods. The ATP-independent activation of these receptors is in agreement with most reports. Please note, however, that we are neither currently suggesting nor have we previously suggested that ATP does not increase the guanylyl cyclase activities of these receptors, as has been implied (7, 20). With the exception of the very early time points, we, as all other investigators, observe more activity in the presence of ATP (3). Importantly, we now demonstrate that the increased activities result from decreases in the Km of these enzymes, not from increases in maximal velocities.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the University of Minnesota Medical School and NIH Training Grant T32 AR-050938-04.


View this table:
[in this window]
[in a new window]

 
Table 1. Kinetic analysis of endogenous NPRs

 

    FOOTNOTES
 

Address for reprint requests and other correspondence: L. R. Potter, Dept. of Biochemistry, Molecular Biology and Biophysics, Univ. of Minnesota, 6-155 Jackson, 321 Church St. SE, Minneapolis, MN 55455 (e-mail: potter{at}umn.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abbey SE, Potter LR. Lysophosphatidic acid inhibits C-type natriuretic peptide activation of guanylyl cyclase-B. Endocrinology 144: 240–246, 2003.[Abstract/Free Full Text]
  2. Abbey SE, Potter LR. Vasopressin-dependent inhibition of the C-type natriuretic peptide receptor, NPR-B/GC-B, requires elevated intracellular calcium concentrations. J Biol Chem 277: 42423–42430, 2002.[Abstract/Free Full Text]
  3. Antos LK, Abbey-Hosch SE, Flora DR, Potter LR. ATP-independent activation of natriuretic peptide receptors. J Biol Chem 280: 26928–26932, 2005.[Abstract/Free Full Text]
  4. Aparicio JG, Applebury ML. The photoreceptor guanylate cyclase is an autophosphorylating protein kinase. J Biol Chem 271: 27083–27089, 1996.[Abstract/Free Full Text]
  5. Bhandari R, Srinivasan N, Mahaboobi M, Ghanekar Y, Suguna K, Visweswariah SS. Functional inactivation of the human guanylyl cyclase C receptor: modeling and mutation of the protein kinase-like domain. Biochemistry 40: 9196–9206, 2001.[CrossRef][Medline]
  6. Bryan PM, Potter LR. The atrial natriuretic peptide receptor (NPR-A/GC-A) is dephosphorylated by distinct microcystin-sensitive and magnesium-dependent protein phosphatases. J Biol Chem 277: 16041–16047, 2002.[Abstract/Free Full Text]
  7. Burczynska B, Duda T, Sharma RK. ATP signaling site in the ARM domain of atrial natriuretic factor receptor guanylate cyclase. Mol Cell Biochem 301: 93–107, 2007.[CrossRef][Web of Science][Medline]
  8. Chang CH, Kohse KP, Chang B, Hirata M, Jiang B, Douglas JE, Murad F. Characterization of ATP-stimulated guanylate cyclase activation in rat lung membranes. Biochim Biophys Acta 1052: 159–165, 1990.[Medline]
  9. Chinkers M, Garbers DL. The protein kinase domain of the ANP receptor is required for signaling. Science 245: 1392–1394, 1989.[Abstract/Free Full Text]
  10. Chinkers M, Singh S, Garbers DL. Adenine nucleotides are required for activation of rat atrial natriuretic peptide receptor/guanylyl cyclase expressed in a baculovirus system. J Biol Chem 266: 4088–4093, 1991.[Abstract/Free Full Text]
  11. De Lean A, McNicoll N, Labrecque J. Natriuretic peptide receptor A activation stabilizes a membrane-distal dimer interface. J Biol Chem 278: 11159–11166, 2003.[Abstract/Free Full Text]
  12. Duda T, Goraczniak RM, Sharma RK. The glycine residue of ATP regulatory module in receptor guanylate cyclases that is essential in natriuretic factor signaling. FEBS Lett 335: 309–314, 1993.[CrossRef][Web of Science][Medline]
  13. Duda T, Goraczniak RM, Sitaramayya A, Sharma RK. Cloning and expression of an ATP-regulated human retina C-type natriuretic factor receptor guanylate cyclase. Biochemistry 32: 1391–1395, 1993.[CrossRef][Medline]
  14. Fan D, Bryan PM, Antos LK, Potthast RJ, Potter LR. Down-regulation does not mediate natriuretic peptide-dependent desensitization of natriuretic peptide receptor (NPR)-A or NPR-B: guanylyl cyclase-linked natriuretic peptide receptors do not internalize. Mol Pharmacol 67: 174–183, 2005.[Abstract/Free Full Text]
  15. Foster DC, Garbers DL. Dual role for adenine nucleotides in the regulation of the atrial natriuretic peptide receptor, guanylyl cyclase-A. J Biol Chem 273: 16311–16318, 1998.[Abstract/Free Full Text]
  16. Garbers DL, Chrisman TD, Wiegn P, Katafuchi T, Albanesi JP, Bielinski V, Barylko B, Redfield MM, Burnett JC Jr. Membrane guanylyl cyclase receptors: an update. Trends Endocrinol Metab 17: 251–258, 2006.[CrossRef][Web of Science][Medline]
  17. Gazzano H, Wu HI, Waldman SA. Activation of particulate guanylate cyclase by Escherichia coli heat-stable enterotoxin is regulated by adenine nucleotides. Infect Immun 59: 1552–1557, 1991.[Abstract/Free Full Text]
  18. Gazzano H, Wu HI, Waldman SA. Adenine nucleotide regulation of particulate guanylate cyclase from rat lung. Biochim Biophys Acta 1077: 99–106, 1991.[CrossRef][Medline]
  19. Goraczniak RM, Duda T, Sharma RK. A structural motif that defines the ATP-regulatory module of guanylate cyclase in atrial natriuretic factor signalling. Biochem J 282: 533–537, 1992.[Web of Science][Medline]
  20. Joubert S, Jossart C, McNicoll N, De Lean A. Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A. FEBS J 272: 5572–5583, 2005.[CrossRef][Medline]
  21. Joubert S, Labrecque J, De Lean A. Reduced activity of the npr-a kinase triggers dephosphorylation and homologous desensitization of the receptor. Biochemistry 40: 11096–11105, 2001.[CrossRef][Medline]
  22. Koller KJ, Lipari MT, Goeddel DV. Proper glycosylation and phosphorylation of the type A natriuretic peptide receptor are required for hormone-stimulated guanylyl cyclase activity. J Biol Chem 268: 5997–6003, 1993.[Abstract/Free Full Text]
  23. Kuhn M. Structure, regulation, and function of mammalian membrane guanylyl cyclase receptors, with a focus on guanylyl cyclase-A. Circ Res 93: 700–709, 2003.[Abstract/Free Full Text]
  24. Kurose H, Inagami T, Ui M. Participation of adenosine 5'-triphosphate in the activation of membrane-bound guanylate cyclase by the atrial natriuretic factor. FEBS Lett 219: 375–379, 1987.[CrossRef][Web of Science][Medline]
  25. Labrecque J, Deschenes J, McNicoll N, De Lean A. Agonistic induction of a covalent dimer in a mutant of natriuretic peptide receptor-A documents a juxtamembrane interaction that accompanies receptor activation. J Biol Chem 276: 8064–8072, 2001.[Abstract/Free Full Text]
  26. Langenickel TH, Buttgereit J, Pagel-Langenickel I, Lindner M, Monti J, Beuerlein K, Al-Saadi N, Plehm R, Popova E, Tank J, Dietz R, Willenbrock R, Bader M. Cardiac hypertrophy in transgenic rats expressing a dominant-negative mutant of the natriuretic peptide receptor B. Proc Natl Acad Sci USA 103: 4735–4740, 2006.[Abstract/Free Full Text]
  27. Ogawa H, Qiu Y, Ogata CM, Misono KS. Crystal structure of hormone-bound atrial natriuretic peptide receptor extracellular domain: rotation mechanism for transmembrane signal transduction. J Biol Chem 279: 28625–28631, 2004.[Abstract/Free Full Text]
  28. Pfeifer A, Aszodi A, Seidler U, Ruth P, Hofmann F, Fassler R. Intestinal secretory defects and dwarfism in mice lacking cGMP-dependent protein kinase II. Science 274: 2082–2086, 1996.[Abstract/Free Full Text]
  29. Potter LR. Domain analysis of human transmembrane guanylyl cyclase receptors: implications for regulation. Front Biosci 10: 1205–1220, 2005.[Web of Science][Medline]
  30. Potter LR. Phosphorylation-dependent regulation of the guanylyl cyclase-linked natriuretic peptide receptor B: dephosphorylation is a mechanism of desensitization. Biochemistry 37: 2422–2429, 1998.[CrossRef][Medline]
  31. Potter LR, Abbey-Hosch S, Dickey DM. Natriuretic peptides, their receptors, and cyclic guanosine monophosphate-dependent signaling functions. Endocr Rev 27: 47–72, 2006.[Abstract/Free Full Text]
  32. Potter LR, Garbers DL. Dephosphorylation of the guanylyl cyclase-A receptor causes desensitization. J Biol Chem 267: 14531–14534, 1992.[Abstract/Free Full Text]
  33. Potter LR, Garbers DL. Protein kinase C-dependent desensitization of the atrial natriuretic peptide receptor is mediated by dephosphorylation. J Biol Chem 269: 14636–14642, 1994.[Abstract/Free Full Text]
  34. Potter LR, Hunter T. A constitutively "phosphorylated" guanylyl cyclase-linked atrial natriuretic peptide receptor mutant is resistant to desensitization. Mol Biol Cell 10: 1811–1820, 1999.[Abstract/Free Full Text]
  35. Potter LR, Hunter T. Guanylyl cyclase-linked natriuretic peptide receptors: structure and regulation. J Biol Chem 276: 6057–6060, 2001.[Free Full Text]
  36. Potter LR, Hunter T. Identification and characterization of the major phosphorylation sites of the B-type natriuretic peptide receptor. J Biol Chem 273: 15533–15539, 1998.[Abstract/Free Full Text]
  37. Potter LR, Hunter T. Phosphorylation of the kinase homology domain is essential for activation of the A-type natriuretic peptide receptor. Mol Cell Biol 18: 2164–2172, 1998.[Abstract/Free Full Text]
  38. Potthast R, Abbey-Hosch SE, Antos LK, Marchant JS, Kuhn M, Potter LR. Calcium-dependent dephosphorylation mediates the hyperosmotic and lysophosphatidic acid-dependent inhibition of natriuretic peptide receptor-B/guanylyl cyclase-B. J Biol Chem 279: 48513–48519, 2004.[Abstract/Free Full Text]
  39. Qiu Y, Ogawa H, Miyagi M, Misono KS. Constitutive activation and uncoupling of the atrial natriuretic peptide receptor by mutations at the dimer interface. Role of the dimer structure in signalling. J Biol Chem 279: 6115–6123, 2004.[Abstract/Free Full Text]
  40. Schulz S, Waldman SA. The guanylyl cyclase family of natriuretic peptide receptors. Vitam Horm 57: 123–151, 1999.[Web of Science][Medline]
  41. Song DL, Kohse KP, Murad F. Brain natriuretic factor. Augmentation of cellular cyclic GMP, activation of particulate guanylate cyclase and receptor binding. FEBS Lett 232: 125–129, 1988.[CrossRef][Web of Science][Medline]
  42. Tucker CL, Laura RP, Hurley JB. Domain-specific stabilization of photoreceptor membrane guanylyl cyclase by adenine nucleotides and guanylyl cyclase activating proteins (GCAPs). Biochemistry 36: 11995–12000, 1997.[CrossRef][Medline]
  43. Vaandrager AB, Schulz S, De Jonge HR, Garbers DL. Guanylyl cyclase C is an N-linked glycoprotein receptor that accounts for multiple heat-stable enterotoxin-binding proteins in the intestine. J Biol Chem 268: 2174–2179, 1993.[Abstract/Free Full Text]
  44. Vaandrager AB, van der Wiel E, de Jonge HR. Heat-stable enterotoxin activation of immunopurified guanylyl cyclase C. Modulation by adenine nucleotides. J Biol Chem 268: 19598–19603, 1993.[Abstract/Free Full Text]
  45. Vaandrager AB, van der Wiel E, Hom ML, Luthjens LH, de Jonge HR. Heat-stable enterotoxin receptor/guanylyl cyclase C is an oligomer consisting of functionally distinct subunits, which are non-covalently linked in the intestine. J Biol Chem 269: 16409–16415, 1994.[Abstract/Free Full Text]
  46. Waldman SA, Rapoport RM, Murad F. Atrial natriuretic factor selectively activates particulate guanylate cyclase and elevates cyclic GMP in rat tissues. J Biol Chem 259: 14332–14334, 1984.[Abstract/Free Full Text]
  47. Wei CM, Aarhus LL, Miller VM, Burnett JC Jr. Action of C-type natriuretic peptide in isolated canine arteries and veins. Am J Physiol Heart Circ Physiol 264: H71–H73, 1993.[Abstract/Free Full Text]
  48. Winquist RJ, Faison EP, Waldman SA, Schwartz K, Murad F, Rapoport RM. Atrial natriuretic factor elicits an endothelium-independent relaxation and activates particulate guanylate cyclase in vascular smooth muscle. Proc Natl Acad Sci USA 81: 7661–7664, 1984.[Abstract/Free Full Text]
  49. Wong SK, Ma CP, Foster DC, Chen AY, Garbers DL. The guanylyl cyclase-A receptor transduces an atrial natriuretic peptide/ATP activation signal in the absence of other proteins. J Biol Chem 270: 30818–30822, 1995.[Abstract/Free Full Text]
  50. Woodard GE, Zhao J, Rosado JA. Different effect of ATP on ANP receptor guanylyl cyclase in spontaneously hypertensive and normotensive rats. Acta Physiol (Oxf) 188: 195–206, 2006.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/6/E1756    most recent
00321.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antos, L. K.
Right arrow Articles by Potter, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antos, L. K.
Right arrow Articles by Potter, L. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.