AJP - Endo Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 293: E259-E263, 2007. First published April 24, 2007; doi:10.1152/ajpendo.00616.2006
0193-1849/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/E259    most recent
00616.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zalutskaya, A. A.
Right arrow Articles by Abou-Samra, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zalutskaya, A. A.
Right arrow Articles by Abou-Samra, A. B.

Impaired adaptation to repeated restraint and decreased response to cold in urocortin 1 knockout mice

Alena A. Zalutskaya,1 Maya Arai,1 George S. Bounoutas,1 and Abdul B. Abou-Samra2

1Endocrine Unit, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts; and 2Wayne State University School of Medicine, Detroit, Michigan

Submitted 16 November 2006 ; accepted in final form 29 March 2007


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Urocortin 1 (UCN1) is a corticotropin-releasing factor (CRF)-like peptide whose role in stress is not well characterized. To study the physiological role of UCN1 in the response of the hypothalamic-pituitary-adrenal (HPA) axis to stress, we generated UCN1-knockout (KO) mice and examined their adaptation to repeated restraint and to cold environment. Wild-type (WT) and UCN1-KO animals were restrained hourly for 15 min from 9 AM to 2 PM, and blood samples were obtained for corticosterone measurement. WT animals adapted to repeated restraint with a decreased corticosterone response; the restraint-stimulated corticosterone levels fell from 215 ± 31 ng/ml in naïve animals to 142 ± 50 ng/ml in mice subjected to repeated restraint (P < 0.01) and from 552 ± 98 to 314 ± 58 ng/ml (P < 0.001) in males and females, respectively. Male UCN1-KO mice did not show any adaptation to repeated restraint; instead, restraint-stimulated corticosterone levels were increased from 274 ± 80 ng/ml in naïve animals to 480 ± 75 ng/ml in mice subjected to repeated restraint (P < 0.001). Female UCN1-KO mice showed only a partial adaptation to repeated restraint, with a decrease in the restraint-stimulated corticosterone response from 631 ± 102 ng/ml in naïve animals to 467 ± 78 ng/ml in mice subjected to repeated restraint (P < 0.01). In addition, UCN1-KO mice showed no corticosterone response to 2-h cold environment. These data demonstrate an important role for UCN1 in the HPA axis adaptation to repeated restraint and in the corticosterone response to a cold environment.

corticosterone; stress; mice

CORTICOTROPIN-RELEASING FACTOR (CRF) plays a critical role in the physiology of the central nervous system and the regulation of hypothalamic-pituitary-adrenal (HPA) axis activity. CRF is a 41-amino acid peptide that stimulates the secretion of adrenocorticotropic hormone (ACTH) (28). Several studies (7, 14) have shown that CRF is the major regulator of the basal and stress-induced activation of the HPA-axis and is involved in several other physiological and behavioral responses. Three CRF receptors have been characterized: CRFR1, CRFR2, and CRFR3. CRFR1 and CRFR2 have been found in mammalian species (8, 10) and Xenopus (12), whereas CRFR3 has been found only in fish (4). The CRF receptors couple to the stimulatory G protein (Gs), which activates adenylate cyclase, leading to accumulation of cAMP in the target cells. The CRF receptors have also been shown to couple to several other G proteins, such as Gi, Gq, Go, and Gz (9, 15). CRF binds to CRFR1 with high affinity and to CRFR2 minimally (24). Recently, three CRF-like peptides, urocortin (UCN)1 (29), UCN2 (25), and UCN3 (20), have been discovered in different species. UCN2 and UCN3 bind to CRFR2 with a high affinity, but only UCN2 can activate CRFR1 at higher concentrations. UCN1 has equal affinity to both receptors (24); however, this peptide binds to CRFR1 with an affinity that is similar to that of CRF. The high-affinity interaction between UCN1 and CRFR1 suggests a physiological role for UCN1 in stress responses and behavioral processes mediated by CRFR1. UCN1 is a 40-amino acid peptide expressed in the Edinger-Westphal, supraoptic, and hypoglossal nuclei as well as in several peripheral tissues (29). UCN1 mRNA levels in the Edinger-Westphal nucleus were shown to increase approximately threefold after 3-h restraint (34); these data suggested that UCN1 is involved in stress regulation. However, studies with UCN1-KO mice did not reveal an important role for UCN1 in the HPA axis response to stress but indicated an important role for UCN1 in anxiety-like behavior and in inner ear physiology (30, 32). We, therefore, hypothesized that UCN1 plays a nonclassic role in stress regulation, such as in the adaptation of the HPA axis to repeated stress and in response to a cold environment.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. All chemicals and the Polymerase Chain Reaction kit were obtained from Sigma (St. Louis, MO), except as indicated. DNA primers were made at the Massachusetts General Hospital Polymer Facility (Boston, MA). All molecular biology enzymes were from Promega (Madison, WI). Corticosterone radioimmunoassay kit was from ICN Biomedicals (Costa Mesa, CA).

Generation of the UCN1-KO mice. An XbaI murine UCN1 genomic fragment, cloned in the bluescript, was kindly provided by Dr. Joe Majzoub (Children's Hospital, Boston, MA). A targeting vector was constructed in the pPNT cloning vector (27), in which the coding sequence after the initiator methionine was interrupted with the neomycin-resistance gene cloned into the BamHI site, which occurs naturally within the UCN1 gene sequence (Fig. 1A). The targeting vector was linearized with NotI and transfected into J1 embryonic stem (ES) cells by electroporation; cell clones that survived the G418 selection were screened for homologous recombination using Southern blots probed with a 1.6-Kb external probe (Fig. 1, A and B). Positive ES clones were expanded and used to generate the KO mouse colony. ES cells that had undergone correct homologous recombination were injected into C57BL/6 blastocysts. Germ line transmission of the mutant allele was confirmed by Southern blot analysis. Mice heterozygous for the UCN1-KO allele were then crossed with C57BL/6 background for six generations. Heterozygous mating produced 25% homozygous KO progeny, as expected. PCR amplification of mouse tail DNA was used for genotype screening using three primers: UC1 (GAGGGGACGCGCTACGCTCC), a UCN1 forward primer; UC2 (GTCCGAGCTAGCTCCAGCAG), a UCN1 backward primer; and a neomycin-resistant gene specific primer (Neo2; GCGAATGGGCTGACCGCTTC). The UC1 and UC2 PCR product is a 300-bp fragment from the UCN1 gene seen in wild-type (WT) and heterozygous animals (Fig. 1D). The UC2 and Neo2 PCR product is an 800-bp fragment seen in heterozygous and KO mice (Fig. 1D). The validity of PCR genotyping was confirmed with Southern blot analysis (Fig. 1C). In situ hybridization of brain sections made through the Edinger-Westphal nucleus using UCN1-specific probe (29) was performed (Fig. 1E). The probe is complementary to nucleotides 660–882 of the murine UCN1 gene and does not cross-react with CRF, UCN2, or UCN3 transcripts. We performed reverse transcription (RT) followed by PCR (RT-PCR) of total brain RNA, prepared from WT and KO mice, using the UC1 and UC2 primers that are specific for the mouse UCN1 transcript.


Figure 1
View larger version (43K):
[in this window]
[in a new window]

  		Fig. 1. Generation of urocortin 1 knockout (UCN1-KO) mice. A: an XbaI murine UCN1 genomic fragment, cloned in the bluescript, was kindly provided by Dr. Joe Majzoub (Children's Hospital, Boston, MA). A targeting vector was constructed in the pPNT cloning vector (27), in which the coding sequence after the angiotensinogen initiator was interrupted with the neomycin-resistance gene cloned into the BamHI site within the UCN1 gene. The targeting vector was linearized with NotI and transfected into J1 embryonic stem (ES) cells by electroporation. B: Southern blot of transfected ES cells. Cell clones, which survived the G418 selection, were screened for homologous recombination using Southern blots probed with a 1.6-Kb external probe. C: Southern blot analysis of tail DNA isolated from wild-type (WT) and UCN1-KO mice digested by XbaI and probed by an external 1-kb probe (EcoRI-XbaI fragment; A). D: PCR amplification of mouse tail DNA was used for genotyping with 3 primers: UC1 (GAGGGGACGCGCTACGCTCC), a UCN1 forward primer; UC2 (GTCCGAGCTAGCTCCAGCAG), a UCN2 backward primer; and a neomycin-resistant gene specific primer (Neo2; GCGAATGGGCTGACCGCTTC). E: in situ hybridization using UCN1-specific RNA probe on brain sections made through the Edinger-Westphal nucleus of WT and UCN1-KO mice.

 
Animals. Adult male and female (12-wk-old) WT and homozygous UCN1-KO mice were used. All animals were housed under 12:12-h light-dark cycles (lights on at 0700), with free access to food and water. Each mouse was used for experimentation only once. The number of the mice in each experimental group was six. All animal procedures were approved by the Massachusetts General Hospital Animal Care and Use Committee.

Immobilization and cold stress studies. UCN1-KO and WT male and female mice were group housed. Animals were individually restrained in ventilated 50-ml polypropylene Falcon tubes. Trunk blood was collected either before (control) or after immobilization. The immobilization stress was performed at 2 PM for 15 min. To investigate the adaptation to repeated immobilization stress, the animals were restrained hourly for 15 min from 9 AM to 2 PM (a total of 6 times). The control groups were restrained five times and allowed 1 h for recovery, and blood samples were collected at 2:15 PM. Cold stress was performed by placing mice housed individually in separate cages at 4°C for 2 h from 12 to 2 PM.

Blood sampling. Trunk blood samples were obtained after rapid decapitation of isoflurane-anesthetized mice. Blood samples were collected into 1.5-ml Fisher plastic tubes containing 5 µl of 0.5 M EDTA, the samples were immediately centrifuged, and the plasma was stored at –80°C until assayed. All blood collection was performed at 2:15 PM to avoid the diurnal variation in corticosterone secretion. Corticosterone radioimmunoassay was performed according to the manufacturer's specifications. All control and experimental samples from one experiment were assayed in one assay. The intra-assay and interassay variations were 7.1 and 7.2%, respectively. Statistical comparisons between groups were performed using one-way ANOVA followed by the Student-Newman-Keuls multiple comparison test for unequal replicates. All analyses were conducted with Excel 2001 software.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
The UCN1-KO mice were generated by homologous recombination (Fig. 1). The construction of a targeting vector is shown in Fig. 1A. Southern blot analysis of XbaI-digested DNA from the ES cell clones showed homologous recombination with a 6.3-Kb WT allele and a 4.3-Kb mutant allele (Fig. 1B). Southern blot analysis performed on mouse tail DNA prepared from WT and KO mice also showed the 6.3-Kb XbaI fragment in WT and 4.3-Kb XbaI fragment in UCN1-KO DNA (Fig. 1C). PCR genotyping also showed a 300-bp fragment in the WT and an 800-bp fragment in the UCN1-KO mice (Fig. 1D). In situ hybridization of brain sections made through the Edinger-Westphal nucleus showed UCN1 expression in the WT (Fig. 1E, arrow) but not in the UCN1-KO mice (Fig. 1E). RT followed by PCR of total brain RNA, prepared from WT and KO mice, also showed the normal transcript in the WT but absent expression in the KO (data not shown).

To avoid genetic drift in the phenotype, we back-crossed the heterozygous UCN1-KO mice with the C57BL/6 background for six generations.

The UCN1-KO mice were fertile, showed normal litter size, and passed the mutations according to the Mendelian inheritance. Gross anatomy revealed no abnormalities in the internal organs; these data correspond with the results from other groups (27, 28).

Since sexual dimorphism was described for corticosterone response to stress in CRF-KO mice (21), we performed experiments on male and female mice and analyzed the data for each sex separately. Basal corticosterone levels, analyzed in trunk blood collected after rapid decapitation, were higher in male UCN1-KO mice than in WT controls (188.1 ± 65.6 vs. 56.3 ± 21.1 ng/ml, respectively, P < 0.05; Fig. 2). Furthermore, corticosterone values increased significantly after 15-min immobilization to 215 ± 31 and 274 ± 80 ng/ml in WT and in UCN1-KO male mice, respectively (Fig. 2). Repeated restraint resulted in a significant adaptation of the corticosterone response to restraint in WT mice. The corticosterone response to 15-min immobilization in WT male mice fell from 215 ± 31 ng/ml in naïve mice to 142 ± 50 ng/ml (P < 0.01) in mice subjected to repeated restraint (Fig. 2). In contrast, UCN1-KO male mice had an increased corticosterone response; corticosterone levels after 15-min immobilization were 274 ± 80 ng/ml in naïve animals and 480 ± 75 ng/ml (P < 0.001) in mice subjected to repeated restraint (Fig. 2). Thus, male UCN1-KO mice did not show any adaptation to repeated restraint.


Figure 2
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 2. Corticosterone response to restraint and cold stress in male UCN1-KO mice. WT and UCN1-KO mice were restrained hourly for 15 min between 9 AM and 1 PM (groups G, H, I, J, K, and L). At 2 PM, mice were subjected to nothing (control groups G and J), 15-min restraint (groups H and K), or 2-h cold environment (groups C and F). Naïve mice (groups A, B, C, D, E, and F) were handled similarly to the other experimental groups, except that they did not receive any restraint (control groups A and D), received only one 15-min restraint at 2 PM (groups B and E), or were placed in a cold environment for 2 h (groups C and F) . The data are means ± SD (n = 6). aP < 0.0001 vs. group A; bP < 0.001 vs. group A; cP < 0.05 vs. group D; dP < 0.05 vs. group A; eP < 0.01 vs. group B; fP < 0.001 vs. group G; gP < 0.001 vs. group E; hP < 0.05 vs. group E.

 
Similarly, female WT and UCN1-KO mice have a significant response to acute immobilization stress (Fig. 3). Furthermore, significant adaptation of the corticosterone response to acute immobilization was observed in WT females; the corticosterone levels after immobilization fell from 552 ± 98 ng/ml in naïve animals to 314 ± 58 ng/ml (P < 0.001) in mice subjected to repeated restraint (Fig. 3). The UCN1-KO females showed a partial adaptation to repeated restraint; the corticosterone response to immobilization decreased from 631 ± 102 ng/ml in naïve mice to 467 ± 78 ng/ml in mice subjected to repeated restraint (P < 0.01; Fig. 3).


Figure 3
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 3. Corticosterone response to restraint and cold stress in female UCN1-KO mice. The experimental groups are similar to those described in Fig. 2, except that they were performed on female mice. The data are means ± SD (n = 6). aP < 0.005 vs. group A; bP < 0.01 vs. group A; cP < 0.0001 vs. group D; dP < 0.001 vs. group B; eP < 0.01 vs. group E; fP < 0.05 vs. group G; gP < 0.01 vs. group J.

 
To study the effect of adaptation to repeated restraint on the corticosterone response to a novel stress, WT and UCN1-KO mice were restrained hourly (x3) and then subjected to 2-h cold environment. A 2-h cold exposure was selected from an experiment designed to examine the time course of the effect of cold environment on corticosterone levels; the latter showed a robust reproducible stimulation after 2 h of cold (Table 1). Both male and female WT mice showed significant response to cold stress. Corticosterone levels after 2 h of cold exposure increased from 56.3 ± 21.1 to 190.8 ± 16.1 ng/ml (P < 0.001; Tables 1 and 2 and Fig. 2) in males and from 141.3 ± 58.8 to 416.5 ± 40.2 ng/ml (P < 0.01; Fig. 3 and Table 2) in females, respectively. In contrast to WT, UCN1-KO males and females showed no corticosterone response to cold (Figs. 2 and 3). Furthermore, the cold response in naïve WT mice was similar to that in mice subjected to repeated restraints (Figs. 2 and 3). Interestingly, UCN1 KO males showed no corticosterone response to cold environment when they were subjected to repeated restraint (Fig. 2). However, repeated restraint in female UCN1 KO mice resulted in a significant corticosterone response to cold (Fig. 3).


View this table:
[in this window]
[in a new window]

  		Table 1. Time course of the effect of cold environment on corticosterone levels in WT mice

 

View this table:
[in this window]
[in a new window]

  		Table 2. Sex differences in the corticosterone response to stress in WT and UCN1-KO mice

 
Comparison between the responses in males and females revealed sex differences in the corticosterone response to stress in WT and UCN1-KO mice (Table 2). In WT mice, basal levels of corticosterone were higher than in males (Table 2). This tendency was also observed after different stress exposure in WT mice (Table 2). In contrast to WT, UCN1-KO mice show no differences in basal corticosterone levels between males and females (Table 2). UCN1 KO-females have significantly higher restraint and cold exposure responses than UCN1-KO males (Table 2). Adaptation to repeated restraint and the response to cold after adaptation to repeated restraint were similar between UCN1 KO males and females (Table 2).


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Adaptation of the corticosterone response to chronic stress is a complex biological phenomenon that involves multiple hypothalamic neuroendocrine hormones and the negative feedback of corticosterone on the pituitary and the hypothalamus (1, 2, 5, 11, 26). Studies in rats (16–18, 26) showed a blunted corticosterone response when the animals were exposed to a familiar restraint stress repeatedly. In mice subjected to daily restraint for 21 days, plasma corticosterone levels returned to prestressed, basal levels by their 21st day (23). The mechanism of this adaptation is not known and may involve several neuroendocrine peptides and receptors. Our data show that the adaptation to repeated restraint is impaired in UCN1-KO mice; male UCN1-KO mice demonstrated an enhanced corticosterone response after repeated restraint, whereas female UCN1-KO mice had an impaired adaptation to repeated restraint. These data clearly implicate UCN1 in the physiological adaptation of the HPA axis to repeated restraint. It is important to notice that UCN1 mRNA expression in the Edinger-Westphal nucleus increased approximately threefold after 3-h restraint (14); these data are consistent with our observation that UCN1 is involved in stress regulation.

It is surprising that UCN1-KO mice had an impaired corticosterone response to cold stress; both males and females showed no corticosterone response to 2-h cold environment, whereas the WT male and female mice had a significant increase in corticosterone levels. The WT response in mice is similar to that described in rats (13). Review of the literature suggests that different stressors employ different stress circuits (19). Our data that UCN1-KO male and female mice have impaired response to cold suggest that UCN1 is essential for this response. This finding suggests that cold exposure leads to activation of the UCN1 neurons and that such an activation results in stimulation of the HPA axis. The latter can be a direct response to the release of UCN1 in the vicinity of the anterior pituitary or an indirect response via multiple relays within the central nervous system modulating the release of hypothalamic CRF and/or vasopressin. It is also interesting to note that cold exposure was shown to modulate the expression of CRFR1 and CRFR2 transcripts in the anterior pituitary gland (31).

Adaptation of the HPA axis to repeated stress may involve 1) desensitization of the neurons that release CRF and/or other factors with CRF-like activity, 2) reduction of receptors mediating ACTH release at the corticotrophs, and/or 3) desensitization of the intracellular signaling cascades leading to ACTH secretion and activation of the HPA axis. It has been shown (3) that administration of CRF or glucocorticoid downregulates the CRF binding sites, although CRF receptor mRNA may be increased. Our finding that UCN1-KO mice have an impaired adaptation to repeated restraint suggests that UCN1 is required for one or more of the mechanisms described above. The exact site of UCN1 action in the adaptation to repeated restraint requires further experimentation.

It has been shown (22) that conditional CRFR1 KO from the limbic system resulted in sustained ACTH and corticosterone response to restraint; this suggested an important role for the limbic CRFR1 in stress adaptation. Since low levels of UCN1 expression are found in the central nervous system outside the Edinger-Westphal nucleus (33), we speculate that UCN1 acts on CRFR1 within the limbic system to modulate the stress response.

Furthermore, our data showed an interesting sexually dimorphic corticosterone response to cold in UCN1-KO mice subjected to repeated restraint. Female UCN1-KO mice showed a normal corticosterone response to cold after repeated restraint. Surprisingly, basal corticosterone levels were higher in male UCN1-KO mice than in male WT mice, whereas they were similar in female WT and UCN1-KO mice. These variations of the basal corticosterone levels, of the response to cold, and of the adaptation to repeated restraint in male and female UCN1-KO mice illustrate the complexity of the neuroendocrine regulation of the HPA axis response to different stressors in females and males. The different corticosterone regulation in male and female WT and UCN1-KO mice is concordant with the sexually dimorphic stress response previously observed in CRF-KO mice (17). The mechanism of this dimorphism is unknown. It is possible that the gonadal steroids alter the adrenal response to stimulation in a sex-specific manner, since differences in corticosterone levels between males and females were not reflected in ACTH levels (6). It is also possible that sex differences are inherent within the neuronal circuit regulating the stress response.

Other investigators (27, 28) have described a normal corticosterone response in UCN1-KO mice subjected to one restraint stress. Wang et al. (32) found no differences between UCN1-KO and WT mice in response to 1-h immobilization stress. Similarly, Vetter et al. (30) also showed a normal corticosterone response to immobilization in UCN1-KO mice. Our data on naïve mice confirm those of Wang et al. and Vetter et al. that UCN1-KO mice have normal corticosterone response to one-time immobilization stress.

In conclusion, this study demonstrates that UCN1-KO mice have impaired response to cold and exhibit impaired adaptation to repeated restraint, thus demonstrating an important role for UCN1 in the regulation of the HPA axis.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by a grant from the National Institute of Diabetes and Digestive and Kidney Diseases, 5R01-DK-063211.


   ACKNOWLEDGMENTS
 
We thank Dr. Joseph Majzoub (Children's Hospital, Boston, MA) for providing murine UCN1 genomic clones and Dr. Mansour Shomali (John Hopkins University, Baltimore, MD) for doing in situ hybridization on the mouse brain.


   FOOTNOTES
 

Address for reprint requests and other correspondence: A. A. Zalutskaya, Endocrine Unit, Massachusetts General Hospital, Thier 1051, 55 Fruit St., Boston. MA 02114 (e-mail: azalutskaya{at}partners.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Aguilera G. Regulation of pituitary ACTH secretion during chronic stress. Front Neuroendocrinol 15: 321–350, 1994.[CrossRef][ISI][Medline]
  2. Aguilera G, Nikodemova M, Wynn PC, Catt KJ. Corticotropin releasing hormone receptors: two decades later. Peptides 25: 319–329, 2004.[CrossRef][ISI][Medline]
  3. Aguilera G, Rabadan-Diehl C, Nikodemova M. Regulation of pituitary corticotropin releasing hormone receptors. Peptides 22: 769–774, 2001.[CrossRef][ISI][Medline]
  4. Arai M, Assil IQ, Abou-Samra AB. Characterization of three corticotropin-releasing factor receptors in catfish: a novel third receptor is predominantly expressed in pituitary and urophysis. Endocrinology 142: 446–454, 2001.[Abstract/Free Full Text]
  5. Armario A, Marti O, Valles A, Dal-Zotto S, Ons S. Long-term effects of a single exposure to immobilization on the hypothalamic-pituitary-adrenal axis: neurobiologic mechanisms. Ann NY Acad Sci 1018: 162–172, 2004.[CrossRef][ISI][Medline]
  6. Atkinson HC, Waddell BJ. Circadian variation in basal plasma corticosterone and adrenocorticotropin in the rat: sexual dimorphism and changes across the estrous cycle. Endocrinology 138: 3842–3848, 1997.[Abstract/Free Full Text]
  7. Bale TL, Vale WW. CRF and CRF receptors: role in stress responsivity and other behaviors. Annu Rev Pharmacol Toxicol 44: 525–557, 2004.[CrossRef][ISI][Medline]
  8. Bittencourt JC, Vaughan J, Arias C, Rissman RA, Vale WW, Sawchenko PE. Urocortin expression in rat brain: evidence against a pervasive relationship of urocortin-containing projections with targets bearing type 2 CRF receptors. J Comp Neurol 415: 285–312, 1999.[CrossRef][ISI][Medline]
  9. Blank T, Nijholt I, Grammatopoulos DK, Randeva HS, Hillhouse EW, Spiess J. Corticotropin-releasing factor receptors couple to multiple G-proteins to activate diverse intracellular signaling pathways in mouse hippocampus: role in neuronal excitability and associative learning. J Neurosci 23: 700–707, 2003.[Abstract/Free Full Text]
  10. Chalmers DT, Lovenberg TW, De Souza EB. Localization of novel corticotropin-releasing factor receptor (CRF2) mRNA expression to specific subcortical nuclei in rat brain: comparison with CRF1 receptor mRNA expression. J Neurosci 15: 6340–6350, 1995.[Abstract/Free Full Text]
  11. Dallman MF, Akana SF, Strack AM, Scribner KS, Pecoraro N, La Fleur SE, Houshyar H, Gomez F. Chronic stress-induced effects of corticosterone on brain: direct and indirect. Ann NY Acad Sci 1018: 141–150, 2004.[CrossRef][ISI][Medline]
  12. Dautzenberg FM, Dietrich K, Palchaudhuri MR, Spiess J. Identification of two corticotropin-releasing factor receptors from Xenopus laevis with high ligand selectivity: unusual pharmacology of the type 1 receptor. J Neurochem 69: 1640–1649, 1997.[ISI][Medline]
  13. Dronjak S, Gavrilovic L, Filipovic D, Radojcic MB. Immobilization and cold stress affect sympatho-adrenomedullary system and pituitary-adrenocortical axis of rats exposed to long-term isolation and crowding. Physiol Behav 81: 409–415, 2004.[CrossRef][Medline]
  14. Dunn AJ, Berridge CW. Is corticotropin-releasing factor a mediator of stress responses? Ann NY Acad Sci 579: 183–191, 1990.[ISI][Medline]
  15. Grammatopoulos DK, Randeva HS, Levine MA, Kanellopoulou KA, Hillhouse EW. Rat cerebral cortex corticotropin-releasing hormone receptors: evidence for receptor coupling to multiple G-proteins. J Neurochem 76: 509–519, 2001.[CrossRef][ISI][Medline]
  16. Harris RB, Gu H, Mitchell TD, Endale L, Russo M, Ryan DH. Increased glucocorticoid response to a novel stress in rats that have been restrained. Physiol Behav 81: 557–568, 2004.[CrossRef][Medline]
  17. Harris RB, Mitchell TD, Simpson J, Redmann SM Jr, Youngblood BD, Ryan DH. Weight loss in rats exposed to repeated acute restraint stress is independent of energy or leptin status. Am J Physiol Regul Integr Comp Physiol 282: R77–R88, 2002.[Abstract/Free Full Text]
  18. Harris RB, Palmondon J, Leshin S, Flatt WP, Richard D. Chronic disruption of body weight but not of stress peptides or receptors in rats exposed to repeated restraint stress. Horm Behav 49: 615–625, 2006.[CrossRef][Medline]
  19. Herman JP, Prewitt CM, Cullinan WE. Neuronal circuit regulation of the hypothalamo-pituitary-adrenocortical stress axis. Crit Rev Neurobiol 10: 371–394, 1996.[ISI][Medline]
  20. Lewis K, Li C, Perrin MH, Blount A, Kunitake K, Donaldson C, Vaughan J, Reyes TM, Gulyas J, Fischer W, Bilezikjian L, Rivier J, Sawchenko PE, Vale WW. Identification of urocortin III, an additional member of the corticotropin-releasing factor (CRF) family with high affinity for the CRF2 receptor. Proc Natl Acad Sci USA 98: 7570–7575, 2001.[Abstract/Free Full Text]
  21. Muglia L, Jacobson L, Dikkes P, Majzoub JA. Corticotropin-releasing hormone deficiency reveals major fetal but not adult glucocorticoid need. Nature 373: 427–432, 1995.[CrossRef][Medline]
  22. Muller MB, Zimmermann S, Sillaber I, Hagemeyer TP, Deussing JM, Timpl P, Kormann MS, Droste SK, Kuhn R, Reul JM, Holsboer F, Wurst W. Limbic corticotropin-releasing hormone receptor 1 mediates anxiety-related behavior and hormonal adaptation to stress. Nat Neurosci 6: 1100–1107, 2003.[CrossRef][ISI][Medline]
  23. Pawlak R, Magarinos AM, Melchor J, McEwen B, Strickland S. Tissue plasminogen activator in the amygdala is critical for stress-induced anxiety-like behavior. Nat Neurosci 6: 168–174, 2003.[CrossRef][ISI][Medline]
  24. Perrin M, Donaldson C, Chen R, Blount A, Berggren T, Bilezikjian L, Sawchenko P, Vale W. Identification of a second corticotropin-releasing factor receptor gene and characterization of a cDNA expressed in heart. Proc Natl Acad Sci USA 92: 2969–2973, 1995.[Abstract/Free Full Text]
  25. Reyes TM, Lewis K, Perrin MH, Kunitake KS, Vaughan J, Arias CA, Hogenesch JB, Gulyas J, Rivier J, Vale WW, Sawchenko PE. Urocortin II: a member of the corticotropin-releasing factor (CRF) neuropeptide family that is selectively bound by type 2 CRF receptors. Proc Natl Acad Sci USA 98: 2843–2848, 2001.[Abstract/Free Full Text]
  26. Thorsell A, Carlsson K, Ekman R, Heilig M. Behavioral and endocrine adaptation, and up-regulation of NPY expression in rat amygdala following repeated restraint stress. Neuroreport 10: 3003–3007, 1999.[ISI][Medline]
  27. Tybulewicz VL, Crawford CE, Jackson PK, Bronson RT, Mulligan RC. Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene. Cell 65: 1153–1163, 1991.[CrossRef][ISI][Medline]
  28. Vale W, Spiess J, Rivier C, Rivier J. Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science 213: 1394–1397, 1981.[Free Full Text]
  29. Vaughan J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, Chan R, Turnbull AV, Lovejoy D, Rivier C, Rivier J, Sawchenko PE, Vale W. Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 378: 287–292, 1995.[CrossRef][Medline]
  30. Vetter DE, Li C, Zhao L, Contarino A, Liberman MC, Smith GW, Marchuk Y, Koob GF, Heinemann SF, Vale W, Lee KF. Urocortin-deficient mice show hearing impairment and increased anxiety-like behavior. Nat Genet 31: 363–369, 2002.[CrossRef][ISI][Medline]
  31. Wang TY, Chen XQ, Du JZ, Xu NY, Wei CB, Vale WW. Corticotropin-releasing factor receptor type 1 and 2 mRNA expression in the rat anterior pituitary is modulated by intermittent hypoxia, cold and restraint. Neuroscience 128: 111–119, 2004.[CrossRef][ISI][Medline]
  32. Wang X, Su H, Copenhagen LD, Vaishnav S, Pieri F, Shope CD, Brownell WE, De Biasi M, Paylor R, Bradley A. Urocortin-deficient mice display normal stress-induced anxiety behavior and autonomic control but an impaired acoustic startle response. Mol Cell Biol 22: 6605–6610, 2002.[Abstract/Free Full Text]
  33. Weitemier AZ, Tsivkovskaia NO, Ryabinin AE. Urocortin 1 distribution in mouse brain is strain-dependent. Neuroscience 132: 729–740, 2005.[CrossRef][ISI][Medline]
  34. Weninger SC, Peters LL, Majzoub JA. Urocortin expression in the Edinger-Westphal nucleus is up-regulated by stress and corticotropin-releasing hormone deficiency. Endocrinology 141: 256–263, 2000.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/E259    most recent
00616.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zalutskaya, A. A.
Right arrow Articles by Abou-Samra, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zalutskaya, A. A.
Right arrow Articles by Abou-Samra, A. B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.