AJP - Endo Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 293: E1045-E1052, 2007. First published July 31, 2007; doi:10.1152/ajpendo.00276.2007
0193-1849/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/E1045    most recent
00276.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berthiaume, M.
Right arrow Articles by Deshaies, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berthiaume, M.
Right arrow Articles by Deshaies, Y.

11beta-HSD1 inhibition improves triglyceridemia through reduced liver VLDL secretion and partitions lipids toward oxidative tissues

Magalie Berthiaume,1 Mathieu Laplante,1 William T. Festuccia,1 Katherine Cianflone,1 Lorraine P. Turcotte,2 Denis R. Joanisse,3 Gunilla Olivecrona,4 Rolf Thieringer,5 and Yves Deshaies1

Faculty of Medicine, 1Laval Hospital Research Center and 3Division of Kinesiology, Department of Social and Preventive Medicine, Laval University, Sainte-Foy, Quebec, Canada; 2Department of Kinesiology, University of Southern California, Los Angeles, California; 4Department of Medical Biochemistry and Biophysics, Umeå University, Umeå, Sweden; and 5Department of External Scientific Affairs, Merck Research Laboratories, Rahway, New Jersey

Submitted 12 May 2007 ; accepted in final form 26 July 2007


   ABSTRACT
TOP
 ABSTRACT
RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURES
 REFERENCES
 
Tissue-specific alterations in 11beta-hydroxysteroid dehydrogenase (HSD) type 1 activity, which amplifies glucocorticoid action, are thought to contribute to some of the metabolic complications of obesity. The present study tested whether hypertriglyceridemia is one such complication by investigating the effects of an 11beta-HSD1 inhibitor (compound A, 3 mg·kg–1·day–1, 21 days) on triglyceride (TG) metabolism in a rat model of diet-induced obesity. The dose of compound A used did not affect food intake or final body weight. Compound A improved fasting triglyceridemia (–42%) through a robust reduction (–41%) in hepatic TG secretion rate, without change in plasma TG clearance rate. Uptake of TG-derived fatty acids was, however, increased in oxidative tissues, including red gastrocnemius (+47%), heart (+39%), and brown adipose tissue (BAT, +46%) at the expense of the liver, with a concomitant increase in plasma membrane fatty acid-binding protein. Lipid oxidation products were increased in red gastrocnemius (+35%) and heart (+33%), as were levels of uncoupling protein 1 mRNA in BAT (+48%), and carnitine palmitoyltransferase 1 activity tended to be increased in some oxidative tissues. These findings demonstrate that pharmacological inhibition of 11beta-HSD1 at a dose that does not affect food intake improves triglyceridemia by reducing hepatic very low density lipoprotein-TG secretion, with a shift in the pattern of TG-derived fatty acid uptake toward oxidative tissues, in which lipid accumulation is prevented by increased lipid oxidation.

11beta-hsd1 inhibitor; glucocorticoids; diet-induced obesity; triglycerides; lipid metabolism; lipid partitioning; lipid oxidation

EXCESS GLUCOCORTICOIDS (GC) promote visceral obesity, hyperlipidemia, and insulin resistance (62), as seen for instance in human Cushing's syndrome (8, 42). Because these abnormalities parallel those of the metabolic syndrome, it has been suggested that increased GC action may be involved in the pathogenesis of the metabolic complications of obesity (4, 31, 50).

Beyond systemic GC, which are not particularly elevated in obesity (43, 46, 59), increasing evidence suggests the importance of 11beta-hydroxysteroid dehydrogenase type 1 (11beta-HSD1)-mediated local amplification in GC action. The enzyme, which converts inactive corticosteroids into bioactive forms such as cortisol in humans and corticosterone in rodents (47, 56), is expressed in many tissues, including the liver (1, 55), adipose tissue (12, 37), heart, and skeletal muscle (10, 13, 60). These tissues together largely determine the fate of circulating lipids. The involvement of 11beta-HSD1 activity in determining lipemia is emphasized by studies in transgenic mice overexpressing the enzyme, in which the lipid profile is deteriorated (33, 41). Conversely, 11beta-HSD1 gene invalidation as well as recently developed, highly specific pharmacological 11beta-HSD1 inhibitors markedly improve the plasma lipid profile in several animal models (23, 35, 61), further supporting a physiologically relevant modulatory role of 11beta-HSD1 action on triglyceride (TG) metabolism.

In addition to its effect on plasma levels of lipids, 11beta-HSD1 also impacts their metabolic fate. For instance, whole body 11beta-HSD1 gene invalidation upregulates the expression of fatty acid oxidation genes in the liver (35), and high-dose pharmacological 11beta-HSD1 inhibition prevents lowering of whole body energy expenditure in the face of decreased food intake in obese mice (61). Therefore, a reduction in 11beta-HSD1 action appears to influence the metabolic fate of TG at multiple levels.

The mechanisms of the hypotriglyceridemic action of selective 11beta-HSD1 inhibition (hepatic secretion vs. intravascular clearance) and those of its tissue-specific impact on the metabolic handling of lipids remain largely unknown. In addition, in the context of understanding how 11beta-HSD1 inhibition impacts lipid metabolism, the interpretation of previous work is confounded by the anorectic effect of commonly used doses of pharmacological 11beta-HSD1 inhibitors (23, 35, 61), with lipemia being obviously highly sensitive to caloric intake. The present study therefore aimed to assess, in rats fed an obesity-promoting diet, the contribution of major determinants (secretion and clearance) of circulating TG levels and their peripheral metabolism under conditions where 11beta-HSD1 action has no impact on food intake.


   RESEARCH DESIGN AND METHODS
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURES
 REFERENCES
 
Animals and treatments. Male Sprague-Dawley rats initially weighing 150–175 g were purchased from Charles River Laboratories (St. Constant, QC, Canada) and housed individually in stainless steel cages in a room kept at 23 ± 1°C with a 12:12-h light-dark cycle (lights on at 0700). The animals were cared for and handled in conformance with the Canadian Guide for the Care and Use of Laboratory Animals, and protocols were approved by the institutional animal care committee at Laval University. For the first 5 days, rats had free access to tap water and a stock diet (Charles River Rodent Diet no. 5075; Ralston Products, Woodstock, ON, Canada; digestible energy content: 12.9 kJ/g). Rats were then fed a purified high-sucrose, high-fat diet (19.44 kJ/g, 41% energy from carbohydrate, 39% from fat, and 20% from protein) to maximally challenge the hypolipidemic potential of 11beta-HSD1 inhibition. One-half of the animals was given the 11beta-HSD1 inhibitor (compound A, 3 mg·kg–1·day–1) as an adjunct to their diet for 3 wk. Compound A is a 4-heteroarylbicyclo[2.2.2]octyltriazole; the potency and pharmacodynamic activity of this class of drugs have been published elsewhere (20). It was determined in pilot studies that the dose of compound A used here does not affect food intake or body weight gain. In the present conditions, plasma levels of the drug achieved with this dose (11 ± 2 µM, measured 6 h after food removal following normal night access to food) were nearly identical to those (13 ± 2 µM) of a pilot study in which compound A, given to rats as an adjunct to rodent chow for 7 days, was found to inhibit 97 ± 3% of 11beta-HSD1 activity in adipose tissue and liver, as quantified by a [3H]cortisone-to-cortisol conversion assay. These pilot studies have also shown that, with provision of compound A in food, drug levels in plasma measured during the dark (feeding) period (12 ± 1 µM) are maintained for at least 6 h into the lighted period (13 ± 2 µM), during which food intake is minimal. The amount of 11beta-HSD1 inhibitor was adjusted every other day to the average food consumption so as to provide a constant amount per unit body weight. At the end of the experiments, rats were fasted at 0700, and measurements were performed at 1300.

Serum and tissue sampling. The 6-h-fasted rats were killed by decapitation; trunk blood was collected and centrifuged (1,500 g, 15 min at 4°C); and serum was stored at –20°C until later biochemical measurements. Liver, red gastrocnemius, vastus lateralis (VLM) and soleus muscles, heart, and brown adipose tissue (BAT) were excised, weighed, and prepared for further analysis as described below. Samples of liver, red gastrocnemius muscle, heart, and BAT were immediately frozen and stored at –80°C for later quantification of TG content in lipid extracts (17).

Hormone and metabolite determinations. Insulin and corticosterone were determined by RIA using reagent kits from Linco Research (St. Charles, MO) with rat insulin and corticosterone as standards, respectively. Serum glucose concentrations were measured by the glucose oxidase method with the Beckman glucose analyzer. Serum nonesterified fatty acid (NEFA) concentrations were assayed enzymatically with a reagent kit (Wako Chemicals, Richmond, VA). TG concentrations in serum and tissue lipid extracts were measured by an enzymatic method using a reagent kit (Roche Diagnostics, Montreal, QC, Canada) that allows correction for free glycerol.

Very low density lipoprotein-TG secretion rate. Before the end of the 3-wk treatment (4 days), eight control and eight compound A-treated rats were cannulated in the jugular vein and allowed to recover. On the day of the experiment and following the 6-h fast, an initial blood sample (0.15 ml) was withdrawn in an EDTA-containing syringe through the venous cannula, and rats were injected through the cannula with 1 ml/kg Triton WR-1339 (300 mg/ml saline; Sigma-Aldrich, St. Louis, MO), a detergent that prevents intravascular TG catabolism (40). Blood samples (0.15 ml) were then taken 20, 40, and 60 min after the injection. Rats were then injected with a lethal dose of ketamine-xylazine. Blood samples were centrifuged at 60 g for 10 min, and plasma was stored at –20°C for later plasma TG quantification. The rate of very low-density lipoprotein (VLDL)-TG secretion in the circulation was determined from regression analysis of TG accumulation in plasma vs. time. Secretion rate was calculated by multiplying the slope of the regression line by plasma volume estimated from body weight and was expressed as micromoles per minute.

TG clearance from blood, tissue lipid uptake, and oxidation. Before the end of the 3-wk treatment (4 days), eight control and eight compound A-treated rats were cannulated in the jugular vein and allowed to recover. On the day of the experiment, following the 6-h fast and an initial blood sampling (0.3 ml), rats were injected through the jugular catheter with 0.1 ml/kg of 10% Intralipid containing [9,10-3H]trioleoylglycerol (570 dpm/nmol fatty acids) diluted 1:8.5 with 20% Intralipid (160 mg/kg TG were injected). Blood samples (0.2 ml) were then taken 1, 2, 3, 5, and 10 min after the injection and directly added to 2 ml Dole's mixture (isopropanol-heptane-1 M H2SO4, 40:10:1 vol/vol/vol). The exact amount of blood in each sample was determined by weighing the tube before and after addition of the sample. TG clearance from the circulation was calculated from the slope of disappearance of radioactivity from plasma. After the injection (20 min), rats were injected with a lethal dose of ketamine-xylazine. The following tissues were excised: liver, gastrocnemius muscle, heart, BAT, kidneys, lungs, pancreas, and spleen. No treatment effect was found in kidneys, lungs, pancreas, and spleen, and these data are not reported herein. Tissue lipid uptake was derived from the amount of radioactivity incorporated, as previously described (24). The amount of lipid taken up that was oxidized within tissues, acetate and water being the major end products, was determined by counting radioactivity in the aqueous phase of the tissue extracts (63). Data are reported as percent injected dose of [3H]TG.

Skeletal muscle lipoprotein lipase activity. Because the red gastrocnemius was used entirely for the other assays, LPL activity was measured in alternative oxidative muscles. Immediately upon tissue harvesting, samples (~50 mg) of the soleus and the red portion of the VLM muscle were homogenized, processed, and frozen exactly as described (44). For determination of total extractable lipoprotein lipase (LPL) activity, thawed tissue homogenates were incubated at 28°C with a substrate mixture containing [carboxyl-14C]triolein, and [14C]NEFA released by LPL were separated and counted. LPL activity is expressed as micromole NEFA released per gram wet tissue.

Plasma membrane fatty acid binding protein content. Because plasma membrane fatty acid binding protein (FABPpm) could not readily be related with TG-derived fatty acid uptake in the liver because of lipolysis-independent hepatic processing of TG emulsions (38), protein mass was not determined in this tissue. Pieces (~10 mg) of thawed red gastrocnemius muscle and heart were homogenized in a ground-glass Duall homogenizer (1.5 ml) with 39 vol ice-cold extracting medium (0.1 M phosphate buffer, 2 mM EDTA, pH 7.2). Homogenates were transferred into 1.5 ml polypropylene microtubes and sonicated six times for 5 s each at 20 W on ice, with pauses of 85 s between pulses. FABPpm protein content was measured by Western blotting. Homogenate protein concentration was determined by the RC DC protein assay (Bio-Rad, Hercules, CA). Homogenate proteins (50 µg) were separated by SDS-PAGE on a 12% resolving gel and transferred electrophoretically to a polyvinylidene difluoride membrane (Bio-Rad). Membranes were blocked, rinsed, and then incubated with a purified polyclonal rabbit anti-FABPpm antibody (1:1,000; see Ref. 58). The secondary incubations were performed with ECL horseradish peroxidase-linked anti-rabbit IgG (1:10,000; GE Healthcare BioSciences, Baie d'Urfé, QC, Canada). Detection with ECL (Plus Western Blotting Detection System; GE Healthcare Biosciences) and exposure to film (Kodak BioMax MR-1 Film; GE Healthcare BioSciences) were then performed. A sample of liver homogenate (50 µg) was used as a reference standard for FABPpm. The integrated density of bands was measured using Labworks image acquisition and analysis software (UVP BioImaging Systems, Upland, CA). Results are expressed as density units relative to the reference standard.

Carnitine palmitoyltransferase 1 activity. Tissue homogenates prepared as described above were used for determination of carnitine palmitoyltransferase 1 (CPT1) activity (maximal velocity) by a spectrophotometric technique as described earlier (14). Enzyme activity is expressed in nanokatals per gram tissue wet weight.

BAT uncoupling protein 1 mRNA. Levels of lipid oxidation products, FABPpm protein, and CPT1 activity in BAT were all below detection levels of the methods described above. Therefore, mRNA levels of uncoupling protein 1 (UCP1), a reliable marker of BAT oxidative/thermogenic capacity, was assessed. Total RNA was prepared from BAT using the Trizol RNA extraction method. RNA concentration was quantitated by absorbance at 260 nm. For cDNA synthesis, Expand reverse transcriptase (Invitrogen, Burlington, ON, Canada) was used following the manufacturer's instructions, and cDNA was diluted in DNase-free water (1:25) before quantification by real-time PCR. The primers, designed using the Vector NTI program and synthesized by Invitrogen, were the following: 5'-primer TGGTGAGTTCGACAACTTCC; 3'-primer GTGGGCTGCCCAATGAATAC. These primers were validated with a sample BAT cDNA. mRNA transcript levels were measured using a Rotor Gene 3000 system (Montreal Biotech, Montreal, QC, Canada). Amplification and detection of the target mRNA was performed with SYBR Green Jumpstart Taq ready mix (Sigma-Aldrich). Levels of mRNA were determined using a standard curve generated with the plasmid corresponding to the target gene and are expressed as number of copies per reaction. To control for sample loading, tissue samples were run in duplicate. Between-duplicate variation never exceeded 10%.

Liver and BAT morphology by light microscopy. Liver and BAT samples were fixed in 10% vol/vol formaldehyde-PBS at 4°C and embedded in paraffin. Thin sections were mounted on glass slides and dyed with oil Red O (liver) or hematoxylin/eosin (BAT). Digital images of tissue slices were captured using an Olympus BX60 microscope equipped with a Sony RT Slider Spot Camera (Camsen Group, Markham, ON, Canada) at a magnification of x20.

Statistical analysis. Data are presented as means ± SE and were analyzed by unpaired Student's t-test. Variables with nonnormal distributions were log transformed before analysis to ensure homogeneity of variance. Differences were considered statistically significant at P < 0.05.


   RESULTS
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 DISCLOSURES
 REFERENCES
 
The low dose of the 11beta-HSD1 inhibitor compound A had no significant effect either on cumulative food intake, body weight gain, or food efficiency (Table 1). Treated rats had slightly increased heart weight (+7%, P < 0.04) without change in total protein content (data not shown) and decreased BAT weight (–17%, P < 0.03), whereas no significant difference was observed in liver and gastrocnemius muscle weight. The effects of compound A on hypothalamic-pituitary-adrenal (HPA) axis activation as well as white adipose tissue morphology and metabolism have been reported elsewhere (6).


View this table:
[in this window]
[in a new window]

  		Table 1. Cumulative food intake, body weight gain, food efficiency, and tissue weights in rats treated or not with compound A for 3 wk

 
Inhibition of 11beta-HSD1 robustly reduced fasting serum TG levels (–42%; Table 2) whereas serum NEFA remained unaltered by compound A. In the present conditions, compound A had no significant effect on fasting serum insulin, glucose, and corticosterone concentrations.


View this table:
[in this window]
[in a new window]

  		Table 2. Fasting (6-h) serum concentrations of triglycerides, nonesterified fatty acids, glucose, insulin, and corticosterone in rats treated or not with compound A for 3 wk

 
To gain insight into the mechanisms of the hypotriglyceridemic action of 11beta-HSD1 inhibition, the rate of hepatic VLDL-TG secretion and that of TG clearance from the circulation, the balance of which determines fasting triglyceridemia, were assessed. Here again, fasting plasma TG levels were significantly lower in treated than control rats. The 3-wk treatment with compound A robustly decreased (–41%) liver TG secretion rate (Fig. 1A), whereas it did not affect global TG clearance (Fig. 1B), indicating that the hypotriglyceridemic action of compound A in the present nutritional conditions was entirely caused by reduced liver TG output in the circulation.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 1. Plasma triglyceride (TG) concentration following Triton WR-1339 injection (A) and TG secretion rate (TGSR, inset in A), percent label remaining in plasma (B) and TG clearance rate (TGCR, inset in B) in rats treated or not with compound A for 3 wk. Each point and column represents the mean ± SE of 5–6 animals. In A, TG levels were significantly (P < 0.05) lower in treated than control rats at all time points. *Different from control, P < 0.05.

 
Although the global rate of TG clearance from blood was not altered by 11beta-HSD1 inhibition, we next sought to determine whether tissue partitioning of circulating TG was affected by treatment. In our previous study (6), it was determined that compound A did not affect TG-derived fatty acid uptake by various white adipose tissue depots. Therefore, only oxidative tissues were considered herein. Uptake of labeled TG-derived fatty acids indicated that the major effect of 11beta-HSD1 inhibition was a redistribution of uptake toward extrahepatic oxidative tissues. Radiolabel uptake was decreased in liver (–19%) and increased in red gastrocnemius muscle (+47%), heart (+39%), and BAT (+46%; Fig. 2, A–D). To gain insight into the mechanisms of such increased uptake, we next considered the availability of LPL, the key enzyme responsible for intravascular TG hydrolysis, as well as that of a major determinant of fatty acid uptake downstream of LPL action. The fatty acid transporter FABPpm is present at the plasma membrane where it facilitates fatty acid entry in the cell (53, 54). LPL activity was determined in the soleus and VLM muscles and was found to remain unaffected by treatment [soleus: control, 6.3 ± 1.1 µmol NEFA/g tissue vs. compound A, 6.7 ± 1.3, not significant (NS); VLM: control, 2.2 ± 0.3 µmol NEFA/g tissue vs. compound A, 2.4 ± 0.5, NS]. FABPpm protein content was, however, significantly increased in red gastrocnemius (+34%) and heart (2.9-fold) of rats treated with the 11beta-HSD1 inhibitor (Fig. 3).


Figure 2
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 2. [3H]TG-derived fatty acid uptake in liver (A), red gastrocnemius (R gastr, B), heart (C), and brown adipose tissue (BAT, D) of rats treated or not with compound A for 3 wk. Each bar represents the mean ± SE of 5–6 animals. *Different from control, P < 0.05.

 

Figure 3
View larger version (8K):
[in this window]
[in a new window]

  		Fig. 3. Red gastrocnemius (A) and heart (B) plasma membrane fatty acid-binding protein (FABPpm) content in rats treated or not with compound A for 3 wk. Each bar represents the mean ± SE of 5–6 animals. *Different from control, P < 0.05.

 
The TG content of oxidative tissues was next assessed to determine whether increased lipid uptake translated into lipid accumulation. As shown in Fig. 4, the 11beta-HSD1 inhibitor decreased TG concentration in the liver (–19%; Fig. 4, A and B), with no change in red gastrocnemius (Fig. 4C) and the heart (Fig. 4D). Whereas TG concentration per unit weight of BAT was unchanged by treatment (data not shown), the lower total TG content (–16%; Fig. 4, E and F) of this lipid-rich tissue appeared to largely explain its lower weight (Table 1) seen in rats treated with compound A.


Figure 4
View larger version (45K):
[in this window]
[in a new window]

  		Fig. 4. Liver TG concentration (A) and representative oil Red O-stained liver samples (B), red gastrocnemius (C) and heart (D) TG concentration, BAT total TG content (E), and representative hematoxylin/eosin-stained BAT samples (F) from rats treated or not with compound A for 3 wk. Each bar represents the mean ± SE of 5–6 animals. *Different from control, P < 0.05. Micrographs were taken at x20 magnification. In B, note lesser red (lipid) staining in sample from compound A-treated rat; in F, note smaller lipid droplets in sample from compound A-treated rat.

 
Increased fatty acid oxidation constitutes one likely mechanism to explain the fact that increased TG-derived fatty acid uptake did not translate into tissue lipid accumulation. This was directly tested through quantitation of the proportion of labeled lipids administered that was metabolized into water-soluble oxidative products in tissues, as well as through estimation of the activity of CPT1, a key limiting enzyme of mitochondrial lipid oxidation. Lipid oxidative products were modestly increased in liver (+21%, P = 0.06) but more robustly so in red gastrocnemius (+35%, P < 0.03) and heart (+33%, P < 0.04; Fig. 5, A–C), whereas they were below detection level in BAT. Levels of expression of UCP1 were, however, strongly increased in BAT (+48%) in treated rats compared with controls (Fig. 5D). Finally, 11beta-HSD1 inhibition increased the activity of CPT1 in the red gastrocnemius (+22%, P < 0.02), and it tended to do so in the liver (+13%, P = 0.12) and heart (+12%, P = 0.10) (Fig. 5, E–G).


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 5. Proportion of injected [3H]TG found as lipid oxidation products in liver (A), red gastrocnemius (B), and heart (C); uncoupling protein 1 (UCP1) mRNA levels in BAT (D); and carnitine palmitoyltransferase (CPT) 1 activity in liver (E), red gastrocnemius (F), and heart (G) of rats treated or not with compound A for 3 wk. Each bar represents the mean ± SE of 5–6 animals. *Different from control, P < 0.05.

 

   DISCUSSION
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 DISCLOSURES
 REFERENCES
 
This study assessed the impact of pharmacological inhibition of 11beta-HSD1 on determinants of plasma TG and their metabolic fate under dietary eucaloric conditions. It was found that 11beta-HSD1 robustly lowered fasting triglyceridemia because of decreased liver VLDL-TG output, without any change in plasma TG clearance. A greater proportion of TG-derived fatty acids was, however, directed toward oxidative tissues, in which lipids did not accumulate and were in fact slightly lowered because of increased oxidation. Therefore, 11beta-HSD1 inhibition beneficially impacts liver lipid metabolism, lipemia, and the peripheral metabolic handling of lipids independent of its anorectic action.

A previous study (6) established that long-term activation of the HPA axis, a well-recognized effect of 11beta-HSD1 inhibition (22, 27), did occur even at the low dose of compound A used here; however, terminal levels of corticosterone were unchanged in the present study. Importantly, ingestive behavior was not affected by low-dose 11beta-HSD1 inhibition, contrary to the reduction in food intake observed at higher doses, likely because the inhibitor at low dose failed to antagonize GC production in areas of the central nervous system involved in the regulation of food intake. The metabolic improvements achieved with 11beta-HSD1 inhibition clearly establish that any upward change in systemic GC resulting from increased HPA axis activity is overridden by local tissue inhibition of GC activation.

The reduced fasting triglyceridemia found here in rats treated with the 11beta-HSD1 inhibitor is in line with the improved metabolic profile reported in complete genetic invalidation of the 11beta-HSD1 gene (27, 35, 36). One report ascribed the improved plasma lipid profile of 11beta-HSD1 knockout mice to an amelioration of hepatic lipid metabolism (35); however, the present study extends this notion by directly demonstrating in vivo that reduced VLDL-TG secretion explains the hypotriglyceridemic action of pharmacological inhibition of the enzyme. The study also establishes the as yet untested ability of 11beta-HSD1 inhibition to directly alter liver TG metabolism independent from its anorectic action in rats fed an obesogenic, metabolically deleterious diet. This finding is particularly relevant because reduced caloric intake is in itself an obvious powerful negative modulator of lipemia, and because, to our knowledge, this confounding factor has not been systematically addressed to date in the context of the impact of pharmacological 11beta-HSD1 inhibition on TG metabolism.

The amount of VLDL-TG secreted by the liver is modulated by several factors, one of the most important being the amount of lipids available for VLDL assembly. Modulation of hepatocyte fatty acid channeling to storage or secretory lipid pools and its integration with the synthetic and oxidative fatty acid pathways indeed appear to be key determinants of the ultimate VLDL production rate (30). GC exert several actions on hepatic lipid metabolism, including stimulation of lipogenesis (19, 28) and promotion of VLDL-TG secretion (25, 45). Here we show that, consistent with reduced liver GC availability, 11beta-HSD1 inhibition significantly reduced liver TG content, extending earlier findings obtained in 11beta-HSD1 knockout mice (35). Reduced liver uptake of fatty acids derived from the labeled TG emulsion used here may have contributed to the lowering of hepatic lipid content; however, liver uptake data should be interpreted with caution because several mechanisms independent of TG hydrolysis are involved in the hepatic clearance of such emulsions (38). Also, altered de novo lipogenesis is unlikely to have contributed to the reduction in liver lipid content. Expression levels of key lipogenic and fatty acid esterification genes, including ACS1, FAS, SCD1, GPAT, and DGAT1, were not affected by treatment in the present study (data not shown). In addition, previous work in the 11beta-HSD1 knockout mouse showed either no change (fed and 24-h-fasted states) or an increase (refeeding after 24-h fast, indicating higher insulin sensitivity) in the expression levels of major lipogenic genes (35). Another potential contributor to reduced liver lipid content and VLDL-TG secretion is reduced provision of NEFA from visceral fat to the liver. Although systemic NEFA levels were unaltered by 11beta-HSD1 inhibition in the present study, our previous (6) and other studies (2, 3, 23, 35, 61) have found a modest reduction (~20%) in plasma NEFA. Conversely, adipose overexpression of 11beta-HSD1 was associated with an increase in systemic NEFA that was even more marked in portal blood (33). Given the stimulatory action of GC on adipose lipolysis, these findings suggest a possible contribution of decreased adipose-derived NEFA supply to the reduction in liver lipids associated with 11beta-HSD1 inhibition. Alternatively, the present study clearly supports the likely importance of 11beta-HSD1 inhibition-induced lipid oxidation in the reduction in steatosis. The expression of major genes of fatty acid oxidation, including several peroxisome proliferator-activated receptor-{alpha} targets, was previously shown to be increased in chow-fed 11beta-HSD1 knockout mice (35). The present study confirms and extends these findings by directly demonstrating at the functional level the positive action of 11beta-HSD1 inhibition on liver lipid oxidation, in the setting of diet-induced obesity and without alterations in ingestive behavior.

Clearance of TG from plasma did not appear to contribute to the effects of 11beta-HSD1 inhibition on triglyceridemia in the present conditions. Although with little effect by themselves, GC potentiate the positive modulation of adipose LPL by insulin (5, 18, 39). Our previous study, however, did not reveal any change in adipose tissue TG-derived lipid uptake or LPL activity by 11beta-HSD1 inhibition under the present conditions (6). In addition, complete removal of GC by adrenalectomy has little impact on LPL in oxidative tissues such as skeletal muscle (15, 32), in line with the present study with 11beta-HSD1 inhibition. Although LPL is obviously not the sole determinant of TG clearance, these findings constitute a plausible explanation for the lack of contribution of TG clearance to the hypolipidemic action of 11beta-HSD1 inhibition.

Although TG clearance remained unaltered, 11beta-HSD1 inhibition led to a posthydrolysis increase in TG-derived fatty acid uptake by extrahepatic oxidative tissues, including skeletal muscle, heart, and BAT. Tissue uptake of fatty acids is a complex process involving passive diffusion and facilitated transport by several plasma membrane proteins (9). Because neither TG clearance nor serum NEFA levels were altered by treatment, we sought to determine whether 11beta-HSD1 inhibition affected FABPpm, a binding protein that facilitates the uptake of a large fraction of fatty acids by several organs, including oxidative tissues (7, 21, 52, 53). Although below detection levels in BAT, FABPpm protein content was indeed increased in skeletal muscle and heart of compound A-treated rats relative to controls, suggesting its involvement in the concomitant stimulation of TG-derived fatty acid uptake. Several other fatty acid transport proteins (e.g., FAT/CD36 and FATP1) may conceivably also play a role therein. In a separate study, FAT/CD36 protein in oxidative tissues was found to be unchanged by 11beta-HSD1 inhibition (Berthiaume and Deshaies, unpublished observations); however, this does not rule out possible alterations at the intracellular distribution level. Such transport proteins certainly deserve further investigation, as are the detailed mechanisms by which modulation of GC impacts fatty acid transport.

Notably, increased lipid uptake did not result in lipid accumulation in target tissues because of a concomitant increase in their oxidation. In this context, a close relationship between FABPpm content and tissue oxidative capacity has been described (7, 57) and is further suggested by the present findings. Furthermore, the activity of CPT1, a rate-limiting enzyme in the mitochondrial beta-oxidation pathway (34), tended to be increased in several oxidative tissues. Increased whole body energy expenditure is a feature of the 11beta-HSD1 knockout mouse (36), and the present findings corroborate and broaden this notion by demonstrating that pharmacological 11beta-HSD1 inhibition favors fatty acid oxidation in several tissues. At the low dose of 11beta-HSD1 inhibitor used here it appears, however, that such metabolic changes were too modest to result in a frank, detectable elevation in whole body energy expenditure, as indirectly witnessed by unchanged food efficiency.

Although increased lipid oxidation could conceivably result from indirect endocrine influences from modified metabolism of adipose tissue or liver, the well-established antioxidative action of GC in various tissues suggests a direct involvement of local 11beta-HSD1 inhibition. In skeletal muscle, lipid oxidation is known to be reduced by dexamethasone (26, 29). Muscle oxidative capacity is a better predictor of insulin sensitivity than its TG and fatty acyl-CoA content (11) and may therefore contribute to the improvement in whole body insulin sensitivity associated with 11beta-HSD1 gene knockout or pharmacological inhibition (2, 3, 23, 35, 61). With respect to the heart, the ability of cardiomyocytes to use both circulating corticosterone and 11-dehydrocorticosterone as a source of GC suggests that the heart is under tonic GC control (48). In the present study, heart TG content tended to be slightly reduced by 11beta-HSD1 inhibition in conjunction with increased lipid oxidation; however, whether the latter is beneficial to cardiac metabolism regardless of the prevailing metabolic conditions remains to be established (16). Finally, BAT is a well-established target of GC, where the steroids reduce UCP1 expression and thermogenesis (49, 51). Although lipid oxidation products could not be detected in BAT in the present conditions, TG content was reduced and UCP1 mRNA was nearly doubled in rats treated with compound A, suggesting increased thermogenesis. These findings, observed in the absence of change in food intake, agree well with the 11beta-HSD1–/– mouse model (61). Taken together, these observations support the notion that 11beta-HSD1 inhibition prevents extra-adipose fat accumulation through stimulation of fatty acid oxidation and that, in rodents, it establishes conditions that favor energy dissipation through BAT thermogenesis.

In summary, pharmacological inhibition of 11beta-HSD1 led to a robust reduction in triglyceridemia that was the result of decreased hepatic TG output in the circulation. In addition, 11beta-HSD1 inhibition favored TG-derived fatty acid uptake by oxidative tissues, possibly facilitated by the concomitant increase in FABPpm abundance. Tissue lipid accumulation was, however, prevented because of increased fatty acid oxidation. Therefore, in a rat model of diet-induced obesity, 11beta-HSD1 inhibition exerts beneficial actions both on triglyceridemia and on the metabolic handling of lipids in oxidative tissues. The findings underline the importance of GC action in the deterioration of the metabolic profile associated with diet-induced obesity and demonstrate that 11beta-HSD1 inhibition can lead to metabolic improvement independent of its impact on the central regulation of ingestive behavior.


   GRANTS
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
DISCLOSURES
 REFERENCES
 
This work was supported by a grant from the Canadian Institutes of Health Research (CIHR) to Y. Deshaies. M. Berthiaume was the recipient of a studentship from a CIHR Training in Obesity Program grant.


   DISCLOSURES
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURES
REFERENCES
 
R. Thieringer is employed by Merck Research Laboratories, the manufacturer of Compound A.


   ACKNOWLEDGMENTS
 
We acknowledge the skillful professional assistance of Josée Lalonde, Yves Gélinas, Josée St-Onge, and Sébastien Poulin (Laval University) and the contribution of the following personnel from Merck Research Laboratories, Rahway, NJ: Amanda Makarewicz for the preparation of compound A and Kathy Lyons, Liming Yang, Joseph Metzger, and Hratch Zokian for the background work in support of the studies presented herein.


   FOOTNOTES
 

Address for reprint requests and other correspondence: Y. Deshaies, Laval Hospital Research Center, Faculty of Medicine, Laval Univ., 2725 Ch Sainte-Foy, QC, Canada G1V 4G5 (e-mail: yves.deshaies{at}phs.ulaval.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURES
 REFERENCES
 

  1. Agarwal AK, Monder C, Eckstein B, White PC. Cloning and expression of rat cDNA encoding corticosteroid 11 beta-dehydrogenase. J Biol Chem 264: 18939–18943, 1989.[Abstract/Free Full Text]
  2. Alberts P, Engblom L, Edling N, Forsgren M, Klingstrom G, Larsson C, Ronquist-Nii Y, Ohman B, Abrahmsen L. Selective inhibition of 11beta-hydroxysteroid dehydrogenase type 1 decreases blood glucose concentrations in hyperglycaemic mice. Diabetologia 45: 1528–1532, 2002.[CrossRef][ISI][Medline]
  3. Alberts P, Nilsson C, Selen G, Engblom LO, Edling NH, Norling S, Klingstrom G, Larsson C, Forsgren M, Ashkzari M, Nilsson CE, Fiedler M, Bergqvist E, Ohman B, Bjorkstrand E, Abrahmsen LB. Selective inhibition of 11beta-hydroxysteroid dehydrogenase type 1 improves hepatic insulin sensitivity in hyperglycemic mice strains. Endocrinology 144: 4755–4762, 2003.[Abstract/Free Full Text]
  4. Andrew R, Phillips DI, Walker BR. Obesity and gender influence cortisol secretion and metabolism in man. J Clin Endocrinol Metab 83: 1806–1809, 1998.[Abstract/Free Full Text]
  5. Ashby P, Robinson DS. Effects of insulin, glucocorticoids and adrenaline on the activity of rat adipose-tissue lipoprotein lipids. Biochem J 188: 185–192, 1980.[ISI][Medline]
  6. Berthiaume M, Laplante M, Festuccia W, Gelinas Y, Poulin S, Lalonde J, Joanisse DR, Thieringer R, Deshaies Y. Depot-specific modulation of rat intra-abdominal adipose tissue lipid metabolism by pharmacologic inhibition of 11beta-hydroxysteroid dehydrogenase type 1. Endocrinology 148: 2391–2397, 2007.[Abstract/Free Full Text]
  7. Bonen A, Luiken JJ, Liu S, Dyck DJ, Kiens B, Kristiansen S, Turcotte LP, Van Der Vusse GJ, Glatz JF. Palmitate transport and fatty acid transporters in red and white muscles. Am J Physiol Endocrinol Metab 275: E471–E478, 1998.[Abstract/Free Full Text]
  8. Boscaro M, Barzon L, Fallo F, Sonino N. Cushing's syndrome. Lancet 357: 783–791, 2001.[CrossRef][ISI][Medline]
  9. Bradbury MW. Lipid metabolism and liver inflammation. I. Hepatic fatty acid uptake: possible role in steatosis. Am J Physiol Gastrointest Liver Physiol 290: G194–G198, 2006.[Abstract/Free Full Text]
  10. Brem AS, Bina RB, King T, Morris DJ. Bidirectional activity of 11beta-hydroxysteroid dehydrogenase in vascular smooth muscle cells. Steroids 60: 406–410, 1995.[CrossRef][ISI][Medline]
  11. Bruce CR, Anderson MJ, Carey AL, Newman DG, Bonen A, Kriketos AD, Cooney GJ, Hawley JA. Muscle oxidative capacity is a better predictor of insulin sensitivity than lipid status. J Clin Endocrinol Metab 88: 5444–5451, 2003.[Abstract/Free Full Text]
  12. Bujalska IJ, Kumar S, Stewart PM. Does central obesity reflect "Cushing's disease of the omentum"? Lancet 349: 1210–1213, 1997.[CrossRef][ISI][Medline]
  13. Christy C, Hadoke PW, Paterson JM, Mullins JJ, Seckl JR, Walker BR. 11beta-Hydroxysteroid dehydrogenase type 2 in mouse aorta: localization and influence on response to glucocorticoids. Hypertension 42: 580–587, 2003.[Abstract/Free Full Text]
  14. Colberg SR, Simoneau JA, Thaete FL, Kelley DE. Skeletal muscle utilization of free fatty acids in women with visceral obesity. J Clin Invest 95: 1846–1853, 1995.[ISI][Medline]
  15. Deshaies Y, Dagnault A, Lalonde J, Richard D. Interaction of corticosterone and gonadal steroids on lipid deposition in the female rat. Am J Physiol Endocrinol Metab 273: E355–E362, 1997.[Abstract/Free Full Text]
  16. Dyck JR, Lopaschuk GD. AMPK alterations in cardiac physiology and pathology: enemy or ally? J Physiol Lond 574: 95–112, 2006.[Abstract/Free Full Text]
  17. Folch J, Lees M, Sloane SGH. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226: 497–509, 1957.[Free Full Text]
  18. Fried SK, Russell CD, Grauso NL, Brolin RE. Lipoprotein lipase regulation by insulin and glucocorticoid in subcutaneous and omental adipose tissues of obese women and men. J Clin Invest 92: 2191–2198, 1993.[ISI][Medline]
  19. Glenny HP, Brindley DN. The effects of cortisol, corticotropin and thyroxine on the synthesis of glycerolipids and on the phosphatidate phosphohydrolase activity in rat liver. Biochem J 176: 777–784, 1978.[ISI][Medline]
  20. Gu X, Dragovic J, Koo GC, Koprak SL, LeGrand C, Mundt SS, Shah K, Springer MS, Tan EY, Thieringer R, Hermanowski-Vosatka A, Zokian HJ, Balkovec JM, Waddell ST. Discovery of 4-heteroarylbicyclo[2.22]octyltriazoles as potent and selective inhibitors of 11beta-HSD1: novel therapeutic agents for the treatment of metabolic syndrome. Bioorg Med Chem Lett 15: 5266–5269, 2005.[CrossRef][Medline]
  21. Hajri T, Abumrad NA. Fatty acid transport across membranes: relevance to nutrition and metabolic pathology. Annu Rev Nutr 22: 383–415, 2002.[CrossRef][ISI][Medline]
  22. Harris HJ, Kotelevtsev Y, Mullins JJ, Seckl JR, Holmes MC. Intracellular regeneration of glucocorticoids by 11beta-hydroxysteroid dehydrogenase (11beta-HSD)-1 plays a key role in regulation of the hypothalamic-pituitary-adrenal axis: analysis of 11beta-HSD-1-deficient mice. Endocrinology 142: 114–120, 2001.[Abstract/Free Full Text]
  23. Hermanowski-Vosatka A, Balkovec JM, Cheng K, Chen HY, Hernandez M, Koo GC, Le Grand CB, Li Z, Metzger JM, Mundt SS, Noonan H, Nunes CN, Olson SH, Pikounis B, Ren N, Robertson N, Schaeffer JM, Shah K, Springer MS, Strack AM, Strowski M, Wu K, Wu T, Xiao J, Zhang BB, Wright SD, Thieringer R. 11beta-HSD1 inhibition ameliorates metabolic syndrome and prevents progression of atherosclerosis in mice. J Exp Med 202: 517–527, 2005.[Abstract/Free Full Text]
  24. Hultin M, Carneheim C, Rosenqvist K, Olivecrona T. Intravenous lipid emulsions: removal mechanisms as compared to chylomicrons. J Lipid Res 36: 2174–2184, 1995.[Abstract]
  25. Klausner H, Heimberg M. Effect of adrenalcortical hormones on release of triglycerides and glucose by liver. Am J Physiol 212: 1236–1246, 1967.[Free Full Text]
  26. Korach-Andre M, Gao J, Gounarides JS, Deacon R, Islam A, Laurent D. Relationship between visceral adiposity and intramyocellular lipid content in two rat models of insulin resistance. Am J Physiol Endocrinol Metab 288: E106–E116, 2005.[Abstract/Free Full Text]
  27. Kotelevtsev Y, Holmes MC, Burchell A, Houston PM, Schmoll D, Jamieson P, Best R, Brown R, Edwards CR, Seckl JR, Mullins JJ. 11beta-Hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci USA 94: 14924–14929, 1997.[Abstract/Free Full Text]
  28. Lehtonen MA, Savolainen MJ, Hassinen IE. Hormonal regulation of hepatic soluble phosphatidate phosphohydrolase. Induction by cortisol in vivo and in isolated perfused rat liver. FEBS Lett 99: 162–166, 1979.[CrossRef][ISI][Medline]
  29. Letteron P, Brahimi-Bourouina N, Robin MA, Moreau A, Feldmann G, Pessayre D. Glucocorticoids inhibit mitochondrial matrix acyl-CoA dehydrogenases and fatty acid beta-oxidation. Am J Physiol Gastrointest Liver Physiol 272: G1141–G1150, 1997.[Abstract/Free Full Text]
  30. Lewis GF. Fatty acid regulation of very low density lipoprotein production. Curr Opin Lipidol 8: 146–153, 1997.[ISI][Medline]
  31. Livingstone DE, Jones GC, Smith K, Jamieson PM, Andrew R, Kenyon CJ, Walker BR. Understanding the role of glucocorticoids in obesity: tissue-specific alterations of corticosterone metabolism in obese Zucker rats. Endocrinology 141: 560–563, 2000.[Abstract/Free Full Text]
  32. Mantha L, Palacios E, Deshaies Y. Modulation of triglyceride metabolism by glucocorticoids in diet-induced obesity. Am J Physiol Regul Integr Comp Physiol 277: R455–R464, 1999.[Abstract/Free Full Text]
  33. Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR, Flier JS. A transgenic model of visceral obesity and the metabolic syndrome. Science 294: 2166–2170, 2001.[Abstract/Free Full Text]
  34. McGarry JD, Brown NF. The mitochondrial carnitine palmitoyltransferase system. From concept to molecular analysis. Eur J Biochem 244: 1–14, 1997.[ISI][Medline]
  35. Morton NM, Holmes MC, Fievet C, Staels B, Tailleux A, Mullins JJ, Seckl JR. Improved lipid and lipoprotein profile, hepatic insulin sensitivity, and glucose tolerance in 11beta-hydroxysteroid dehydrogenase type 1 null mice. J Biol Chem 276: 41293–41300, 2001.[Abstract/Free Full Text]
  36. Morton NM, Paterson JM, Masuzaki H, Holmes MC, Staels B, Fievet C, Walker BR, Flier JS, Mullins JJ, Seckl JR. Novel adipose tissue-mediated resistance to diet-induced visceral obesity in 11beta-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes 53: 931–938, 2004.[Abstract/Free Full Text]
  37. Napolitano A, Voice MW, Edwards CR, Seckl JR, Chapman KE. 11beta-Hydroxysteroid dehydrogenase 1 in adipocytes: expression is differentiation-dependent and hormonally regulated. J Steroid Biochem Mol Biol 64: 251–260, 1998.[CrossRef][ISI][Medline]
  38. Olivecrona G, Olivecrona T. Clearance of artificial triacylglycerol particles. Curr Opin Clin Nutr Metab Care 1: 143–151, 1998.[CrossRef][Medline]
  39. Ottosson M, Vikman-Adolfsson K, Enerback S, Olivecrona G, Bjorntorp P. The effects of cortisol on the regulation of lipoprotein lipase activity in human adipose tissue. J Clin Endocrinol Metab 79: 820–825, 1994.[Abstract]
  40. Otway S, Robinson DS. The use of a non-ionic detergent (Triton WR 1339) to determine rates of triglyceride entry into the circulation of the rat under different physiological conditions. J Physiol Lond 190: 321–332, 1967.[Abstract/Free Full Text]
  41. Paterson JM, Morton NM, Fievet C, Kenyon CJ, Holmes MC, Staels B, Seckl JR, Mullins JJ. Metabolic syndrome without obesity: Hepatic overexpression of 11beta-hydroxysteroid dehydrogenase type 1 in transgenic mice. Proc Natl Acad Sci USA 101: 7088–7093, 2004.[Abstract/Free Full Text]
  42. Peeke PM, Chrousos GP. Hypercortisolism and obesity. Ann NY Acad Sci 771: 665–676, 1995.[Abstract]
  43. Phillips DI, Barker DJ, Fall CH, Seckl JR, Whorwood CB, Wood PJ, Walker BR. Elevated plasma cortisol concentrations: a link between low birth weight and the insulin resistance syndrome? J Clin Endocrinol Metab 83: 757–760, 1998.[Abstract/Free Full Text]
  44. Picard F, Naïmi N, Richard D, Deshaies Y. Response of adipose tissue lipoprotein lipase to the cephalic phase of insulin secretion. Diabetes 48: 452–459, 1999.[Abstract]
  45. Reaven EP, Kolterman OG, Reaven GM. Ultrastructural and physiological evidence for corticosteroid-induced alterations in hepatic production of very low density lipoprotein particles. J Lipid Res 15: 74–83, 1974.[Abstract]
  46. Rosmond R, Dallman MF, Bjorntorp P. Stress-related cortisol secretion in men: relationships with abdominal obesity and endocrine, metabolic and hemodynamic abnormalities. J Clin Endocrinol Metab 83: 1853–1859, 1998.[Abstract/Free Full Text]
  47. Seckl JR, Walker BR. Minireview: 11beta-hydroxysteroid dehydrogenase type 1: a tissue-specific amplifier of glucocorticoid action. Endocrinology 142: 1371–1376, 2001.[Abstract/Free Full Text]
  48. Sheppard KE, Autelitano DJ. 11beta-Hydroxysteroid dehydrogenase 1 transforms 11-dehydrocorticosterone into transcriptionally active glucocorticoid in neonatal rat heart. Endocrinology 143: 198–204, 2002.[Abstract/Free Full Text]
  49. Soumano K, Desbiens S, Rabelo R, Bakopanos E, Camirand A, Silva JE. Glucocorticoids inhibit the transcriptional response of the uncoupling protein-1 gene to adrenergic stimulation in a brown adipose cell line. Mol Cell Endocrinol 165: 7–15, 2000.[CrossRef][ISI][Medline]
  50. Stewart PM, Boulton A, Kumar S, Clark PM, Shackleton CH. Cortisol metabolism in human obesity: impaired cortisone->cortisol conversion in subjects with central adiposity. J Clin Endocrinol Metab 84: 1022–1027, 1999.[Abstract/Free Full Text]
  51. Strack AM, Bradbury MJ, Dallman MF. Corticosterone decreases nonshivering thermogenesis and increases lipid storage in brown adipose tissue. Am J Physiol Regul Integr Comp Physiol 268: R183–R191, 1995.[Abstract/Free Full Text]
  52. Stremmel W. Fatty acid uptake by isolated rat heart myocytes represents a carrier-mediated transport process. J Clin Invest 81: 844–852, 1988.[ISI][Medline]
  53. Stremmel W, Strohmeyer G, Berk PD. Hepatocellular uptake of oleate is energy dependent, sodium linked, and inhibited by an antibody to a hepatocyte plasma membrane fatty acid binding protein. Proc Natl Acad Sci USA 83: 3584–3588, 1986.[Abstract/Free Full Text]
  54. Stremmel W, Theilmann L. Selective inhibition of long-chain fatty acid uptake in short-term cultured rat hepatocytes by an antibody to the rat liver plasma membrane fatty acid-binding protein. Biochim Biophys Acta 877: 191–197, 1986.[Medline]
  55. Tannin GM, Agarwal AK, Monder C, New MI, White PC. The human gene for 11beta-hydroxysteroid dehydrogenase. Structure, tissue distribution, and chromosomal localization. J Biol Chem 266: 16653–16658, 1991.[Abstract/Free Full Text]
  56. Tomlinson JW, Stewart PM. Cortisol metabolism and the role of 11beta-hydroxysteroid dehydrogenase. Best Pract Res Clin Endocrinol Metab 15: 61–78, 2001.[CrossRef][Medline]
  57. Turcotte LP, Srivastava AK, Chiasson JL. Fasting increases plasma membrane fatty acid-binding protein (FABPPM) in red skeletal muscle. Mol Cell Biochem 166: 153–158, 1997.[CrossRef][ISI][Medline]
  58. Turcotte LP, Swenberger JR, Tucker MZ, Yee AJ, Trump G, Luiken JJ, Bonen A. Muscle palmitate uptake and binding are saturable and inhibited by antibodies to FABPPM. Mol Cell Biochem 210: 53–63, 2000.[CrossRef][ISI][Medline]
  59. Walker BR, Soderberg S, Lindahl B, Olsson T. Independent effects of obesity and cortisol in predicting cardiovascular risk factors in men and women. J Intern Med 247: 198–204, 2000.[CrossRef][ISI][Medline]
  60. Walker BR, Yau JL, Brett LP, Seckl JR, Monder C, Williams BC, Edwards CR. 11beta-Hydroxysteroid dehydrogenase in vascular smooth muscle and heart: implications for cardiovascular responses to glucocorticoids. Endocrinology 129: 3305–3312, 1991.[Abstract]
  61. Wang SJ, Birtles S, de Schoolmeester J, Swales J, Moody G, Hislop D, O'Dowd J, Smith DM, Turnbull AV, Arch JR. Inhibition of 11beta-hydroxysteroid dehydrogenase type 1 reduces food intake and weight gain but maintains energy expenditure in diet-induced obese mice. Diabetologia 49: 1333–1337, 2006.[CrossRef][ISI][Medline]
  62. Wolf G. Glucocorticoids in adipocytes stimulate visceral obesity. Nutr Rev 60: 148–151, 2002.[CrossRef][ISI][Medline]
  63. Xia Z, Stanhope KL, Digitale E, Simion OM, Chen L, Havel P, Cianflone K. Acylation-stimulating protein (ASP)/complement C3adesArg deficiency results in increased energy expenditure in mice. J Biol Chem 279: 4051–4057, 2004.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J EndocrinolHome page
D. P Macfarlane, S. Forbes, and B. R Walker
Glucocorticoids and fatty acid metabolism in humans: fuelling fat redistribution in the metabolic syndrome
J. Endocrinol., May 1, 2008; 197(2): 189 - 204.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
A. M. Nuotio-Antar, D. L. Hachey, and A. H. Hasty
Carbenoxolone treatment attenuates symptoms of metabolic syndrome and atherogenesis in obese, hyperlipidemic mice
Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1517 - E1528.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/E1045    most recent
00276.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager