AJP - Endo Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 293: E1021-E1029, 2007. First published July 24, 2007; doi:10.1152/ajpendo.00003.2007
0193-1849/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/E1021    most recent
00003.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hsu, S.-H.
Right arrow Articles by Luo, C.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hsu, S.-H.
Right arrow Articles by Luo, C.-W.

Molecular dissection of G protein preference using Gs{alpha} chimeras reveals novel ligand signaling of GPCRs

Shih-Han Hsu and Ching-Wei Luo

Department of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Taipei, Taiwan

Submitted 3 January 2007 ; accepted in final form 24 July 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Although only 16 genes have been identified in mammals, several G{alpha} subunits can be simultaneously activated by G protein-coupled receptors (GPCRs) to modulate their complicated functions. Current GPCR assays are limited in the evaluation of selective G{alpha} activation, thus not allowing a comprehensive pathway screening. Because adenylyl cyclases are directly activated by Gs{alpha} and the carboxyl termini of the various G{alpha} proteins determine their receptor coupling specificity, we proposed a set of chimeric Gs{alpha} where the COOH-terminal five amino acids are replaced by those of other G{alpha} proteins and used these to dissect the potential G{alpha} linked to a given GPCR. Unlike Gq{alpha}, G12{alpha}, and Gi{alpha} outputs, compounding the signals from several G{alpha} members, the chimeric Gs{alpha} proteins provide a superior molecular approach that reflects the previously uncharacterized pathways of GPCRs under the same cAMP platform. This is, to our knowledge, the first time allowing verification of the whole spectrum of G{alpha} coupling preference of adenosine A1 receptor, reported to couple to multiple G proteins and modulate many physiological processes. Furthermore, we were able to distinguish the uncharacterized pathways between the two neuromedin U receptors (NMURs), which distribute differently but are stimulated by a common agonist. In contrast to the Gq signals mainly conducted by NMUR1, NMUR2 routed preferentially to the Gi pathways. Dissecting the potential G{alpha} coupling to these GPCRs will promote an understanding of their physiological roles and benefit the pharmaceutical development of agonists/antagonists by exploiting the selective affinity toward a certain G{alpha} subclass.

G protein-coupled receptor; chimeric G protein; G{alpha}; Gs


G PROTEIN-COUPLED RECEPTORS (GPCRs) represent the largest family of cell membrane receptors and are characterized by a distinctive seven-transmembrane configuration. The ligands of GPCRs are highly diverse including photon, Ca2+, odorants, amino acids, nucleotides, fatty acid derivatives, peptides, and large proteins (5, 39). Despite their wide ligand diversity, activated GPCRs mainly interact with the G{alpha} subunits of heterotrimeric G proteins for signal transduction to effectors (13, 31). Currently, 16 G{alpha} subunits capable of activating diverse signaling pathways have been identified (7, 32). Based on sequence similarity, the G{alpha} subunits can be divided into four subfamilies, Gs, Gi, G12, and Gq. Each subfamily contains several closely related isotypes. The Gs family, named for their ability to stimulate adenylyl cyclase isoforms, consists of Gs and Golf. Members of the Gi subfamily, made up of Gi1, Gi2, Gi3, Go, Gz, Gt1, Gt2, and Ggust, are involved in many functions including the inhibition of adenylyl cyclases. The G12 family, consisting of G12 and G13, activates the small G protein Rho pathways. The Gq family, including Gq, G11, G14, and G16, is linked to the stimulation of phospholipase Cbeta (PLCbeta) isoforms that trigger the Ca2+ signal cascade (7, 31).

As part of GPCR screening, many attempts have been made to design universal outputs so that any ligand-GPCR response can be screened at a common end point. Although several assays have been established, most of them are limited to the evaluation of a selective G{alpha} subfamily and thus do not allow a comprehensive screening of orphan GPCRs that do not have a known downstream signaling pathway. Interestingly, it has been shown that pertussis toxin prevents some Gi members from interacting with GPCRs by ADP ribosylating the Cys residue at the COOH-terminal fourth position (40). This early clue led to the discovery that the COOH-terminal region of the G{alpha} subunit dictates the specificity of interaction with receptors (8, 9). Several chimeras using the Gq backbone with Gi COOH-terminal replacements have offered convenient assays for Gi-coupled GPCRs to overcome the difficulty and low sensitivity of traditional Gi assays during the large-scale screening (41). Furthermore, a series of chimeras incorporating different length of the Gz COOH terminus into the backbone of G16 have also been designed for ligand screening (26). Nevertheless, despite the promiscuous characteristics of G16 to interact with a variety of GPCRs, many GPCRs have failed to activate G16 or its chimeras (26). Therefore, until now, no single G{alpha} or chimera can truly couple to all the different receptors. The unique characteristic of each G{alpha} COOH terminus, providing a limited range on receptor selectivity, suggests that it is necessary to screen the whole G{alpha} spectrum when studying an orphan GPCR without known G{alpha} pathways.

In addition, it has been known that an activated GPCR can couple to several G{alpha} proteins simultaneously (29). However, current Gq, G12, and Gi readouts are only able to reflect the compound responses shared by several G{alpha} members in the same family or across subfamilies and are inadequate to dissect the GPCR responses into each individual G{alpha}. In contrast, a cAMP increase resulting from the stimulation of adenylyl cyclases has been set up as a direct effect of the Gs{alpha}. Therefore, we hypothesized that the Gs pathway would be a superior system if designed to dissect and screen GPCR signals. To further cover the COOH-terminal varieties of the different G{alpha} subfamilies, a set of chimeric Gs proteins where the COOH termini were replaced with those of other known G{alpha} for diverse GPCR interactions were constructed. We showed that these chimeras were able to reveal previously unknown G protein-coupled pathways for a given GPCR with a known ligand. Moreover, the present chimeric G proteins are able to serve as a tool to investigate the potential G protein pathways of orphan GPCRs, thus allowing the future screening of candidate ligands.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents and hormones. Dulbecco's modified Eagle's medium-F12 and Opti-MEM were obtained from GIBCO-BRL (Gaithersburg, MD). L-Glutamine, penicillin, and streptomycin were purchased from BioWhittaker (Walkersville, MD). Human neuromedin U-25 (hNMU-25) was purchased from Phoenix Pharmaceuticals (Belmont, CA). Mouse anti-hemagglutinin antibodies were from Roche Diagnostics (Mannheim, Germany). R(–)N6-(2-phenylisopropyl)adenosine (R-PIA), bovine serum albumin, forskolin, 3-isobutyl-1-methylxanthine, thrombin and other chemicals unless noted were obtained from Sigma Chemical (St. Louis, MO). R-PIA (1 mM) was prepared in dimethyl sulfoxide, whereas hNMU-25 and thrombin (300 µM) were prepared in phosphate-buffered saline (GIBCO-BRL) as stocks. A dilution series of each ligand was made using the reaction assay buffer before use.

Construction of GPCRs and chimeric G protein plasmids. Human adenosine A1 receptor (AA1R; NM_000674), proteinase-activated receptor-1 (PAR-1; NM_001992), neuromedin U receptor-1 (NMUR1; NM_006056), and neuromedin U receptor-2 (NMUR2; NM_020167) cDNAs were amplified from human brain, ovary, placenta, and brain cDNA (Clontech, Palo Alto, CA), respectively. The products were subcloned into the pcDNA3.1/Zeo(+) expression vector (Invitrogen Life Technologies, Carlsbad, CA) after sequence confirmation. Rat Gs{alpha} with an internal hemagglutinin epitope tag (77DVPDYA81) in pcDNA1 (9), a gift from Dr. B. R. Conklin, was used as a template to replace its COOH-terminal five amino acids with those of other G{alpha} by the PCR-based mutagenesis. The PCR products were subcloned into the pcDNA3.1/Zeo(+) expression vector, and the sequences were then confirmed. The reversed primer sequences corresponding to mutated five amino acids were as follows: GAAGAGGCCACAGTC for Gsi/t/g, ATAAAGTCCACATTC for Gsi3, GATCAAGCCACAGCC for Gso; GCAAAGGCCGATGTA for Gsz; CTGCAGCATGATATC for Gs12; CTGTAGCATAAGCTG for Gs13, CACCAGATTGTACTC for Gsq/11, GACAAGGTTGAATTC for Gs14, CAGCAGGTTGATCTC for Gs16, CAGCAGGTTGATCTCGTC for Gs16-6, and TTCGTAGAGATTGAC for Gsc.

Protein detection and measurement of potential activities of chimeric Gs proteins. To test the expression levels of the various chimeric G proteins, equivalent numbers (2 x 106) of various chimeric Gs (1 µg/ml)-transfected cells were lysed in the protein sample buffer. Measurement of the protein content was done using a Micro BCA protein assay kit (Pierce Biotechnology, Rockford, IL). A 50-µg aliquot of each sample was analyzed by running a 12% SDS-PAGE. Western blotting was performed using mouse anti-hemagglutinin antibodies (Roche) or mouse anti-human beta-actin (Chemicon International, Temecula, CA) followed by horseradish peroxidase-linked anti-mouse antibodies (Amersham Biosciences, Piscataway, NJ).

To demonstrate that all of the chimeric G proteins are able to activate adenylyl cyclases to the same degree, the chimeric G protein-transfected cells were further treated with or without AlF4 (50 µM AlCl3, 10 mM MgCl2, and 5 mM NaF) for 8 h (37). The cAMP amounts were measured in triplicate using a specific RIA (23). Antibodies against cAMP were provided by the National Pituitary and Hormone Program.

Assessment of receptor activities based on cAMP production or inhibition or reporter gene activity. To assess the receptor activity stimulated by its corresponding agonists, confluent 293T cells in a 12-well plate were cotransfected with a receptor construct (1 µg/well) together with each individual chimeric Gs plasmid (30 ng/well) using LipofectAMINE 2000 (Invitrogen Life Technologies). A 33:1 plasmid ratio was chosen on the basis of the cAMP basal levels derived from transfected Gs chimeras and the standard range of the cAMP RIA assay. To monitor the receptor-chimeric G protein coupling efficiency, receptor plasmids (1 µg/well) together with increasing concentrations of chimeric Gs constructs were used for the transfection. In addition, a certain amount of mock vector [pcDNA3.1/Zeo(+)] was also added to maintain equal amounts of plasmids in each transfection. Then, 24 h after transfection, the cells were harvested using the cAMP assay buffer (DMEM-F12 supplemented with 0.1% bovine serum albumin and 0.25 mM 3-isobutyl-1-methylxanthine) and seeded onto a 24-well plate (2 x 105 viable cells/ml). The transfected cells were then treated with different ligands for 8 h before measurement of the total cAMP levels in triplicate (23).

For measuring cAMP amounts inhibited by the Gi{alpha} pathways, NMUR1- or NMUR2-transfected 293T cells were resuspended in the cAMP assay buffer and seeded into a 24-well plate (2 x 105 cells/well). The cells were preincubated with 100 nM hNMU-25 for 30 min and then stimulated by 1 µM forskolin for 30 min. The cell medium was acetylated immediately, and this was followed by cAMP measurement in triplicates (23).

For testing signal transduction mediated by the serum response element (SRE), 293T cells were cotransfected with an SRE-driven luciferase (SRE-Luc) reporter construct (Stratagene, La Jolla, CA) together with the NMUR1 or NMUR2 construct in the ratio 1:2. One day after transfection, cells were resuspended in DMEM-/F12 supplemented with 0.1% bovine serum albumin (5 x 105 viable cells/ml) and treated with increasing doses of hNMU-25 for 16 h. Cells were harvested in the lysis buffer (Promega, Madison, WI), and the lysate was analyzed for luciferase activity using a luminometer (Bio-Rad Laboratories, Hercules, CA). Data are means ± SE of triplicates (42).

Assessing the tissue distribution of two NMURs. To analyze NMUR1 and NMUR2 mRNA expression, tissues were collected from four adult Sprague-Dawley rats, and total RNA was extracted using an RNeasy minikit (Qiagen Sciences, Valencia, CA). Total RNA from each sample was reverse transcribed for later PCR analysis. The specific primers were as follows: NMUR1 forward, GGCTTCAGTGCTCAATGTCA; NMUR1 reverse, TAGCATCTTGGTCACCTGTC; NMUR2 forward, AAGTACTTGAACAGCACAGAGGAGT; NMUR2 reverse, AGCTTGGATGATCAAGTTATACACC; beta-actin forward, TGACAGACTACCTCATGAAGATCC; beta-actin reverse, CTGCTTGCTGATCCACATCTG.

Data analysis. The cAMP data are presented as means ± SE of triplicate measurements of triplicate cultures. The arbitrary units of luciferase activity varied between experiments and are presented as means ± SD of triplicate determinations of a single experiment; two extra experiments showed similar results. Statistical significance was determined by ANOVA for multiple group comparisons. Significance was accepted at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Hypothesis of the chimeric G protein array and design of the Gs{alpha} chimeras. G proteins have been classified into four subfamilies by their {alpha}-subunit composition: Gs, Gi, G12, and Gq. Because of the diverse effectors for each subfamily (Fig. 1A, top), several distinct assays are needed to evaluate the different downstream pathways for a given GPCR (3, 31, 32). In addition, concerns have been raised as to the choice of the wrong analytic approaches when monitoring an unknown GPCR response. Gs{alpha} but not any other G{alpha} directly activates adenylyl cyclases. Furthermore, the carboxyl termini of different G{alpha} subunits determine the specificity of receptor coupling (8, 9). Based on these two facts, Gs{alpha} was chosen as a backbone to produce a set of chimeric Gs{alpha} expression vectors with various COOH-terminal replacements. We hypothesized that these Gs{alpha} chimeras would redirect the different G{alpha} pathways toward cAMP production. These Gs{alpha} chimeras would then allow one to dissect the ligand signaling for any given GPCR by simply measuring cAMP production (Fig. 1A, bottom).


Figure 1
View larger version (39K):
[in this window]
[in a new window]

 
Fig. 1. Hypothesis of the chimeric G protein array and design of the chimeric Gs{alpha} constructs. A: after G protein-coupled receptors (GPCRs) are activated, the corresponding G{alpha} subunits couple to the receptors using their COOH-terminal 5 amino acids as the interacting motif (8). Top: effectors for the signaling responses vary with the various G{alpha} subunits that are activated. GEF, guanine-nucleotide exchange factor. Bottom: a set of Gs{alpha} chimeras (designated as Gsx, with x denoting the COOH-terminal origins from different G proteins where the COOH-terminal 5 amino acids were replaced by those of other G{alpha} was constructed to couple to diverse GPCRs, thus allowing switching of all receptor responses into the production of cAMP. This system can be used as a screening array for any given GPCR by simply measuring the cAMP accumulation under various stimulations (S1-Sn). B: alignment of COOH-terminal 5 amino acid sequences of G{alpha} subunits sorted by their subfamilies. Gsc, with the COOH-terminal sequence derived from the Gq but in random order, serves as a control chimera. Expression levels of the chimeric G proteins were determined by Western blotting using antibodies against the hemagglutinin tag on Gs{alpha}. Western blotting against human beta-actin served as a loading control. Each of the Gsx-transfected cells was further treated with AlF 5 and fold increases of cAMP production were compared.

 
To prove our hypothesis, we constructed a set of chimeric Gs{alpha} proteins where the COOH-terminal five residues were replaced with those of other kinds. As shown in Fig. 1B, the chimera for the Gs family, which contains Gs and Golf, was designated Gs/olf because of the identical COOH-terminal five residues between Gs and Golf. Also, the chimeras for the Gi family were designated Gsi/t/g (Gi1, Gi2, Gt1, Gt2, and Ggust share the same COOH-terminal motif), Gsi3, Gso,and Gsz. The chimeras for the G12 family included Gs12 and Gs13, whereas the chimeras for the Gq family contained Gsq/11 (Gq and G11 share the same COOH-terminal motif), Gs14, and Gs16. In addition, a control chimera, Gsc, with the COOH-terminal five amino acids of Gq in random order was designed to demonstrate the specificity of interaction between the COOH terminus of chimeric G{alpha} and receptors. Each construct was transiently transfected into 293T cells individually, and the expression levels of chimeric G proteins were determined (Fig. 1B). Compared with the loading control beta-actin, all the Gs chimeras were expressed at comparable levels except for the mock vector control. In addition, compared with the basal cAMP levels, the AlF4 treatment increased cAMP production to a similar extent in each chimeric G protein-transfected cells (Fig. 1B, right). These data suggest that all of the chimeric G proteins are able to activate adenylyl cyclases to the same degree.

Functional coupling of constructed chimeras to Gi-, G12-, and Gq-coupled GPCRs. To demonstrate the functional coupling of chimeric Gs proteins to receptors, we transiently coexpressed either Gsi/t/g, Gs12, or Gsq/11 chimera with a selected receptor, AA1R, PAR-1, or NMUR1, which have been reported to be able to couple to the Gi (20), G12 (30), or Gq (16) family, respectively (Fig. 2). In 293T cells cotransfected with AA1R and Gsi/t/g, R-PIA agonist treatment resulted in a dose-dependent accumulation of cAMP (Fig. 2A). In contrast, R-PIA had no effect on cells transfected with AA1R only, AA1R with Gsc (Fig. 2A), or Gsi/t/g only (data not shown), indicating that there was a successful coupling of the Gsi/t/g chimera to the Gi-coupled receptor. To assess the coupling efficiency between Gsi/t/g and AA1R, cells were cotransfected with constant amounts of AA1R and graded doses of Gsi/t/g. The total amounts of plasmids used for transfection were adjusted to be equal, using a mock plasmid. The total cAMP concentrations in the samples with or without R-PIA (100 nM) stimulation were compared. As shown in Fig. 2B, an increase in basal cAMP was seen, corresponding to the transfected amount of Gsi/t/g. In the 0.01–0.3 µg/ml range of Gsi/t/g, there was an increase of cAMP amount in the agonist-stimulated cells of 8.9 ± 0.4-fold compared with cells without agonist treatment. The decrease in agonist-induced cAMP levels that occurred at the 1 µg/ml Gsi/t/g point may be a result of the high cAMP background caused by overexpression of Gsi/t/g (Fig. 2B). Therefore, in the following experiments for receptor pathway screening, a 33:1 plasmid ratio of GPCR to chimeric Gs{alpha} was used in consideration of the cAMP basal levels and unpredictable effects that occurred due to overexpression of Gs chimeras.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 2. Concentration-response curves of increasing ligands (A, C, and E) and increasing chimeric G proteins (B, D, and F) during stimulation of cAMP production by selected receptors. Gi-coupled AA1R (adenosine A1 receptor; A and B), G12-coupled PAR-1 (proteinase-activated receptor-1; C and D), and Gq-coupled NMUR1 (neuromedin U receptor-1; E andF) were chosen to evaluate functional couplings of chimeric Gsi/t/g, Gs12 and Gsq/11, respectively. R-PIA, R(–)N6-(2-phenylisopropyl) adenosine. To assess the concentration-associated response of the corresponding agonists, 293T cells were transfected with 1 µg/ml receptor in the presence or absence of 30 ng/ml chimeric G protein. After 24-h transfection, cells were treated with increasing amounts of ligands and then assayed for cAMP. In addition, cells cotransfected with receptors and Gsc were also stimulated with 100 nM agonist as a coupling control. To determine how coupling efficiency varied with graded doses of chimeric G proteins, 293T cells were cotransfected with the given receptor (1 µg/ml) and increasing doses of chimeric G proteins (0–1 µg/ml). Amount of cAMP present was then determined after treatments with 100 nM of corresponding agonists or with cAMP assay buffer (buffer) only. Data are expressed as means of triplicates in 3 experiments ± SE.

 
PAR-1 and NMUR1 are known to be able to couple to the G12 and Gq pathways, respectively. Compared with receptor only, PAR-1 in the presence of Gs12 or NMUR1 in the presence of Gsq/11 can efficiently stimulate adenylyl cyclase activity in response to increasing concentrations of the corresponding agonists (Fig. 2, C and E). Interestingly, no cAMP stimulation was observed in cells cotransfected with Gsc and either receptor (Fig. 2, C and E). The control Gsc chimera is a functional construct because of its normal expression in the Gsc-transfected cells (Fig. 1B) and the increasing cAMP background in cells transfected with graded amounts of Gsc (data not shown). Therefore, these results suggest that the agonist-stimulated adenylyl cyclase activation is drawn from a specific coupling between the receptors and designed COOH termini of the chimeric Gs proteins and are not because of the side reactions forced by the overexpression of either the receptors or the Gs chimeras. In addition, the fold increase of cAMP production after agonist stimulation was reproducible in the 0.01–0.3 µg/ml range of each chimeric G{alpha} construct (Fig. 2, D and F).

On the basis of sequence alignment, the sixth residue at the COOH termini of the different G{alpha} proteins is either Arg in Gs, Go, and G14 or Lys in Golf, Gi1, Gi2, Gi3, Gz, Gt1, Gt2, Ggust, G12, G13, Gq, and G11, except for Asp in G16. To further identify whether the charge effect of Asp at the sixth residue of G16 terminus might affect the receptor coupling, two Gs16 chimeras with the Gs COOH-terminal five-residue replacements, designated Gs16, or six-residue replacements, designated Gs16-6, were constructed. G16 belongs to the Gq family. Therefore, NMUR1, which is known to conduct Ca2+ signals by activating PLCbeta, was used for the coupling tests. In cells transfected with NMUR1 and graded doses of either Gs16 or Gs16-6, increases in the cAMP basal levels were observed (Fig. 3). However, in contrast to the cAMP background in cells without agonist stimulation, hNMU-25 elevated cAMP about sixfold in cells expressing NMUR1 and Gs16 (Fig. 3A) as opposed to a less than 2.5-fold cAMP increase in cells expressing NMUR1 and Gs16-6 (Fig. 3B) in the 0.01–0.3 µg/ml range of the chimeric G protein constructs. These results suggest that more extensive replacements beyond the fifth position of Gs{alpha} COOH terminus do not further increase the coupling efficiency between G{alpha} proteins and corresponding receptors. Thus, the charge characteristics of the sixth residue at the Gs{alpha} COOH terminus may be involved in receptor interaction, maintenance of the Gs{alpha} conformation, or a yet unknown structural function(s).


Figure 3
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 3. Comparison of pathway switching ability between Gs16 and Gs16-6 using NMUR1-transfected cells. 293T cells were cotransfected with NMUR1 and graded doses of Gs16 (A) or Gs16-6 (B). The cAMP concentration in medium was determined after treatment with 100 nM hNMU-25 or with cAMP assay buffer (buffer) only. Data are shown as means ± SE; n = 3.

 
Evaluation of AA1R coupling pathways using the chimeric G proteins. AA1R has been cloned and studied for more than 15 years, and its downstream coupling pathways have been well characterized (20). Therefore, we chose AA1R to verify the ability and specificity of the Gs chimeras for revealing G protein coupling preference. AA1R is known to be an adenylyl cyclase-inhibiting receptor that decreases cAMP production under cognate ligand stimulation (20). Of interest, our data showed that the agonist R-PIA increased cAMP production in cells cotransfected with AA1R and various Gs chimeras except wild-type Gs/olf (Fig. 4) and Gsc (Fig. 2A), suggesting that there is specific coupling between AA1R and other chimeric Gs proteins.


Figure 4
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 4. Effects of various Gs chimeras when directing AA1R action toward cAMP production. Production of cAMP in cells cotransfected with AA1R and various Gs chimeras individually was measured in the absence or presence of 100 nM R-PIA agonist. Data are expressed as fold increases in cAMP using the cAMP amount in cells without agonist stimulation as the onefold control. Data are shown as means ± SE; n = 3. *Significant difference from onefold control without stimulation (ANOVA, P < 0.05).

 
In the chimeric Gsi family, our studies showed that there was an increase in cAMP production in cells cotransfected with AA1R and Gsi/t/g, Gsi3, Gso, or Gsz of 8.9-, 8.0-, 3.9-, and 3.6-fold, respectively (Fig. 4). In the chimeric Gs12 family, cells coexpressing AA1R and either Gs12 or Gs13, cAMP were increased 6.5- and 3.7-fold, respectively, after agonist stimulation. In addition to inhibiting cAMP accumulation, AA1R is also known to stimulate PLCbeta activity and arachidonate release (1). Our results showed that cells coexpressing AA1R and chimeric Gs16 have a greater cAMP stimulation than those coexpressing AA1R and either Gq/11 or G14 in response to the agonist. These data suggest that AA1R is likely to have a greater preference for coupling to G16 than to Gq/11 or G14 under intrinsic conditions.

Use of the set of Gs chimeras as a tool to screen potential coupling pathways for receptors. It is well known that one GPCR can couple to several G protein pathways (29). There are also cases where a single ligand can activate several GPCRs but might regulate distinct biological functions in different tissues. Therefore, clarification of the coupling pathways of such receptors using a common ligand would help our understanding of their precise roles in the body. Neuromedin U (NMU), first reported in 1985 (25), is a neuropeptide found to be able to activate two corresponding receptors, NMUR1 and NMUR2 (16). We analyzed the mRNA distribution of two NMURs in 22 different rat tissues (Fig. 5). In contrast to the wide distribution of the NMUR1 transcript, the NMUR2 message was found mainly in lung, duodenum, prostate, ovary, and uterus. These data imply potential differences of signaling between the two NMURs.


Figure 5
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 5. Tissue distribution patterns of rat NMUR1 and NMUR2. In contrast to the widely distributed pattern of rat NMUR1, NMUR2 expression is more restricted. NMUR1 and NMUR2, 45 cycles; beta-actin, 30 cycles.

 
To screen their potential coupled G{alpha}, either NMUR1 or NMUR2 was cotransfected with each chimeric Gs, and the increasing fold in cAMP production was measured. Interestingly, NMUR1 and NMUR2 showed distinct differences in coupling to the various chimeric G proteins (Fig. 6). NMUR1 and NMUR2 showed no coupling to wild-type Gs/olf under stimulation with NMU-25, indicating that neither of the receptors uses the Gs pathway (Fig. 6, first condition). In addition, no response was found in cells expressing the NMURs together with the control chimera Gsc (Fig. 2E for NMUR1; data not shown for NMUR2). These results suggest that the agonist-stimulated cAMP production in the presence of NMURs and other Gs chimeras is unlikely to be from a nonspecific effect because of overexpression of either the receptor or the Gs chimera.


Figure 6
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 6. Potential G{alpha} pathway screening for NMUR1 and NMUR2. 293T cells expressing NMUR1 (A) or NMUR2 (B) were cotransfected with individual chimeric G protein. The fold increases of cAMP production in transfected cells treated with 100 nM hNMU-25 were compared using cAMP amounts in cells without stimulation as the onefold control. Data represent means ± SE; n = 3. *Significant difference from onefold control without stimulation (ANOVA, P < 0.05).

 
In the different G{alpha} subfamilies, no stimulation was induced by hNMU-25 when cells were cotransfected with NMUR1 and Gsi/t/g (Fig. 6A). In addition, compared with the average response in the presence of Gsq or Gs12 members, only a low stimulating efficiency was observed in cells coexpressing NMUR1 and other Gsi members (Gsi3, Gso, or Gsz). However, NMUR1 strongly coupled to chimeric Gsq members with various signal responses ranked Gs14 > Gsq/11 > Gs16 (Fig. 6A). NMUR1 also showed interaction with Gs12 or Gs13 in response to hNMU-25 with about a four- to fivefold increase in cAMP accumulation.

In contrast to NMUR1, NMUR2 after ligand stimulation coupled mainly to the Gsi family and increased cAMP production five- to ninefold in the ranking Gsz > Gsi3 ≥ Gsi/t/g > Go (Fig. 6B). Similar to NMUR1, NMUR2 also coupled to Gs12 and Gs13 with an increase of about four- to fivefold in cAMP. However, unlike NMUR1, the signal couplings between NMUR2 and the Gsq members were less effective. After treatment with hNMU-25, although a 6.6-fold increase was detected in cells coexpressing NMUR2 and Gsq/11, there was a less than threefold increase observed in cells coexpressing NMUR2 and either Gs14 or Gs16. Therefore, although they were stimulated by a common agonist, our results suggest that NMUR1 and NMUR2 may play different physiological roles by activating diverse G protein pathways in the body.

NMUR1 and NMUR2 preferentially activate different G{alpha} subtypes in intrinsic conditions. To assess the accuracy of pathway preference between NMUR1 and NMUR2 predicted by our chimeric Gs proteins, the established assays for Gi and Gq signaling outputs were used. The inhibitory effect of forskolin-induced cAMP production is commonly used to evaluate the Gi response. As shown in Fig. 7, graded doses of hNMU-25 remarkably inhibited forskolin-induced cAMP production in the NMUR2-expressing cells, indicating that there was intrinsic Gi coupling with NMUR2. In contrast, the inhibitory effect in response to hNMU-25 in the NMUR1-expressing cells was low to negligible.


Figure 7
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 7. Differences in endogenous Gi coupling between NMUR1 and NMUR2. NMUR1- or NMUR2-expressing cells were treated with hNMU-25 for 30 min before being subjected to stimulation of cAMP production by forskolin. Inhibitory effects on forskolin-stimulated cAMP production in both cells were compared by measuring the accumulated cAMP amount. Data represent means ± SE of 3 independent experiments in triplicate.

 
The SRE-driven reporter gene assay has been used to evaluate the activation of GPCRs triggered by the Gq and G12 families via the changes in reporter gene levels (36). In the presence of a SRE-Luc construct containing an SRE-driven luciferase, either NMUR1 or NMUR2 responded to hNMU-25 in a dose-dependent manner (Fig. 8). However, the maximum stimulation of luciferase activity in NMUR1-transfected cells is four times higher than that in NMUR2-transfected cells (Fig. 8). In addition, no further stimulation was observed in cells transfected with an increasing amount of NMUR2 construct (data not shown). Though it is known that both Gq and G12 signals can link to SRE-dependent gene expression, our data using either chimeric Gs12 or Gs13 suggest that NMUR1 and NMUR2 have similar coupling efficiency to intrinsic G12 or G13 (Fig. 6). Therefore, we conclude that the differences shown in the SRE-Luc reporter assay are derived from a higher coupling efficiency of the Gq family to NMUR1 than to NMUR2 and is not caused by low expression levels of NMUR2.


Figure 8
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 8. Use of stimulus response element (SRE)-driven reporter assay to evaluate Gq coupling preference between NMUR1 and NMUR2. Cells were transfected with SRE-Luc reporter plasmid and NMUR1 or NMUR2 plasmid. After 24-h transfection, cells were treated with graded doses of hNMU-25 before determination of luciferase activity. NMUR1-expressing cells showed a higher level of stimulation than cells expressing NMUR2. Data were normalized using a beta-galactosidase assay to correct for variations in transfection efficiency. Data were obtained from triplicate experiments and are presented as means ± SD.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Gs proteins are highly conserved in mammals, with 99.7% identity between rats and humans. Taking advantage of the direct activation of adenylyl cyclases by Gs, the present study develops a set of chimeric Gs proteins for the evaluation of G protein coupling to GPCRs. In cells cotransfected with AA1R and Gsi/t/g, PAR-1 and Gs12, or NMUR1 and Gsq/11, we demonstrated that the chimeric Gs proteins successfully redirect the endogenous Gi, G12, or Gq pathways into cAMP production. The lower cAMP stimulation in cells coexpressing Gs16-6 and NMUR1 than in cells coexpressing Gs16 and NMUR1 indicates the importance of the sixth residue at the Gs COOH terminus for receptor coupling. Furthermore, the predictions for the endogenous pathways of AA1R, NMUR1, and NMUR2 by our Gs chimeras demonstrate that this system is able to provide a new strategy for dissecting the concerto of multiple G protein couplings to any given GPCR. Such information would be undoubtedly invaluable when pharmaceutical assays and agents are being designed.

GPCRs, communicating signals from many neurotransmitters, hormones, chemokines, and environmental factors, are of particular interest when pharmaceutical screen design is carried out. However, the remarkable diversity and complexity of the couplings between GPCRs and G proteins raise difficulties for GPCR studies. From a drug screening perspective, it was our aim to create a generic technique with a very high likelihood for revealing the various GPCR-G protein interactions, which would allow high-throughput screening analyses. The discovery that the COOH-terminal tail of G{alpha} is the primary receptor recognition domain thus opens a new era of G protein receptor interaction study. Although numerous results have also suggested that various regions within G{alpha} subunits might act in concert to achieve interactions with receptors (7, 19), so far, no receptors are able to couple to G{alpha} subunits without recognizing their COOH termini. In addition, our data also showed that no cAMP stimulation was observed when using the control Gsc chimera (Fig. 2), in which the COOH terminus was replaced by that of Gq in a random order. Therefore, we conclude that the cAMP stimulations shown in the present study are derived from specific interactions between the receptors and the corresponding chimeric COOH termini of Gs.

Degradation of cAMP is controlled by cAMP phosphodiesterase enzymes. In contrast to the difficulty in the detection of transient Ca2+ mobilization, measuring cAMP production is a much more accessible assay, especially when a nonselective inhibitor such as 3-isobutyl-1-methylxanthine is added during the reaction to block phosphodiesterase activity. In addition, although several Gq or G16 chimeras with certain COOH-terminal modification have been studied (8, 26), no systematic chimeric G protein set has been proposed for pathway screening and orphan GPCR studies. Our proposed chimeric G protein array with systematic COOH-terminal replacements should be able to compensate for the inadequacies of the previous promiscuous system when capturing overall GPCR responses. In the present results, although only several Gs-inactive receptors were chosen to display the GPCR interactions with chimeric Gs proteins, future studies using Gs-null cell lines will eliminate endogenous Gs problems, thus allowing the application of pathway screening to intrinsic Gs-coupled GPCRs.

AA1R is widely distributed in the body and modulates many physiological functions, including a decrease in heart rate and atrial contractility (17), the control of neurotransmission (34), and the regulation of hepatic glycogen metabolism, as well as a reduction of lipolysis in adipose tissue (10, 12). AA1R has been reported to show higher intrinsic activity on activation of Gi1, Gi2, and Gi3 than of Go, This study indicates that Gi-coupled pathways may be activated selectively by AA1R (22, 28), consistent with our results shown in cells cotransfected with AA1R and Gsi/t/g, Gsi3, or Gso chimeras. Each chimera is different merely at the COOH terminus, and therefore our data demonstrated that the members of chimeric Gsi family were able to be used to evaluate the Gi-coupling preference of AA1R. Although no study has clearly reported the direct coupling of AA1R to Gz, our results showed that there was an interaction between AA1R and Gsz. Similar interactions have been also reported in previous studies when AA1R was coexpressed with Gq or G16 chimeras fused with the Gz COOH terminus (8, 26). In addition, AA1R has been reported to induce stress fiber formation and inhibit neurite process formation through Rho-mediated pathways (38), supporting the intrinsic interaction between AA1R and the G12 family predicted in our results. Furthermore, a recent study has proved that there is a direct interaction between AA1R and G16 in the NF-{kappa}B-mediated anti-inflammatory action (21), indicating that AA1R would stimulate the PLCbeta pathway with a greater coupling preference to G16 than to Gq/11 or G14. Similar results were also found in our studies in the chimeric Gsq family. Though AA1R has been reported to interact with many G{alpha} proteins, it is difficult to compare their coupling preference using different reading outputs. The chimeric Gs{alpha} system, to our knowledge, is the first tool that can reveal the G{alpha}-coupling preference of AA1R under the same platform.

There are many examples that a common agonist can activate several receptors. However, it is difficult to explain the natural design of multiple receptors without knowing the differences in their downstream signal conduction. Two NMURs, for example, were found to be activated by NMU, a neuropeptide with potent activity affecting smooth muscle contraction, blood pressure increase, stress response, and animal feeding (6, 16, 25). However, unlike NMU, which is widely expressed in tissues (2, 15), NMUR1 expression is abundant in peripheral tissues whereas NMUR2 is expressed chiefly in the central nervous system (16, 33). The differences in distribution and/or signals between NMUR1 and NMUR2 ought to contribute to their functional diversities. Although the interaction between NMU and the two receptors can be monitored by measuring intracellular Ca2+ and inositol phosphate accumulation (16, 33), neither method is able to distinguish the detailed differences in signaling between NMUR1 and NMUR2. In contrast, when we used chimeric G proteins, our results revealed that there is a distinct preference in G protein selectivity between NMUR1 and NMUR2, which supports the functional diversity of NMU in various tissues by activating different receptors through diverse G protein pathways. From a pharmaceutical perspective, this information may allow one to develop small-molecule agonists or antagonists with receptor subtype specificity that will help to identify the roles of NMU as well as the receptor subtypes through which the different effects are mediated. Likewise, similar approaches can also be applied to other receptors. In addition, it is known that several NMU isoforms can be produced either by posttranslational cleavage of a preprohormone (25) or by individual gene transcription (27). It would be interesting to explore whether the different NMU isoforms are able to alter receptor selectivity on G protein coupling.

Furthermore, it is well known that some GPCRs are able to interact with more than one endogenous agonist. Although no example was studied here, the application of a whole set of Gs chimeras should be able to reveal the differences in G protein selectivity associated with a certain receptor when stimulated by diverse agonists. Interestingly, a diverse spectrum of G protein-coupled pathways has been found to show receptor properties with different ligand selectivity (4, 24, 35). An example is the human serotonin 2C receptor, where it has been shown that certain agonists can preferentially activate the PLCbeta-IP3 pathway, whereas other agonists favor the phospholipase A2-arachidonic acid release pathway (4). These results strongly support the "agonist-directed trafficking of receptor stimulus" hypothesis proposed by Kenakin (18). It has been hypothesized that each different agonist-receptor interaction stabilizes a unique conformation of the receptor, which changes its specificity for different G proteins (24). If agonist-directed trafficking occurs, the physiological outcome of receptor activation may change depending on which endogenous ligand is seen by a receptor. However, the available information is inadequate, and the underlying mechanism remains speculative, partially because it is difficult to normalize the G protein coupling efficiency from different reading outputs against various G{alpha} responses. In contrast, our proposed chimeric Gs{alpha} analyses should provide a convenient tool to compare the G protein-coupled preferences of a given GPCR when stimulated with different agonists. This could provide important information on physiological as well as pharmacological regulation. Similarly, in drug design, therapeutic agents could be developed with even greater selectivity than now afforded, by exploiting selective affinity for a subclass of receptor pathways and thus minimizing unwanted effects.

The chimeric Gs proteins will be also useful for orphan GPCR studies. Up to the present, no single G{alpha} or its chimera can serve as a universal signaling adaptor for all different receptors because of the unique COOH-terminal characteristics of G{alpha} that provide a limited range for receptor selectivity. With a whole set of chimeric Gs proteins designed to cover all G{alpha} subtypes, it should be possible to redirect orphan GPCRs with unknown G protein-coupling specificities toward a common cAMP assay end point. This approach can avoid the need to set up different assays for agonist screening.

In conclusion, the present study provides a comprehensive and convenient approach to explore previously uncharacterized G protein pathways for GPCRs with known ligands. Besides, the present chimeric Gs protein system can serve as a tool to examine the potential G protein pathways for orphan GPCRs, thus allowing future screening of candidate ligands. With the rapid progress in high-throughput screening and real-time techniques using live cells with fluorescent probed molecules (11, 14), one can envisage that this novel system is likely to be incorporated into drug discovery programs.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by Grant NSC 95-2320-B-010-060-MY2 from the National Science Council, Taiwan and Grant 95A-C-D01-CDG-03 from the Ministry of Education, Aim for the Top University Plan, Taiwan.


    ACKNOWLEDGMENTS
 
We thank Dr. Aaron J.-W. Hsueh (Stanford University School of Medicine, Stanford, CA) for experimental support and careful review of this manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: C.-W. Luo, Dept. of Life Sciences and Inst. of Genome Sciences, National Yang-Ming University, 155 Li Nong St., Section 2, Shihpai, Taipei 112, Taiwan (e-mail: cwluo{at}ym.edu.tw)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Akbar M, Okajima F, Tomura H, Shimegi S, Kondo Y. A single species of A1 adenosine receptor expressed in Chinese hamster ovary cells not only inhibits cAMP accumulation but also stimulates phospholipase C and arachidonate release. Mol Pharmacol 45: 1036–1042, 1994.[Abstract]
  2. Ballesta J, Carlei F, Bishop AE, Steel JH, Gibson SJ, Fahey M, Hennessey R, Domin J, Bloom SR, Polak JM. Occurrence and developmental pattern of neuromedin U-immunoreactive nerves in the gastrointestinal tract and brain of the rat. Neuroscience 25: 797–816, 1988.[CrossRef][Web of Science][Medline]
  3. Bence K, Ma W, Kozasa T, Huang XY. Direct stimulation of Bruton's tyrosine kinase by G(q)-protein alpha-subunit. Nature 389: 296–299, 1997.[CrossRef][Medline]
  4. Berg KA, Maayani S, Goldfarb J, Scaramellini C, Leff P, Clarke WP. Effector pathway-dependent relative efficacy at serotonin type 2A and 2C receptors: evidence for agonist-directed trafficking of receptor stimulus. Mol Pharmacol 54: 94–104, 1998.[Abstract/Free Full Text]
  5. Bockaert J, Pin JP. Molecular tinkering of G protein-coupled receptors: an evolutionary success. EMBO J 18: 1723–1729, 1999.[CrossRef][Web of Science][Medline]
  6. Brighton PJ, Szekeres PG, Willars GB. Neuromedin U and its receptors: structure, function, and physiological roles. Pharmacol Rev 56: 231–248, 2004.[Abstract/Free Full Text]
  7. Cabrera-Vera TM, Vanhauwe J, Thomas TO, Medkova M, Preininger A, Mazzoni MR, Hamm HE. Insights into G protein structure, function, and regulation. Endocr Rev 24: 765–781, 2003.[Abstract/Free Full Text]
  8. Conklin BR, Farfel Z, Lustig KD, Julius D, Bourne HR. Substitution of three amino acids switches receptor specificity of Gq alpha to that of Gi alpha. Nature 363: 274–276, 1993.[CrossRef][Medline]
  9. Conklin BR, Herzmark P, Ishida S, Voyno-Yasenetskaya TA, Sun Y, Farfel Z, Bourne HR. Carboxyl-terminal mutations of Gq alpha and Gs alpha that alter the fidelity of receptor activation. Mol Pharmacol 50: 885–890, 1996.[Abstract]
  10. Dhalla AK, Wong MY, Voshol PJ, Belardinelli L, Reaven GM. A1 adenosine receptor partial agonist lowers plasma FFA and improves insulin resistance induced by high-fat diet in rodents. Am J Physiol Endocrinol Metab 292: E1358–E1363, 2007.[Abstract/Free Full Text]
  11. Gales C, Rebois RV, Hogue M, Trieu P, Breit A, Hebert TE, Bouvier M. Real-time monitoring of receptor and G-protein interactions in living cells. Nat Methods 2: 177–184, 2005.[CrossRef][Web of Science][Medline]
  12. Gonzalez-Benitez E, Guinzberg R, Diaz-Cruz A, Pina E. Regulation of glycogen metabolism in hepatocytes through adenosine receptors. Role of Ca2+ and cAMP. Eur J Pharmacol 437: 105–111, 2002.[CrossRef][Web of Science][Medline]
  13. Hamm HE, Gilchrist A. Heterotrimeric G proteins. Curr Opin Cell Biol 8: 189–196, 1996.[CrossRef][Web of Science][Medline]
  14. Hoffmann C, Gaietta G, Bunemann M, Adams SR, Oberdorff-Maass S, Behr B, Vilardaga JP, Tsien RY, Ellisman MH, Lohse MJ. A FlAsH-based FRET approach to determine G protein-coupled receptor activation in living cells. Nat Methods 2: 171–176, 2005.[CrossRef][Web of Science][Medline]
  15. Honzawa M, Sudoh T, Minamino N, Tohyama M, Matsuo H. Topographic localization of neuromedin U-like structures in the rat brain: an immunohistochemical study. Neuroscience 23: 1103–1122, 1987.[CrossRef][Web of Science][Medline]
  16. Howard AD, Wang R, Pong SS, Mellin TN, Strack A, Guan XM, Zeng Z, Williams DL Jr, Feighner SD, Nunes CN, Murphy B, Stair JN, Yu H, Jiang Q, Clements MK, Tan CP, McKee KK, Hreniuk DL, McDonald TP, Lynch KR, Evans JF, Austin CP, Caskey CT, Van der Ploeg LH, Liu Q. Identification of receptors for neuromedin U and its role in feeding. Nature 406: 70–74, 2000.[CrossRef][Medline]
  17. Hutchinson SA, Scammells PJ. A(1) adenosine receptor agonists: medicinal chemistry and therapeutic potential. Curr Pharm Des 10: 2021–2039, 2004.[CrossRef][Web of Science][Medline]
  18. Kenakin T. Agonist-receptor efficacy. II. Agonist trafficking of receptor signals. Trends Pharmacol Sci 16: 232–238, 1995.[CrossRef][Medline]
  19. Kostenis E, Waelbroeck M, Milligan G. Techniques: promiscuous Galpha proteins in basic research and drug discovery. Trends Pharmacol Sci 26: 595–602, 2005.[CrossRef][Medline]
  20. Libert F, Schiffmann SN, Lefort A, Parmentier M, Gerard C, Dumont JE, Vanderhaeghen JJ, Vassart G. The orphan receptor cDNA RDC7 encodes an A1 adenosine receptor. EMBO J 10: 1677–1682, 1991.[Web of Science][Medline]
  21. Liu AM, Wong YH. G16-mediated activation of nuclear factor kappaB by the adenosine A1 receptor involves c-Src, protein kinase C, and ERK signaling. J Biol Chem 279: 53196–53204, 2004.[Abstract/Free Full Text]
  22. Lorenzen A, Lang H, Schwabe U. Activation of various subtypes of G-protein alpha subunits by partial agonists of the adenosine A1 receptor. Biochem Pharmacol 56: 1287–1293, 1998.[CrossRef][Web of Science][Medline]
  23. Luo CW, Kawamura K, Klein C, Hsueh AJ. Paracrine regulation of ovarian granulosa cell differentiation by stanniocalcin (STC) 1: mediation through specific STC1 receptors. Mol Endocrinol 18: 2085–2096, 2004.[Abstract/Free Full Text]
  24. McLaughlin JN, Shen L, Holinstat M, Brooks JD, Dibenedetto E, Hamm HE. Functional selectivity of G protein signaling by agonist peptides and thrombin for the protease-activated receptor-1. J Biol Chem 280: 25048–25059, 2005.[Abstract/Free Full Text]
  25. Minamino N, Sudoh T, Kangawa K, Matsuo H. Neuromedins: novel smooth-muscle stimulating peptides identified in porcine spinal cord. Peptides 6, Suppl 3: 245–248, 1985.
  26. Mody SM, Ho MK, Joshi SA, Wong YH. Incorporation of Galpha(z)-specific sequence at the carboxyl terminus increases the promiscuity of Galpha(16) toward G(i)-coupled receptors. Mol Pharmacol 57: 13–23, 2000.[Abstract/Free Full Text]
  27. Mori K, Miyazato M, Ida T, Murakami N, Serino R, Ueta Y, Kojima M, Kangawa K. Identification of neuromedin S and its possible role in the mammalian circadian oscillator system. EMBO J 24: 325–335, 2005.[CrossRef][Web of Science][Medline]
  28. Murthy KS, Makhlouf GM. Adenosine A1 receptor-mediated activation of phospholipase C-beta 3 in intestinal muscle: dual requirement for alpha and beta gamma subunits of Gi3. Mol Pharmacol 47: 1172–1179, 1995.[Abstract]
  29. Neves SR, Ram PT, Iyengar R. G protein pathways. Science 296: 1636–1639, 2002.[Abstract/Free Full Text]
  30. Offermanns S, Laugwitz KL, Spicher K, Schultz G. G proteins of the G12 family are activated via thromboxane A2 and thrombin receptors in human platelets. Proc Natl Acad Sci USA 91: 504–508, 1994.[Abstract/Free Full Text]
  31. Pierce KL, Premont RT, Lefkowitz RJ. Seven-transmembrane receptors. Nat Rev Mol Cell Biol 3: 639–650, 2002.[CrossRef][Web of Science][Medline]
  32. Preininger AM, Hamm HE. G protein signaling: insights from new structures. Sci STKE 2004: re3, 2004.
  33. Raddatz R, Wilson AE, Artymyshyn R, Bonini JA, Borowsky B, Boteju LW, Zhou S, Kouranova EV, Nagorny R, Guevarra MS, Dai M, Lerman GS, Vaysse PJ, Branchek TA, Gerald C, Forray C, Adham N. Identification and characterization of two neuromedin U receptors differentially expressed in peripheral tissues and the central nervous system. J Biol Chem 275: 32452–32459, 2000.[Abstract/Free Full Text]
  34. Ribeiro JA. Purinergic inhibition of neurotransmitter release in the central nervous system. Pharmacol Toxicol 77: 299–305, 1995.[Web of Science][Medline]
  35. Robb S, Cheek TR, Hannan FL, Hall LM, Midgley JM, Evans PD. Agonist-specific coupling of a cloned Drosophila octopamine/tyramine receptor to multiple second messenger systems. EMBO J 13: 1325–1330, 1994.[Web of Science][Medline]
  36. Sah VP, Seasholtz TM, Sagi SA, Brown JH. The role of Rho in G protein-coupled receptor signal transduction. Annu Rev Pharmacol Toxicol 40: 459–489, 2000.[CrossRef][Web of Science][Medline]
  37. Sondek J, Lambright DG, Noel JP, Hamm HE, Sigler PB. GTPase mechanism of G proteins from the 1.7-A crystal structure of transducin alpha-GDP-AIF-4. Nature 372: 276–279, 1994.[CrossRef][Medline]
  38. Thevananther S, Rivera A, Rivkees SA. A1 adenosine receptor activation inhibits neurite process formation by Rho kinase-mediated pathways. Neuroreport 12: 3057–3063, 2001.[CrossRef][Web of Science][Medline]
  39. Vassilatis DK, Hohmann JG, Zeng H, Li F, Ranchalis JE, Mortrud MT, Brown A, Rodriguez SS, Weller JR, Wright AC, Bergmann JE, Gaitanaris GA. The G protein-coupled receptor repertoires of human and mouse. Proc Natl Acad Sci USA 100: 4903–4908, 2003.[Abstract/Free Full Text]
  40. West RE Jr, Moss J, Vaughan M, Liu T, Liu TY. Pertussis toxin-catalyzed ADP-ribosylation of transducin cysteine 347 is the ADP-ribose acceptor site. J Biol Chem 260: 14428–14430, 1985.[Abstract/Free Full Text]
  41. Yokoyama T, Kato N, Yamada N. Development of a high-throughput bioassay to screen melatonin receptor agonists using human melatonin receptor expressing CHO cells. Neurosci Lett 344: 45–48, 2003.[CrossRef][Web of Science][Medline]
  42. Zhang VJ, Ren PG, Avsian-Kretchmer O, Luo CW, Rauch R, Klein C, Hsueh AJ. Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake. Science 310: 996–999, 2005.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Yanagida, K. Masago, H. Nakanishi, Y. Kihara, F. Hamano, Y. Tajima, R. Taguchi, T. Shimizu, and S. Ishii
Identification and Characterization of a Novel Lysophosphatidic Acid Receptor, p2y5/LPA6
J. Biol. Chem., June 26, 2009; 284(26): 17731 - 17741.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. D. Mitchell, J. J. Maguire, R. E. Kuc, and A. P. Davenport
Expression and vasoconstrictor function of anorexigenic peptides neuromedin U-25 and S in the human cardiovascular system
Cardiovasc Res, February 1, 2009; 81(2): 353 - 361.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
D. Mcguinness, A. Malikzay, R. Visconti, K. Lin, M. Bayne, F. Monsma, and C. A. Lunn
Characterizing Cannabinoid CB2 Receptor Ligands Using DiscoveRx PathHunterTM {beta}-Arrestin Assay
J Biomol Screen, January 1, 2009; 14(1): 49 - 58.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/E1021    most recent
00003.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hsu, S.-H.
Right arrow Articles by Luo, C.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hsu, S.-H.
Right arrow Articles by Luo, C.-W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.