AJP - Endo Journal of Neurophysiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 293: E1242-E1249, 2007. First published August 21, 2007; doi:10.1152/ajpendo.00382.2007
0193-1849/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/E1242    most recent
00382.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klein, D. K.
Right arrow Articles by Wojtaszewski, J. F. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klein, D. K.
Right arrow Articles by Wojtaszewski, J. F. P.

Lack of AMPK{alpha}2 enhances pyruvate dehydrogenase activity during exercise

Ditte K. Klein,1 Henriette Pilegaard,2 Jonas T. Treebak,1 Thomas E. Jensen,1 Benoit Viollet,4,5 Peter Schjerling,3 and Jørgen F. P. Wojtaszewski1

1Section of Human Physiology, Department of Exercise and Sport Sciences, and 2Department of Molecular Biology, Copenhagen Muscle Research Centre, University of Copenhagen; 3Department of Molecular Muscle Biology, Rigshospitalet, Copenhagen, and Department of Biomedical Science, University of Copenhagen, Copenhagen, Denmark; 4Institut Cochin, Université Paris Descartes, Centre National de la Recherche Scientifique (UMR8104); and 5Institut National de la Santé et de la Recherche Médicale, U567, Paris, France

Submitted 18 June 2007 ; accepted in final form 19 August 2007


   ABSTRACT
TOP
 ABSTRACT
RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
5'-AMP-activated protein kinase (AMPK) was recently suggested to regulate pyruvate dehydrogenase (PDH) activity and thus pyruvate entry into the mitochondrion. We aimed to provide evidence for a direct link between AMPK and PDH in resting and metabolically challenged (exercised) skeletal muscle. Compared with rest, treadmill running increased AMPK{alpha}1 activity in {alpha}2KO mice (90%, P < 0.01) and increased AMPK{alpha}2 activity in wild-type (WT) mice (110%, P < 0.05), leading to increased AMPK{alpha} Thr172 (WT: 40%, {alpha}2KO: 100%, P < 0.01) and ACCbeta Ser227 phosphorylation (WT: 70%, {alpha}2KO: 210%, P < 0.01). Compared with rest, exercise significantly induced PDH-E1{alpha} site 1 (WT: 20%, {alpha}2KO: 62%, P < 0.01) and site 2 (only {alpha}2KO: 83%, P < 0.01) dephosphorylation and PDHa [~200% in both genotypes (P < 0.01)]. Compared with WT, PDH dephosphorylation and activation was markedly enhanced in the {alpha}2KO mice both at rest and during exercise. The increased PDHa activity during exercise was associated with elevated glycolytic flux, and muscles from the {alpha}2KO mice displayed marked lactate accumulation and deranged energy homeostasis. Whereas mitochondrial DNA content was normal, the expression of several mitochondrial proteins was significantly decreased in muscle of {alpha}2KO mice. In isolated resting EDL muscles, activation of AMPK signaling by AICAR did not change PDH-E1{alpha} phosphorylation in either genotype. PDH is activated in mouse skeletal muscle in response to exercise and is independent of AMPK{alpha}2 expression. During exercise, {alpha}2KO muscles display deranged energy homeostasis despite enhanced glycolytic flux and PDHa activity. This may be linked to decreased mitochondrial oxidative capacity.

adenosine 5'-monophosphate-activated protein kinase; 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside; treadmill running; glucose metabolism

THE PYRUVATE DEHYDROGENASE (PDH) COMPLEX (PDC) is a mitochondrial enzyme that catalyzes the irreversible conversion of pyruvate to acetyl-CoA and entry of carbohydrate-derived substrate into the citric acid cycle for oxidation. Therefore, it is a key regulator of carbohydrate metabolism in cells. PDC consists of several copies of three catalytic proteins denoted E1, E2, and E3, where the PDH activity in the active form (PDHa activity) is associated with the E1 subunit, also denoted PDH. PDH is composed of two {alpha}- and two beta-subunits (14), and the PDH activity is regulated by phosphorylation and dephosphorylation on three specific serine residues on the E1{alpha} subunit (25, 32). In skeletal muscle, PDH is inactivated by phosphorylation of site 1 and site 2 (15), the level of which is regulated by PDH kinases (PDK1-4) and PDH phosphatases (PDP1/2). A range of allosteric factors modulates the action of the upstream kinases and phosphatases (reviewed in Refs. 14 and 31). PKC{delta} was recently shown (5) to translocate to the mitochondrion, and phosphorylation/activation of PDP led to dephosphorylation and activation of PDH. These observations introduce an unexplored field of PDH regulation by covalent modification of upstream regulators by classical signaling components of the cells.

AMPK is involved in regulating various aspects of glucose metabolism in skeletal muscles (reviewed in Ref. 16). Whereas genetic evidence firmly establishes the involvement of AMPK in this respect for glucose transport and regulation of glycogen synthase activity, no such evidence has been provided for glucose oxidation. However, recent studies suggest an association between AMPK and PDH and/or glucose oxidation in skeletal muscle, i.e., 1) pharmacological activation of AMPK results in increased PDHa and glucose oxidation in resting rat soleus muscle (29), and 2) genetic manipulation of the {gamma}3 regulatory subunit of AMPK in mice results in altered skeletal muscle glucose oxidation (2, 3). Together, these findings suggest that AMPK may regulate glucose oxidation by regulating the activity of PDH via regulation of upstream PDKs and/or PDPs.

Skeletal muscle expresses by far more AMPK heterotrimers containing the {alpha}2 catalytic subunit than the AMPK{alpha}1 subunit, and a range of metabolic events is, at least in resting muscle, regulated through this isoform of AMPK (20). Exercise is a potent stimulus for both AMPK (37) and PDH regulation (35), and we therefore investigated whether knockout of the catalytic AMPK{alpha}2 isoform affected the activation of PDH in mouse skeletal muscle at rest as well as during treadmill running.


   RESEARCH DESIGN AND METHODS
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals.

All experiments were approved by the Danish Animal Experimental Inspectorate and complied with the European Convention for the Protection of Vertebrate Animals used for Experiments and other Scientific Purposes (Council of Europe 123, Strasbourg, France, 1985). Wild-type (WT) and AMPK{alpha}2-knockout ({alpha}2KO) (34) mice (4–5 mo old) used were littermates produced by intercross breeding with the use of heterozygote parent animals. The mice were housed in a 10:14-h light-dark cycle and received standard rodent chow.

Treadmill running.

To determine the role of in vivo AMPK activation on PDH activity, fed male WT and {alpha}2KO mice were subjected to a 10-min treadmill run (22 m/min, incline 23°). Immediately after cessation of exercise the mice were killed by cervical dislocation, and quadriceps muscles were freeze-clamped in situ using precooled (liquid N2) aluminum tongs and stored at –80°C until being processed further. Prior to the experiment, all mice were accustomed to the treadmill by being run for 3 consecutive days at increasing intensity and duration. The experiment was performed 2 days after the last familiarization session.

In vitro incubation.

To determine the effect of pharmacological activation of AMPK, extensor digitorum longus (EDL) muscles from fed male WT and {alpha}2KO mice were incubated ex vivo with 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR; Toronto Research Chemicals, Toronto, ON, Canada) for 60 min, as described previously (33). Muscles were quickly removed from anesthetized mice (6 mg/100 g body wt pentobarbital) and suspended by ligatures at 4–5 mN in incubation chambers (multimyograph system; Danish Myo-Technology, Aarhus, Denmark) in medium containing Krebs-Henseleit buffer (118.5 mM NaCl, 24.7 mM NaHCO3, 4.74 mM KCl, 1.18 mM MgSO3, 1.18 KH2PO4, 2.5 CaCl2, pH 7.4). The medium was kept at 30°C and gassed with 95% O2-5% CO2. The muscles were incubated for 10 min in medium without AICAR, followed by 60 min of incubation in medium without or with 2 mM of AICAR. These experiments were performed both in the presence and absence of 10 mM glucose. Immediately after the incubation procedure, muscles were blotted on filter paper and freeze-clamped using aluminum tongs precooled in liquid N2.

Muscle lysate/homogenate preparation.

Muscles were homogenized (1:15 wet wt/vol) in ice-cold buffer A [50 mM HEPES (pH 7.4) 10% glycerol, 20 mM Na pyrophosphate, 150 mM NaCl, 1% NP-40, 20 mM beta-glycerophosphate, 10 mM NaF, 1 mM EDTA, 1 mM EGTA, 2 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 2 mM Na3VO4, 3 mM benzamidine] for 20 s (PT 3100; Kinematica). Homogenates were rotated end over end for 1 h at 4°C. Aliquots of homogenate were stored for muscle glycogen determination. Muscle lysates were generated by centrifugation at 17,500 g for 20 min at 4°C. Supernatant (lysate) was frozen in liquid nitrogen and stored at –80°C. Total protein content in homogenates and lysates was measured by the bicinchoninic acid method (Pierce).

SDS-PAGE.

Muscle lysate proteins were separated by SDS-PAGE (7.5 or 10% Tris·HCl gels, Criterion; Bio-Rad) and transferred to PVDF membranes (Immobilon Transfer Membrane; Millipore) by semidry transfer. After being blocked in Tris-buffered saline-Tween 20 (TBS-T) containing 2% low-fat milk protein for 1 h at room temperature, membranes were incubated with primary antibody overnight at 4°C, washed for 5 min in TBS-T, and incubated 1 h at room temperature with secondary HRP-conjugated antibody (DAKO). Membranes were washed for 30 min in TBS-T, and bands were visualized using chemiluminescence (Millipore) and Kodak Image Station (2000MM; Kodak). The bands were quantified using Kodak MI software, and results were expressed relative to control samples loaded on each gel.

Western blotting.

Phosphorylation of AMPK{alpha} (Thr172) and acetyl-CoA carboxylase (ACC)beta (Ser227) was determined using phosphospecific antibodies (Cell Signaling Technology and Upstate Biotechnologies, respectively). PDH-E1{alpha} subunit protein expression and phosphorylation were determined using three polyclonal antibodies against the human PDH-E1{alpha} subunit as described (26): 1) PDH-E1{alpha} protein antibody raised against the COOH-terminal (296–309) part of the human PDH-E1{alpha} subunit (DPGVSYRTREEIQE), 2) PDH-E1{alpha} site 1 (Ser293) phosphorylation antibody against a phosphopeptide corresponding to amino acid 287–299 in the COOH-terminal part of the human PDH-E1{alpha} subunit [YRYHGH(pS)MSDPGV], and 3) PDH-E1{alpha} site 2 (Ser300) phosphorylation antibody raised against a phosphospecific corresponding to amino acid 294–306 in the COOH-terminal part of the human PDH-E1{alpha} subunit [MSDPGV(pS)YRTREE]. All three antibodies gave one specific band at 40 kDa. Secondary antibodies were horseradish peroxidase-conjugated anti-sheep and anti-rabbit (DAKO).

AMPK activity.

Isoform-specific AMPK{alpha} activity was determined by sequential immunoprecipitation of {alpha}2, then {alpha}1, from 200 µg of muscle lysate protein, as described previously (4, 40), using the AMARA peptide (AMARAASAAALARRR) as substrate (200 µM) (10).

PDHa.

The PDHa activity was determined as previously described (6, 8, 28), except that the muscles were homogenized in buffer A. Briefly, 20 µl of muscle homogenates was used for assaying the PDHa activity. The specific activity was related to PDH-E1{alpha} protein content in the muscle sample.

Muscle glycogen.

Muscle glycogen content was determined as glycosyl units after acid hydrolysis (21) using 400 µg of muscle homogenate protein.

Muscle lactate, adenosine nucleotides, creatine, and phosphocreatine.

Fifteen to 20 mg wet wt of muscle was extracted with 3 M PCA and neutralized with KHCO3. Muscle lactate, creatine (Cr), phosphocreatine (PCr), and ATP concentrations were determined fluorometrically, as previously described (21). Estimation of free ADP and AMP concentrations was based on the near-equilibrium nature of the Cr phosphokinase and adenylate kinase reactions using the equilibrium constants 1.66 x 109 and 1.05, respectively (19). Free ADP was estimated from the measured ATP, Cr, and PCr and H+ content. The H+ concentration was estimated from the lactate content as previously described (22).

DNA extraction.

DNA was extracted from 20–25 mg of quadriceps muscle from {alpha}2KO and WT mice. Muscles were incubated overnight at 50°C in digestion buffer (100 mM NaCl, 10 mM Tris·HCl, pH 8.0, 25 mM EDTA, pH 8.0, 0.25% SDS) containing 0.27 mg/ml proteinase K (Roche). The DNA was extracted using phenol-chloroform-isoamyl OH (Invitrogen) extraction and precipitated for 2 h at –20°C in 3 M NaOAc and 100% ethanol. The DNA was washed twice in 70% ice-cold ethanol, all ethanol was removed by vacuum drying, and the DNA was resuspended in sterile-filtered ddH2O.

Mitochondrial DNA/nuclear DNA ratio.

For each DNA extract, the nuclear gene for mouse cytochrome c oxidase Vb (COX-Vb) subunit and the mitochondrial gene for mouse cytochrome c oxidase I (COX-I) subunit were quantified separately using real-time PCR (ABI Prism 7900 Sequence Detection System; Applied Biosystems) to yield the mitochondrial (mt)DNA/nuclear (n)DNA ratio (9). Forward (FP) and reverse (RP) primers and TaqMan probes were designed and optimized for the PCR reaction as described previously (27). The oligos used for amplification of a segment of COX-Vb were FP: 5'AATCTAGTCCCATCCATCAGCAA3'; RP: 5'GCAGCCAAAACCAGATGACA3'; probe: 5'-Fam-TTGTCCTCTTCACAGATGCAGCCCA-Tamra-3' and of COX-I were FP: 5'TGCAACCCTACACGGAGGTAATA3'; RP: 5'ATGTATCGTGAAGCACGATGTCA-3'; probe: 5'-Fam-TCTAACCGGAATTGTTTTATCCAACTCATCCC-Tamra-3'. The PCR amplifications were performed in triplicates in a total reaction volume of 10 µl, as described (27).

Statistics.

Data are presented as means ± SE. Two-way analysis of variance with repeated or nonrepeated measures or t-tests was applied when appropriate to evaluate the effect of treadmill running and AICAR incubation in {alpha}2KO and WT animals. When significant interactions were observed, Tukey's post hoc test was used to locate differences. Differences were considered significant at P < 0.05.


   RESULTS
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Treadmill running.

All mice completed 10 min of treadmill running at a high-exercise intensity (22 m/min, incline of 23°). This resulted in an increased AMPK{alpha}2 activity (by 110% compared with rest) and an unchanged AMPK{alpha}1 activity in quadriceps muscles of WT mice (Fig. 1, A and B). AMPK{alpha}2 activity was undetectable in quadriceps muscles from {alpha}2KO mice. A normal AMPK{alpha}1 activity was seen at rest but was, in contrast to WT, increased significantly by exercise (by 90% compared with rest) in quadriceps muscles of the {alpha}2KO mice. Absence of the AMPK{alpha}2 subunit led to a marked reduction in AMPK{alpha} phosphorylation at rest and during exercise (~13% of WT level), supporting the view that AMPK{alpha}2 activity contributes the majority of overall AMPK{alpha} phosphorylation in skeletal muscle (Fig. 1C). And yet the AMPK{alpha}1 activation in the {alpha}2KO mice during exercise seems to compensate for the lack of AMPK{alpha}2 activity, leading to a near-similar phosphorylation of Ser227 of ACCbeta in the WT and {alpha}2KO mice (Fig. 1D).


Figure 1
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 1. 5'-AMP-activated protein kinase (AMPK) activity and signaling in quadriceps muscle of wild-type (WT) and AMPK{alpha}2-knockout ({alpha}2KO) mice after treadmill exercise. Isoform-specific enzyme activity of AMPK{alpha}2 activity (A) and AMPK{alpha}1 activity (B), both expressed in pmol·mg protein–1·min–1. Representative Western blot and quantification of AMPK (C) and acetyl-CoA carboxylase (ACC)beta (D) phosphorylation. Values are means ± SE (n = 10). *P < 0.05; **P < 0.01 vs. resting condition within genotype; {dagger}{dagger}P < 0.01, main effect of {alpha}2KO compared with WT; ##P < 0.01 vs. WT within exercise. ND, nondetectable. Open bars, rest (R); black bars, exercise (E). AU, arbitrary units.

 
We have developed phosphospecific antibodies recognizing PDH-E1{alpha} site 1 or site 2 when phosphorylated only (26). Phosphorylation on both of these sites decreased significantly in quadriceps muscle of {alpha}2KO mice, whereas in WT mice only PDH-E1{alpha} site 1 phosphorylation decreased in response to exercise (Fig. 2, A and B). The level of PDH-E1{alpha} site 1 and site 2 phosphorylation in quadriceps muscles was significantly lower after exercise in {alpha}2KO than WT mice. The dephosphorylation of PDH-E1{alpha} in response to exercise was associated with a similar fold increase in PDHa activity in WT and {alpha}2KO (Fig. 2D) but reached higher levels in the {alpha}2KO mice. The genotype differences in degree of PDH-E1{alpha} dephosphorylation was in line with a significantly higher PDHa activity in muscles of {alpha}2KO both at rest and after exercise (by 210 and 190%, respectively, compared with WT levels). As expected (26), a significant strong negative exponential association existed between PDHa activity and both PDH-E1{alpha} site 1 and site 2 phosphorylation (r2 = 0.54 and r2 = 0.46, respectively; both n = 39, P < 0.0001).


Figure 2
View larger version (18K):
[in this window]
[in a new window]

  		Fig. 2. Pyruvate dehydrogenase (PDH)-E1{alpha} phosphorylation and activity in quadriceps muscle of WT and {alpha}2KO mice after treadmill exercise. Quantification of PDH-E1{alpha} site 1 phosphorylation (A) and PDH-E1{alpha} site 2 phosphorylation (B), both relative to total PDH-E1{alpha} protein. Representative Western blots (C) and PDH activity in the active form (PDHa activity; D) relative to PDH-E1{alpha} protein. Values are means ± SE (n = 10). **P < 0.01 vs. resting condition within genotype; {dagger}{dagger}P < 0.01, main effect of {alpha}2KO compared with WT. # and ##P < 0.05 and 0.01, respectively, different from WT within condition. Open bars, R; black bars, E.

 
Muscle glycogen content decreased significantly in response to treadmill running in quadriceps muscles of both WT and {alpha}2KO mice (Fig. 3A). The glycogen content was significantly lower in the {alpha}2KO than in the WT mice both at basal (~19%) and after exercise (~66%) (Fig. 3A). Muscle lactate accumulated during treadmill running in quadriceps muscles of both WT (P = 0.056) and {alpha}2KO mice (P < 0.01) (Table 1). However, the lactate content increased significantly more with exercise in the muscle of {alpha}2KO mice, reaching levels ~200% higher than in WT.


Figure 3
View larger version (7K):
[in this window]
[in a new window]

  		Fig. 3. Glycogen and nucleotides in quadriceps muscle after treadmill exercise. A: muscle glycogen expressed as mmol/g protein. B: phosphocreatine (PCr)/total creatine (Cr) ratio expressed as mmol/kg wet weight. C: AMP/ATP ratio. Values are means ± SE (n = 10). **P < 0.01 vs. resting condition within genotype; # and ##P < 0.05 and 0.01, respectively, different from WT within condition. Open bars, R; black bars, E. ww, Wet weight.

 

View this table:
[in this window]
[in a new window]

  		Table 1. Effects of treadmill running on muscle nucleotides, Cr, PCr, and lactate levels

 
The data above indicate an elevated glycogenolysis during exercise in muscles of {alpha}2KO mice. Thus, we obtained measures of energy status of the muscles. At rest, no differences were apparent between WT and {alpha}2KO quadriceps muscles with respect to Cr, PCr, and ATP, leading to a similar level of estimated free AMP (AMPf). In response to the intense exercise protocol, ATP levels decreased significantly, by ~20%, in both genotypes (Table 1). However, the decline in PCr was markedly enhanced (~100%) in the muscles of the {alpha}2KO compared with the WT, and this was accompanied by a significant rise in Cr content in the {alpha}2KO muscles only. These changes led to more marked disturbances in both the PCr-to-total Cr and AMPf-to-ATP ratios in the {alpha}2KO than in the WT muscles (Fig. 3, B and C).

Protein expression of PDH-E1{alpha} was reduced by 20% in {alpha}2KO compared with WT mice (Fig. 4). In line, other protein markers of the mitochondria showed decreased expression or activity. Thus, cytochrome c protein expression (0.62 ± 0.02 vs. 0.44 ± 0.02, P < 0.01) and the maximal activity of both citrate synthase (293.1 ± 8.5 vs. 243.4 ± 3.8 µmol·mg protein–1·min–1, P < 0.01) and 3-hydroxyacyl-CoA-dehydrogenase (371.5 ± 10.5 vs. 302.2 ± 12.1 µmol·mg protein–1·min–1, P < 0.01) were lower in quadriceps muscle of the {alpha}2KO than in the WT mice. To obtain an mtDNA/nDNA ratio, we quantified the amount of the mitochondrial-encoded COX-I gene and the nuclear-encoded COX-Vb gene to yield a mtDNA/nDNA ratio (9). No differences were detected in the mtDNA/nDNA ratio between quadriceps muscles of {alpha}2KO and WT mice, indicating a decreased quality rather than number of the mitochondria in the {alpha}2KO muscles.


Figure 4
View larger version (10K):
[in this window]
[in a new window]

  		Fig. 4. PDH-E1{alpha} protein expression and mitochondrial (mt)DNA/nuclear (n)DNA ratio in basal quadriceps muscle from {alpha}2KO and WT mice determined by Western blotting and quantitative PCR, respectively. Values are means ± SE (n = 10). *P < 0.05 WT vs. {alpha}2KO in basal samples (t-test). No differences were observed between {alpha}2KO and WT in mitochondrial mtDNA/nDNA content. Open bars, WT; black bars, {alpha}2KO.

 
Although the above data do not support AMPK signaling as a major player in exercise-induced PDH regulation, previous results in rat soleus muscles (29) have suggested that pharmacological AMPK activation by AICAR is sufficient to increase PDH activity and glucose oxidation. To test this in our model, we isolated and incubated EDL muscle from {alpha}2KO and WT littermates for 60 min with 2 mM AICAR. AMPK and ACCbeta were phosphorylated in response to AICAR as seen previously (data not shown) (33), but there were no differences in PDH-E1{alpha} phosphorylation with AICAR (data not shown). Because the previous study in rat soleus muscles included incubation in medium containing glucose, we reevaluated the effect of AICAR in EDL muscle during incubation with 10 mM glucose. As expected, we found an increase in AMPK phosphorylation in response to AICAR in {alpha}2KO and WT mice (both >200% increase compared with basal, P < 0.01), but the overall level of AMPK phosphorylation was significantly lower in {alpha}2KO than in WT mice (Fig. 5, A and B). The ACCbeta phosphorylation increased in WT and {alpha}2KO mice (P < 0.01) in response to AICAR, but the level of phosphorylation was lower in {alpha}2KO mice than in WT mice both at rest and during exercise (P < 0.01) (Fig. 5B). However, the PDH-E1{alpha} site 1 and site 2 phosphorylation relative to total PDH-E1{alpha} protein remained unchanged in response to AICAR in both genotypes (Fig. 5, C and D). Similar observations were made in mouse soleus muscle (data not shown). The lack of response was not due to a nonfunctional PDH system, as isolated EDL muscles from {alpha}2KO and WT mice stimulated to contract by electrical stimulation displayed a marked dephosphorylation of both PDH-E1{alpha} site 1 and site 2 (<30% of resting levels).


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		Fig. 5. Ex vivo 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR) incubation (2 mM AICAR, 10 mM glucose) of extensor digitorum longus muscle from {alpha}2KO and WT. Representative Western blot and quantification for AMPK phosphorylation (A), ACCbeta phosphorylation (B), PDH-E1{alpha} site 1 phosphorylation (C), and PDH-E1{alpha} site 2 phosphorylation (D), both relative to total PDH-E1{alpha} protein. Values are means ± SE (n = 9–10). **P < 0.01 vs. basal condition within genotype; {dagger}{dagger}P < 0.01, main effect of {alpha}2KO compared with WT. Open bars, basal (B); gray bars, AICAR (A).

 

   DISCUSSION
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
The study shows that PDH is dephosphorylated and activated in response to exercise in mouse skeletal muscle and that this activation is independent of AMPK{alpha}2. In addition, pharmacological activation of AMPK by AICAR is not sufficient to activate PDH in nonmetabolically challenged mouse skeletal muscle. The more disturbed energy homeostasis during exercise in the absence of AMPK{alpha}2 is likely the explanation for an enhanced upregulation of PDH activity.

PDH regulates entry of pyruvate into the mitochondrion, and the protein complex is central in regulating glucose oxidation. AMPK is an important energy sensor of the cell and activates a range of metabolic processes seeking to restore energy homeostasis upon disturbances (reviewed in Ref. 16). We hypothesized that PDH is targeted by AMPK-mediated signaling on ths basis of several observations showing that manipulation of AMPK expression or activity modulates glucose oxidation and/or PDH activity. For example, after in vivo swimming exercise, the lack of AMPK{gamma}3 protein leads to decreased glucose oxidation (3), and treatment of isolated split rat soleus muscle with AICAR increases glucose oxidation and PDH activity (29). The data from the present study, however, suggest that such changes in glucose oxidation during exercise are not a direct effect of altered AMPK signaling toward PDH. Also, our data suggest that, in resting skeletal muscle, increased AMPK signaling is not sufficient to induce PDH dephosphorylation. We evaluated the possibility of species differences by performing analysis on rat hindlimb muscles perfused with AICAR (2 mM, 40 min) as previously described (38). However, AICAR did not induce changes in PDH phosphorylation in either soleus or white or red portions of the gastrocnemius muscle (Klein DK, Jørgensen SB, Richter EA, and Wojtaszewski JFP, unpublished observations). Due to limited tissue availability, regulation of PDH in the perfused rat muscles as well as in the isolated mouse muscles was assessed by phosphorylation only. We cannot exclude the possibility that AICAR regulates PDHa activity by mechanisms unrelated to phosphorylation on site 1 and site 2 in rat skeletal muscle. However, we consider it unlikely 1) because data indicate these two sites as the main regulatory sites for PDHa in skeletal muscle (32) and 2) because of the tight association between activity and phosphorylation (both site 1 and site 2) of PDH in both mouse (present study) and human muscles (26). Furthermore, Collier et al. (7) reported that AMPK could be activated pharmacologically without an increase in glucose oxidation, and, although they did not measure regulation of PDH, these observations further support the present findings.

On the basis of amino acid sequence analyses of both mouse and human PDH-E1{alpha}, PDP1-2, and PDK1-4, all proteins contain one or more potential phosphorylation sites recognized by AMPK as defined by the recognition motif [{phi}(X,R/K/H)XXS/TXXX{phi}] (10). Yet within the cell, AMPK likely needs to be located in the mitochondrial matrix to induce such phosphorylation, and sequence analyses (12) reveal that, except for the short form of the mouse AMPK{gamma}2, none of the isoforms contains a mitochondrial import signal sequence. This information is in line with pilot analyses performed on partial purified mitochondrial preparations from rat skeletal muscle in which neither AMPK{alpha}1 nor -{alpha}2 was found (unpublished observations). So if AMPK was to be a regulator of PDHa activity through changes in PDH phosphorylation, this probably has to be indirect.

Despite maintained ability to regulate PDH activity and glucose uptake, the muscle of the {alpha}2KO mouse displayed marked disturbances in energy homeostasis, perhaps due to disturbances in fuel systems other than those involved in glucose metabolism. Although the exercise regimen performed was strenuous and normally would rely on carbohydrate metabolism, it is possible that diminished fat oxidation caused by lack of normal AMPK signaling is a factor in the deranged energy homeostasis observed in these mice. The elevated glycogenolysis and lactate accumulation seen in these mice may thus be compensatory events attempting to normalize the energy homeostasis, potentially brought about by allosteric activation of glycogen phosphorylase, phosphofructokinase, and PDH due to the elevated AMP/ADP levels.

In the present study we did consider the possibility that lack of the AMPK{alpha}2 catalytic subunit may disturb the mitochondrial biogenesis (41), leading to decreased oxidative capacity. We found reduced mitochondrial protein expression (PDH, cytochrome c) and reduced maximal activities of 3-hydroxyacyl-CoA-dehydrogenase and citrate synthase in the quadriceps muscles of {alpha}2KO mice. These observations extend our previous observations in gastrocnemius muscle of this mouse strain (17). The unaltered mtDNA/nDNA ratio suggests that the quality/function of the mitochondrion, rather than the number of mitochondria per se, is reduced in the {alpha}2KO mouse. In support of this view, mitochondrial function, but not content, was recently reported (1) to be impaired in cardiac muscle of these mice.

In the {alpha}2KO model, AMPK{alpha}1 protein expression is increased (18) and during exercise AMPK{alpha}1 activity is enhanced in {alpha}2KO mice. Thus, the present study does not provide direct evidence to exclude the possibility that AMPK{alpha}1 is a player in PDH regulation during treadmill running. However, we do not consider this a likely scenario because the higher PDHa activity observed in {alpha}2KO muscle in the basal state was not accompanied by higher AMPK{alpha}1 activity, and therefore, other factors must regulate the PDHa.

The AMPK{alpha}2 gene knockout is whole body, and the disarranged energy homeostasis during exercise in vivo could be due to extramuscular factors, forcing the cells to rely more on intramuscular substrate as fuel and thereby increasing the depletion of internal fuel stores during exercise. Further studies need to address this issue. However, the observation that the ex vivo contraction capacity is also reduced in mice overexpressing AMPK kinase-dead constructs specifically in muscle (13, 24) suggests that such whole body defects are not the only explanation.

The hypothesis tested in the present study was based on the observation that AICAR increased PDHa activity at rest in isolated rat muscle (29). However, the observation that exercise-induced PDH activity on the contrary was higher when AMPK{alpha}2 was lacking indicates that AMPK could be a potential inhibitor of PDH. Such a scenario could be in play, balancing the regulation of fat and glucose oxidation. In fact, the initial marked elevation in PDHa activity during exercise is diminished late during prolonged exercise (23, 26, 36), and this is associated with increased AMPK activity (39), suggesting a role of AMPK in downregulating PDHa activity during exercise. Still, a range of uncertainties exist; e.g., why is AICAR treatment in resting muscle unable to regulate PDH, and through which effectors does the cytosolic AMPK regulate the mitochondrial PDH or its nearest upstream regulators?

Ca2+ has been described as a powerful signal for PDH activation (30) and may function as a feed-forward signal for PDH activation during exercise. Ca2+ activates the Ca2+-sensitive PDH phosphatase (PDP1) when released from the sarcoplasmatic reticulum upon depolarization (25). So far, we do not have evidence to suggest an altered Ca2+ homeostasis in muscles of the {alpha}2KO mice; however, it is possible that the marked energy disturbances observed during exercise in AMPK{alpha}2 KO mice may also interfere with sarcoplasmic reticulum Ca2+ reuptake during relaxation, leading to elevated Ca2+ levels and, hence, increased PDP and PDH activities. In line, pyruvate and the ATP-to-ADP ratio are allosteric modulators of PDK activity (reviewed in Ref. 11), and thus the increased ADP-to-ATP ratio in {alpha}2KO muscles may induce a diminished activation of PDKs compared with WT mice during exercise.

Finally, it should be noted that phosphorylation of ACCbeta is increased normally during in vivo exercise (present study) in muscles of the AMPK{alpha}2 KO mouse. Similarly, AMPK{alpha}2-independent regulation of ACCbeta has been reported during electrical stimulation in ex vivo incubated EDL muscles (18). Thus, during muscle contractile activity regulation of ACCbeta phosphorylation is not dependent on AMPK{alpha}2, whereas the induction of phosphorylation by AICAR is fully AMPK{alpha}2 dependent (18). Whether this relates to a more severe activation of the remaining AMPK{alpha}1 during exercise/contractions than during AICAR treatment or whether signals unrelated to AMPK are involved in ACC regulation during exercise remains to be resolved.

In conclusion, PDH is dephosphorylated and activated in mouse skeletal muscle in response to treadmill running. A functional AMPK{alpha}2 subunit is not necessary for this regulation. Therefore, we conclude that AMPK does not directly regulate PDH phosphorylation and activity in murine skeletal muscle. However, lack of AMPK{alpha}2 leads to increased PDH activity both at rest and during exercise, and AMPK may therefore indirectly influence PDHa activity, likely due to deranged energy homeostasis.


   GRANTS
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This study was supported by grants from the Danish Diabetes Association, the Danish Medical and Natural Science Research Council, the Novo Nordisk Foundation, the Copenhagen Muscle Research Centre, and an Integrated Project from the European Union (contract LSHM-CT-2004-005272). J. F. P. Wojtaszewski was supported by a Hallas Møller fellowship from the Novo Nordisk Foundation.


   ACKNOWLEDGMENTS
 
We thank professor D. Grahame Hardie, Dundee University, Dundee, Scotland, for the kind donation of valuable tools for this study. Irene B. Nielsen and Betina Bolmgren are acknowledged for skilled technical assistance.


   FOOTNOTES
 

Address for reprint requests and other correspondence: J. F. P. Wojtaszewski, Copenhagen Muscle Research Centre, Section of Human Physiology, Dept. of Exercise and Sport Sciences, Univ. of Copenhagen, 13, Universitetsparken, 2100 Copenhagen (e-mail: JWojtaszewski{at}ifi.ku.dk)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Athea Y, Viollet B, Mateo P, Rousseau D, Novotova M, Garnier A, Vaulont S, Wilding JR, Grynberg A, Veksler V, Hoerter J, Ventura-Clapier R. AMP-activated protein kinase alpha2 deficiency affects cardiac cardiolipin homeostasis and mitochondrial function. Diabetes 56: 786–794, 2007.[Abstract/Free Full Text]
  2. Barnes BR, Glund S, Long YC, Hjalm G, Andersson L, Zierath JR. 5'-AMP-activated protein kinase regulates skeletal muscle glycogen content and ergogenics. FASEB J 19: 773–779, 2005.[Abstract/Free Full Text]
  3. Barnes BR, Long YC, Steiler TL, Leng Y, Galuska D, Wojtaszewski JF, Andersson L, Zierath JR. Changes in exercise-induced gene expression in 5'-AMP-activated protein kinase {gamma}3-null and {gamma}3 R225Q transgenic mice. Diabetes 54: 3484–3489, 2005.[Abstract/Free Full Text]
  4. Birk JB, Wojtaszewski JF. Predominant {alpha}2/beta2/{gamma}3 AMPK activation during exercise in human skeletal muscle. J Physiol 577: 1021–1032, 2006.[Abstract/Free Full Text]
  5. Caruso M, Maitan MA, Bifulco G, Miele C, Vigliotta G, Oriente F, Formisano P, Beguinot F. Activation and mitochondrial translocation of protein kinase Cdelta are necessary for insulin stimulation of pyruvate dehydrogenase complex activity in muscle and liver cells. J Biol Chem 276: 45088–45097, 2001.[Abstract/Free Full Text]
  6. Cederblad G, Carlin JI, Constantin-Teodosiu D, Harper P, Hultman E. Radioisotopic assays of CoASH and carnitine and their acetylated forms in human skeletal muscle. Anal Biochem 185: 274–278, 1990.[CrossRef][Web of Science][Medline]
  7. Collier CA, Bruce CR, Smith AC, Lopaschuk G, Dyck DJ. Metformin counters the insulin-induced suppression of fatty acid oxidation and stimulation of triacylglycerol storage in rodent skeletal muscle. Am J Physiol Endocrinol Metab 291: E182–E189, 2006.[Abstract/Free Full Text]
  8. Constantin-Teodosiu D, Cederblad G, Hultman E. A sensitive radioisotopic assay of pyruvate dehydrogenase complex in human muscle tissue. Anal Biochem 198: 347–351, 1991.[CrossRef][Web of Science][Medline]
  9. Cote HC, Brumme ZL, Craib KJ, Alexander CS, Wynhoven B, Ting L, Wong H, Harris M, Harrigan PR, O'Shaughnessy MV, Montaner JS. Changes in mitochondrial DNA as a marker of nucleoside toxicity in HIV-infected patients. N Engl J Med 346: 811–820, 2002.[Abstract/Free Full Text]
  10. Dale S, Wilson WA, Edelman AM, Hardie DG. Similar substrate recognition motifs for mammalian AMP-activated protein kinase, higher plant HMG-CoA reductase kinase-A, yeast SNF1, and mammalian calmodulin-dependent protein kinase I. FEBS Lett 361: 191–195, 1995.[CrossRef][Web of Science][Medline]
  11. Denton RM, McCormack JG, Rutter GA, Burnett P, Edgell NJ, Moule SK, Diggle TA. The hormonal regulation of pyruvate dehydrogenase complex. Adv Enzyme Regul 36: 183–198, 1996.[CrossRef][Web of Science][Medline]
  12. Emanuelsson O, Brunak S, von Heijne G, Nielsen H. Locating proteins in the cell using TargetP, SignalP and related tools. Nat Protoc 2: 953–971, 2007.[CrossRef][Medline]
  13. Fujii N, Hirshman MF, Kane EM, Ho RC, Peter LE, Seifert MM, Goodyear LJ. AMP-activated protein kinase alpha2 activity is not essential for contraction- and hyperosmolarity-induced glucose transport in skeletal muscle. J Biol Chem 280: 39033–39041, 2005.[Abstract/Free Full Text]
  14. Harris RA, Bowker-Kinley MM, Huang B, Wu P. Regulation of the activity of the pyruvate dehydrogenase complex. Adv Enzyme Regul 42: 249–259, 2002.[CrossRef][Web of Science][Medline]
  15. Holness MJ, Sugden MC. Regulation of pyruvate dehydrogenase complex activity by reversible phosphorylation. Biochem Soc Trans 31: 1143–1151, 2003.[Web of Science][Medline]
  16. Jorgensen SB, Richter EA, Wojtaszewski JF. Role of AMPK in skeletal muscle metabolic regulation and adaptation in relation to exercise. J Physiol 574: 17–31, 2006.[Abstract/Free Full Text]
  17. Jorgensen SB, Treebak JT, Viollet B, Schjerling P, Vaulont S, Wojtaszewski JF, Richter EA. Role of AMPK{alpha}2 in basal, training-, and AICAR-induced GLUT4, hexokinase II, and mitochondrial protein expression in mouse muscle. Am J Physiol Endocrinol Metab 292: E331–E339, 2007.[Abstract/Free Full Text]
  18. Jorgensen SB, Viollet B, Andreelli F, Frosig C, Birk JB, Schjerling P, Vaulont S, Richter EA, Wojtaszewski JF. Knockout of the alpha2 but not alpha1 5'-AMP-activated protein kinase isoform abolishes 5-aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside but not contraction-induced glucose uptake in skeletal muscle. J Biol Chem 279: 1070–1079, 2004.[Abstract/Free Full Text]
  19. Lawson JW, Veech RL. Effects of pH and free Mg2+ on the Keq of the creatine kinase reaction and other phosphate hydrolyses and phosphate transfer reactions. J Biol Chem 254: 6528–6537, 1979.[Abstract/Free Full Text]
  20. Long YC, Zierath JR. AMP-activated protein kinase signaling in metabolic regulation. J Clin Invest 116: 1776–1783, 2006.[CrossRef][Web of Science][Medline]
  21. Lowry OH, Passonneau JV. A Flexible System of Enzymatic Analysis. London, UK: Academic, 1972.
  22. Mannion AF, Jakeman PM, Willan PL. Determination of human skeletal muscle buffer value by homogenate technique: methods of measurement. J Appl Physiol 75: 1412–1418, 1993.[Abstract/Free Full Text]
  23. Mourtzakis M, Saltin B, Graham T, Pilegaard H. Carbohydrate metabolism during prolonged exercise and recovery: interactions between pyruvate dehydrogenase, fatty acids, and amino acids. J Appl Physiol 100: 1822–1830, 2006.[Abstract/Free Full Text]
  24. Mu J, Brozinick JT Jr, Valladares O, Bucan M, Birnbaum MJ. A role for AMP-activated protein kinase in contraction- and hypoxia-regulated glucose transport in skeletal muscle. Mol Cell 7: 1085–1094, 2001.[CrossRef][Web of Science][Medline]
  25. Pettit FH, Roche TE, Reed LJ. Function of calcium ions in pyruvate dehydrogenase phosphatase activity. Biochem Biophys Res Commun 49: 563–571, 1972.[CrossRef][Web of Science][Medline]
  26. Pilegaard H, Birk JB, Sacchetti M, Mourtzakis M, Hardie DG, Stewart G, Neufer PD, Saltin B, van Hall G, Wojtaszewski JF. PDH-E1{alpha} dephosphorylation and activation in human skeletal muscle during exercise: effect of intralipid infusion. Diabetes 55: 3020–3027, 2006.[Abstract/Free Full Text]
  27. Pilegaard H, Saltin B, Neufer PD. Effect of short-term fasting and refeeding on transcriptional regulation of metabolic genes in human skeletal muscle. Diabetes 52: 657–662, 2003.[Abstract/Free Full Text]
  28. Putman CT, Spriet LL, Hultman E, Lindinger MI, Lands LC, McKelvie RS, Cederblad G, Jones NL, Heigenhauser GJ. Pyruvate dehydrogenase activity and acetyl group accumulation during exercise after different diets. Am J Physiol Endocrinol Metab 265: E752–E760, 1993.[Abstract/Free Full Text]
  29. Smith AC, Bruce CR, Dyck DJ. AMP-kinase activation with AICAR simultaneously increases fatty acid and glucose oxidation in resting rat soleus muscle. J Physiol 565: 537–546, 2005.[Abstract/Free Full Text]
  30. Spriet LL, Heigenhauser GJ. Regulation of pyruvate dehydrogenase (PDH) activity in human skeletal muscle during exercise. Exerc Sport Sci Rev 30: 91–95, 2002.[CrossRef][Web of Science][Medline]
  31. Sugden MC, Holness MJ. Recent advances in mechanisms regulating glucose oxidation at the level of the pyruvate dehydrogenase complex by PDKs. Am J Physiol Endocrinol Metab 284: E855–E862, 2003.[Abstract/Free Full Text]
  32. Teague WM, Pettit FH, Yeaman SJ, Reed LJ. Function of phosphorylation sites on pyruvate dehydrogenase. Biochem Biophys Res Commun 87: 244–252, 1979.[CrossRef][Web of Science][Medline]
  33. Treebak JT, Glund S, Deshmukh A, Klein DK, Long YC, Jensen TE, Jorgensen SB, Viollet B, Andersson L, Neumann D, Wallimann T, Richter EA, Chibalin AV, Zierath JR, Wojtaszewski JF. AMPK-mediated AS160 phosphorylation in skeletal muscle is dependent on AMPK catalytic and regulatory subunits. Diabetes 55: 2051–2058, 2006.[Abstract/Free Full Text]
  34. Viollet B, Andreelli F, Jorgensen SB, Perrin C, Geloen A, Flamez D, Mu J, Lenzner C, Baud O, Bennoun M, Gomas E, Nicolas G, Wojtaszewski JF, Kahn A, Carling D, Schuit FC, Birnbaum MJ, Richter EA, Burcelin R, Vaulont S. The AMP-activated protein kinase alpha2 catalytic subunit controls whole-body insulin sensitivity. J Clin Invest 111: 91–98, 2003.[CrossRef][Web of Science][Medline]
  35. Ward GR, Sutton JR, Jones NL, Toews CJ. Activation by exercise of human skeletal muscle pyruvate dehydrogenase in vivo. Clin Sci (Lond) 63: 87–92, 1982.[Medline]
  36. Watt MJ, Heigenhauser GJ, Stellingwerff T, Hargreaves M, Spriet LL. Carbohydrate ingestion reduces skeletal muscle acetylcarnitine availability but has no effect on substrate phosphorylation at the onset of exercise in man. J Physiol 544: 949–956, 2002.[Abstract/Free Full Text]
  37. Winder WW, Hardie DG. Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise. Am J Physiol Endocrinol Metab 270: E299–E304, 1996.[Abstract/Free Full Text]
  38. Wojtaszewski JF, Jorgensen SB, Hellsten Y, Hardie DG, Richter EA. Glycogen-dependent effects of 5-aminoimidazole-4-carboxamide (AICA)-riboside on AMP-activated protein kinase and glycogen synthase activities in rat skeletal muscle. Diabetes 51: 284–292, 2002.[Abstract/Free Full Text]
  39. Wojtaszewski JF, Mourtzakis M, Hillig T, Saltin B, Pilegaard H. Dissociation of AMPK activity and ACCbeta phosphorylation in human muscle during prolonged exercise. Biochem Biophys Res Commun 298: 309–316, 2002.[CrossRef][Web of Science][Medline]
  40. Wojtaszewski JF, Nielsen P, Hansen BF, Richter EA, Kiens B. Isoform-specific and exercise intensity-dependent activation of 5'-AMP-activated protein kinase in human skeletal muscle. J Physiol 528: 221–226, 2000.[Abstract/Free Full Text]
  41. Zong H, Ren JM, Young LH, Pypaert M, Mu J, Birnbaum MJ, Shulman GI. AMP kinase is required for mitochondrial biogenesis in skeletal muscle in response to chronic energy deprivation. Proc Natl Acad Sci USA 99: 15983–15987, 2002.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Cell Physiol.Home page
J. T. Treebak, J. B. Birk, B. F. Hansen, G. S. Olsen, and J. F. P. Wojtaszewski
A-769662 activates AMPK {beta}1-containing complexes but induces glucose uptake through a PI3-kinase-dependent pathway in mouse skeletal muscle
Am J Physiol Cell Physiol, October 1, 2009; 297(4): C1041 - C1052.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. S. Lee-Young, S. R. Griffee, S. E. Lynes, D. P. Bracy, J. E. Ayala, O. P. McGuinness, and D. H. Wasserman
Skeletal Muscle AMP-activated Protein Kinase Is Essential for the Metabolic Response to Exercise in Vivo
J. Biol. Chem., September 4, 2009; 284(36): 23925 - 23934.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
C. D. L. Folmes, C. S. Wagg, M. Shen, A. S. Clanachan, R. Tian, and G. D. Lopaschuk
Suppression of 5'-AMP-activated protein kinase activity does not impair recovery of contractile function during reperfusion of ischemic hearts
Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H313 - H321.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
R. W. Schwenk, J. J.F.P. Luiken, A. Bonen, and J. F.C. Glatz
Regulation of sarcolemmal glucose and fatty acid transporters in cardiac disease
Cardiovasc Res, July 15, 2008; 79(2): 249 - 258.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/E1242    most recent
00382.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klein, D. K.
Right arrow Articles by Wojtaszewski, J. F. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klein, D. K.
Right arrow Articles by Wojtaszewski, J. F. P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.