Am J Physiol Endocrinol Metab 293: E203-E209, 2007.
First published March 27, 2007; doi:10.1152/ajpendo.00118.2007
0193-1849/07 $8.00
Nutritional regulation of adipose tissue apolipoprotein E expression
Zhi Hua Huang,1
Raul M. Luque,1,3
Rhonda D. Kineman,1,3 and
Theodore Mazzone1,2
1Department of Medicine, University of Illinois at Chicago, 2Department of Pharmacology, University of Illinois at Chicago, and 3Jesse Brown Veterans Administration Medical Center, Chicago, Illinois
Submitted 21 February 2007
; accepted in final form 21 March 2007
 |
ABSTRACT
|
|---|
Apolipoprotein E (apoE) is a multifunctional protein that is highly expressed in human and murine adipose tissue. Endogenous adipocyte apoE expression influences adipocyte triglyceride turnover and modulates the expression of genes involved in lipid synthesis and oxidation. We now demonstrate the regulation of adipose tissue apoE expression by nutritional status in lean and obese mice. Obesity induced by high-fat diet, or by hyperphagia in ob/ob mice, produces significant reduction of adipose tissue apoE expression at the protein and messenger RNA level. Fasting in C57BL/6J mice for 24 h significantly increased apoE protein and messenger RNA levels. In ob/ob mice, transplantation of adipose tissue from lean littermate controls to restore circulating leptin levels produced significant weight loss over 12 wk and also produced an increase in adipose tissue apoE expression. The increase in adipose tissue apoE expression in this model, however, did not require leptin. Adipose tissue apoE was also significantly increased in ob/ob mice after a 48-h fast or after 7 days of caloric restriction. In summary, obesity suppresses adipose tissue apoE expression, whereas fasting or weight loss increases it. From our previous observations, these changes in adipose tissue apoE expression will have significant impact on adipose tissue lipid flux and lipoprotein metabolism. Furthermore, these results suggest adipose tissue apoE participates in defending adipose tissue and organismal energy homeostasis in response to nutritional perturbation.
adipocytes; obesity
APOLIPOPROTEIN E (apoE) is a multifunctional protein with an established role in cardiovascular and neurological health (4, 17). In line with this, the apoE gene is highly expressed in cells of the nervous system and in cells important for maintaining vascular wall homeostasis, i.e., macrophages (8, 18). In these cells, apoE has been shown to play an important role in sterol flux, antioxidant defense, and cellular response to injury (4, 8, 9, 11, 13, 17, 18). It has been previously shown that apoE is highly expressed in human adipose tissue (23); however, after the initial observation, there has been little subsequent information regarding regulation of its expression or a potential physiological role for apoE in this tissue. More recently, our laboratory (22) has shown that apoE expression in adipose tissue is subject to significant regulation by peroxisome proliferator-activated receptor (PPAR)-
agonists and TNF-
in vitro and in vivo. For example, treatment of humans with impaired glucose tolerance with PPAR-
agonists (pioglitazone) or incubation of isolated adipocytes with ciglitazone significantly increases adipocyte apoE expression. TNF-
treatment of adipocytes reduces apoE expression by almost 90%. More recently, our group (10) has shown that apoE expression in murine adipose tissue, although present in adipose tissue macrophages, is largely accounted for by expression in adipocytes. By comparing lipid metabolism and gene expression in freshly isolated adipose tissue and cultured adipocytes from apoE/ mice with results from wild-type controls and by using apoE adenoviruses to restore apoE expression in adipocytes from apoE/ mice, we have established an important role for endogenous adipocyte apoE expression in adipocyte-differentiated function (10). Compared with wild-type adipocytes, adipocytes from apoE/ mice are smaller, have less triglyceride (TG) mass, have lower free fatty acid mass, and demonstrate increased expression of genes in the fatty acid oxidation pathway. The absence of apoE expression also leads to reduced TG synthesis and increased TG hydrolysis in isolated adipocytes. Furthermore, the absence of endogenous apoE expression in adipocytes reduces the accumulation of adipocyte TG in response to incubations with apoE-containing very-low-density lipoprotein (VLDL) (10). The important role of endogenous apoE expression in adipocyte TG balance is further demonstrated by experiments that examined the role of apoE in adipocytes stimulated with PPAR-
agonists. PPAR-
treatment of adipocytes leads to increased apoE expression and increased TG accumulation. In the absence of apoE expression, PPAR-
simulation produces a smaller increase in TG synthesis and significantly less adipocyte TG accumulation (10).
Although we recognize that the total absence of adipocyte apoE expression may produce downstream effects different from those produced by more graded changes in its expression level, the above results demonstrate that endogenous adipocyte apoE plays a major role in adipocyte TG turnover and energy flux. Evaluating factors that regulate endogenous apoE expression, particularly in vivo, would be important to further understand the role of adipose tissue apoE within an integrated model of adipose tissue lipid metabolism and systemic energy balance. As noted above, it is already established that adipose apoE expression is regulated by factors with established roles in organismal and adipocyte energy flux (PPAR-
agonists and TNF-
) (22). In the present study, we provide results of experiments designed to evaluate changes in the expression of adipose tissue apoE that accompany changes in organismal nutritional status. We used diet-induced and leptin-deficient obesity and examined the effects of acute and chronic caloric deprivation to evaluate nutritional regulation of adipose tissue apoE expression.
 |
MATERIALS AND METHODS
|
|---|
Animals.
All experimental procedures were approved by the Institutional Animal Care and Use Committees of the University of Illinois at Chicago and the Jesse Brown Medical Center. C57BL/6B mice were purchased from Jackson Laboratories (Bar Harbor, ME). Diet-induced obesity was generated by feeding 4-wk-old mice with a high-fat diet (fat = 60 kcal%, carbohydrate = 20 kcal%, protein = 20 kcal%; no. D12492
[GenBank]
, Research Diets, Brunswick, NJ) for 16 wk. These mice were compared with mice maintained on a lower-fat diet (fat = 10 kcal%, carbohydrate = 70 kcal%, protein = 20 kcal%; no. D12450B, Research Diets). At 20 wk, mice were weighed and killed for collection of intra-abdominal fat pads, which were weighed and used for Western blot or quantitative RT-PCR (qRT-PCR). Blood was also collected for measurement of insulin, glucose, leptin, free fatty acid, and lipid levels. ob/ob mice on a C57BL/6J background and their lean littermate controls were also purchased from Jackson Laboratories. Mice were killed at 10 wk for harvest of fat pads and blood as described above. For fasting protocols, 10-wk-old C57BL/6 were fasted for 12 or 24 h and compared with mice maintained on a standard chow diet. Ten-week-old ob/ob mice were fasted for 48 h and compared with ob/ob mice maintained on a standard chow diet for that same period. At the end of each fasting period, mice were killed as described above. To evaluate the effect of chronic caloric deprivation in this model, ob/ob mice were pair-fed with ob/ob mice undergoing subcutaneous leptin infusion [as part of another series of experiments (15)] for 7 days. This resulted in an approximately two-thirds reduction in food intake vs. ob/ob mice fed ad libitum. After 7 days of reduced caloric intake, mice were killed as described above. For adipose tissue transplantation experiments, 6-wk-old ob/ob mice were subcutaneously implanted with white adipose tissue (WAT) from 12-wk-old lean littermates as previously described (7). Approximately 1 g of adipose tissue was implanted subcutaneously through several small incisions on the shaved skin of the back. A control group of ob/ob mice were sham operated for comparison. Twelve weeks after the procedure, mice were killed as described above.
Immunoblot.
WAT was minced and lysed in radioimmunoprecipitation assay buffer supplemented with protease inhibitor cocktail for 30 min at 4°C (22). The lysate was centrifuged at 14,000 rpm for 15 min, and the supernatants were collected. Protein (15 µg) was separated on 10% SDS-PAGE gels and transferred to nitrocellulose membranes and blotted with rabbit anti-rat apoE antiserum. After incubation with primary antibody, horseradish peroxidase-conjugated secondary antibody (Pierce, Rockford, IL) immune complexes were detected by enhanced chemiluminescence (Amersham Biosciences, Piscataway, NJ) and quantitated by ZeroD scan software (Scanalytics, Fairfax, VA). A similar method was used to detect actin or tubulin signals, which were used as internal controls. Similar results for all immunoblots were obtained with actin or tubulin as internal controls or by using no correction for the apoE signal. Therefore, the actin-corrected results are presented.
mRNA quantitation by real-time PCR.
WAT was flash frozen at the time of harvest. At time of measurement, tissue was minced and total RNA was extracted with an RNeasy lipid tissue mini kit (Qiagen, Valencia, CA). First-strand cDNA was synthesized from 1 µg of total RNA using random hexamer primers according to the manufacture's instructions (first-strand cDNA synthesis kit; Fermantas, Hanover, MD). Real-time PCR was performed on each sample in triplicate with a Stratagene MX 3000P in 25 µl of total volume with the use of Brilliant SYBR green qRT-PCR master mix (Stratagene, La Jolla, CA). PCR primers (forward, reverse) utilized were as follows: murine (m)-
-actin, CTGGGACGACATGGAGAAGA, AGAGGCATACAGGGACAGCA; mapoE, AGTGGCAAAGCAACCAACC, CTTCCGTCATAGTGTCCTCCA; mF4/80, CTGGAACACTGATGTGGAGGA, AGGCAAGACATACCAGGGAGA; and mCD68, ACTTCGGGCCATGTTTCTCT, GGCTGGTAGGTTGATTGTCGT. Data were normalized for the expression of
-actin and analyzed by using comparative critical threshold (10).
Other assays.
Cellular protein, circulating free fatty acids, and glucose levels were measured as previously described. Insulin and leptin levels were measured with Linco ELISA kits (St. Charles, MO) as previously described. We used a kit from Wako (Richmond, VA) to measure total circulating plasma TG and a kit from Invitrogen (Carlsbad, CA) to measure total cholesterol (TC). Results of some of these measurements have been previously reported (15, 16) but are included here to provide context for changes in adipose tissue apoE expression.
Statistical analysis.
Results are expressed as means ± SD for immunoblot and blood measurements. For qRT-PCR, results are presented as mean values with individual values for each mouse (representing the average of 3 measurements) shown. Statistical difference of values was analyzed by Student's t-test or ANOVA with the use of SPSS (Chicago, IL). P < 0.05 was considered significant.
 |
RESULTS
|
|---|
High-fat feeding suppresses adipose tissue apoE expression.
C57BL/6J were maintained for 16 wk on a high-fat or lower-fat diet starting at 4 wk of age. At time of death, the mice on the high-fat diet weighed
39% more, and fat pads weighed over twice as much, compared with mice on the lower-fat diet (Table 1). Consistent with this increased overall body and adipose tissue weight, insulin, glucose, and leptin levels were significantly higher in mice maintained on the high-fat diet. Free fatty acid levels tended to be higher in mice on the high-fat diet, but this did not reach statistical significance. TG and TC levels were higher in high-fat diet mice, but only TC reached statistical significance. apoE expression in adipose tissue was significantly suppressed in mice on the high-fat diet (Fig. 1A). Consistent with the results of the immunoblot, apoE mRNA levels were also significantly reduced in adipose tissue obtained from mice on the high-fat diet (Fig. 1B). CD68 and F4/80 mRNA levels were significantly increased in high-fat diet mice, consistent with increased infiltration of macrophages into adipose tissue in these mice (5, 21).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1. High-fat diet reduces adipose tissue apolipoprotein E (apoE) expression. C57BL/6J mice were fed a high-fat diet (HFD) or low-fat diet (LFD) for 16 wk before adipose tissue was harvested for immunoblot of apoE (n = 3) (A) or quantitative RT-PCR (qRT-PCR) for apoE, F4/80, and CD68 mRNA levels (n = 6) (B). Results are presented as means ± SD of triplicate determinations (A) or means with individual values shown (B). Results are representative of 2 experiments with similar results. ##P < 0.01 for the difference between HFD and LFD diets.
|
|
Fasting increases apoE expression in adipose tissue.
C57BL/6J mice maintained on a chow diet were fasted for 24 h and compared with mice maintained on ad libitum access to a standard chow diet. As shown in Table 2, at the time of death, fasted mice tended to weigh less; however, this did not reach statistical significance. There was no difference in the weight of fat pads between the two groups of mice. Insulin levels, glucose levels, and leptin levels significantly fell in response to the fast; however, free fatty acid levels significantly increased in response to the 24-h fast. TG and TC levels did not change with fasting (not shown). Twelve hours of fasting did not significantly change adipose tissue apoE levels (Fig. 2A). Twenty-four hours of fasting, however, did significantly increase apoE expression. Consistent with the results of the immunoblot, apoE mRNA levels in adipose tissue were also significantly increased by the 24-h fast. CD68 and F4/80 expression also increased, indicating increased infiltration of macrophages into adipose tissue after the acute fasting period.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2. Fasting increases adipose tissue apoE expression. C57BL/6J mice (n = 5) were fasted for 12 or 24 h before adipose tissue was harvested for immunoblot of apoE (A) or qRT-PCR for apoE, F4/80, and CD68 mRNA levels (24 h) (B). Results are presented as means ± SD of 5 replicates (A) or means with individual values shown (B). Results are representative of 2 experiments with similar results. #P < 0.05 and ##P < 0.01 for the difference between fed and fasting conditions.
|
|
Adipose tissue apoE expression in ob/ob mice.
We next examined apoE expression in adipose tissue obtained from ob/ob mice or lean littermate controls. This comparison addressed whether a high-fat diet is needed to suppress apoE expression in adipose tissue or whether the same suppression would be observed in obesity secondary to hyperphagia in mice maintained on a standard chow diet. The ob/ob mice weighed significantly more and had significantly larger fat pads than lean littermate controls (Table 3). Insulin and glucose levels were also significantly higher, but free fatty acid levels were not different between the two groups of mice. Both TG and TC levels were significantly elevated in ob/ob mice. The ob/ob mice expressed significantly less apoE in freshly isolated adipose tissue (Fig. 3A). Consistent with the immunoblot results, apoE mRNA levels were also significantly lower (Fig. 3B). CD68 and F4/80 levels were also significantly higher in adipose tissue from ob/ob mice than from lean littermate controls.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3. apoE expression in adipose tissue from leptin-deficient ob/ob mice. Adipose tissue was harvested from either ob/ob or lean littermate controls and used for immunoblot of apoE (n = 4; A) or qRT-PCR for apoE, F4/80, and CD68 mRNA levels (n = 5; B). Results are presented as means ± SD of 4 determinations (A) or means with individual values shown (B). ##P < 0.01 for the difference between lean control and ob/ob mice.
|
|
To gain insight into any potential role of leptin for regulating apoE expression in adipose tissue, we performed several additional experiments in ob/ob mice. We first undertook transplantation of WAT from lean littermate controls to restore circulating leptin in ob/ob mice. As shown in Table 4, leptin levels were 0.60 ± 0.10 ng/ml in WAT-transplanted mice and nondetectable in sham-operated controls. After transplantation of wild-type WAT, ob/ob mice lost
40% of body weight over 12 wk, had significantly smaller fat pads, and had a significant reduction in circulating glucose level. The ob/ob mice that received adipose tissue transplant from lean littermate controls demonstrated a significant increase in adipose tissue apoE expression compared with sham-operated controls (Fig. 4A). Recipients of adipose tissue also had a significant increase in apoE mRNA levels in adipose tissue and significant increases in CD68 and F4/80 expression in adipose tissue (Fig. 4B).
View this table:
[in this window]
[in a new window]
|
Table 4. Circulating hormones and metabolite levels in leptin-deficient ob/ob mice under fed, fasted (48 h), and restricted diet (7 days) conditions or with WAT transplantation
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4. Adipose tissue transplantation from lean controls increases adipose tissue apoE expression in ob/ob mice. White adipose tissue (WAT) from lean littermates was transplanted into ob/ob recipient mice (n = 4) as described in MATERIALS AND METHODS. Native ob/ob adipose tissue from the recipient ob/ob mice was harvested after 12 wk for immunoblot of apoE (A) or qRT-PCR for apoE, F4/80, and CD68 mRNA levels (B). Results are presented as means ± SD of 4 determinations (A) or means with individual values shown (B). #P < 0.05 and ##P < 0.01 for the difference between the sham-transplanted and adipose-transplanted mice.
|
|
The results of the WAT transplantation experiments are consistent with the conclusion that leptin, or weight loss, influenced adipose tissue apoE in ob/ob mice. Therefore, we next fasted ob/ob mice, or maintained them on a calorie-restricted diet for 7 days, to determine the effect on adipose tissue apoE expression. Fasted ob/ob mice were compared with nonfasted ob/ob mice maintained on chow diet. Fasting in this model was prolonged for up to 48 h because these obese mice tolerated this duration of fast. Forty-eight hours of fast led to a significant reduction in body weight (Table 4). The weight of fat pads did not change. Insulin and glucose levels fell appropriately and significantly during the fast; however, free fatty acid levels were not different between fasted and fed ob/ob mice. TG and TC levels did not change significantly in fasted ob/ob mice (not shown). Similar to that shown in fasting C57BL/6J mice, fasting produced a significant increase in apoE expression in the adipose tissue of ob/ob mice (Fig. 5A). apoE mRNA levels also increased (Fig. 5B). CD68 and F4/80 levels fell in adipose tissue obtained from fasted ob/ob mice (Fig. 5B).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5. Fasting increases adipose tissue apoE expression in ob/ob mice. ob/ob mice (n = 5) were fasted for 48 h before adipose tissue was harvested for immunoblot of apoE (A) or qRT-PCR for apoE, F4/80, and CD68 mRNA levels (B). Results are presented as means ± SD of 5 determinations (A) or means with individual values shown (B). #P < 0.05 and ##P < 0.01 for the difference between fed and fasting conditions.
|
|
To gain insight into any differences between acute vs. chronic negative energy balance, we evaluated ob/ob mice maintained on two-thirds of the chow consumed by ob/ob mice allowed to feed ad libitum to evaluate the effect of chronic weight loss in the absence of leptin. Mice fed in this manner over 7 days lost 23% of body weight vs. that shown in fed ob/ob mice (Table 4). There was no significant change in the weight of fat pads, but insulin and glucose levels fell significantly. Adipose tissue apoE expression significantly increased after 7 days of reduced caloric intake (Fig. 6).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6. Chronic caloric restriction diet increases adipose tissue apoE expression in ob/ob mice. Adipose tissue was harvested from ob/ob mice on ad libitum chow diet or a calorie-restricted diet (as described in MATERIALS AND METHODS) for 7 days and used for immunoblot of apoE (n = 56; A) or qRT-PCR for apoE, F4/80, and CD68 mRNA levels (n = 5; B). Results are presented as means ± SD of 56 determinations (A) or means with individual values shown (B). #P < 0.05 and ##P < 0.01 for the difference between groups with or without calorie restriction.
|
|
 |
DISCUSSION
|
|---|
Our group (22) has previously shown that apoE expression in 3T3-L1 cells is increased by treatment with PPAR-
agonists and decreased by treatment with TNF-
(22). In murine adipose tissue, we subsequently showed that >80% of apoE expression is accounted for by adipocyte expression (10). We have also demonstrated that endogenous adipocyte apoE expression has important effects on adipocyte TG turnover and the expression of adipocyte genes related to fatty acid oxidation (10). The regulation of adipocyte apoE by PPAR-
agonists and TNF-
and its impact on adipocyte TG turnover and gene expression are consistent with an important role for endogenous adipose apoE in maintaining adipose tissue and organismal energy balance. One prediction that flows from this notion is that adipose tissue apoE would respond to systemic nutritional perturbation. The results of the present study demonstrate that adipose tissue apoE expression is significantly reduced in the presence of obesity. This reduction can be demonstrated in two different models of obesity: that induced by high-fat feeding and that resulting from hyperphagia due to deficiency of leptin. Moreover, fasting and reduction of body weight lead to increased adipose tissue apoE expression. In ob/ob mice, weight reduction by a 48-h fast or by 7 days of caloric restriction leads to increased adipose tissue apoE expression. A 12-h fast does not increase apoE expression in adipose tissue from C57BL/6J mice, but a 24-h fast does. In the latter model, body weight tended to be lower in mice fasted for 24 h, but the change was not significant. Therefore, it remains possible that fasting and negative energy balance, even in the absence of body weight reduction, can increase adipose tissue apoE expression.
In our experiments, we measured total adipose tissue apoE using immunoblot and qRT-PCR. In murine adipose tissue, apoE expression is restricted to adipocytes and adipose tissue macrophages, with >80% of expression accounted for by adipocytes (10). In the obesity models that we have studied, apoE expression was decreased, whereas markers of macrophage infiltration were increased. Therefore, it is unlikely that changes in macrophage apoE expression contributed to the decreased apoE expression level that we observed. Similar considerations apply to results obtained in ob/ob mice after a 48-h fast in which apoE expression was increased but macrophage markers decreased. In the other weight loss or fasting models, apoE expression was increased, as were the markers of macrophage infiltration. However, given the fact that
80% of adipose tissue apoE expression is accounted for by adipocytes, it is unlikely that the changes that we observed in adipose tissue apoE expression at the protein or mRNA level could be accounted for by macrophages, although this cannot be completely excluded. The increased accumulation of macrophages in adipose tissue in obesity that we observed is consistent with previously reported results obtained in human and rodent obesity (3, 5, 21). However, in humans, long-term weight loss, for example after bariatric surgery, has been shown to decrease macrophage infiltration (2). Our results show that macrophage infiltration could be increased in rodent models of short-term weight loss. Whether this difference from human results relates to species specificity or short-term vs. long-term weight loss requires further investigation.
There are several pathways by which obesity and weight loss could regulate adipose tissue apoE expression. The apoE gene has been shown to respond to PPAR-
agonists, TNF-
, and sterol content in adipocytes and macrophages (6, 19, 22, 23). Macrophage infiltration and polarization state could contribute to changes in adipocyte apoE expression in response to obesity (14). Macrophages that accumulate in adipose tissue during induction of obesity display a "classically activated" phenotype with increased levels of TNF-
expression and could be the proximate mediator of the decreased adipocyte apoE expression in the obese state that we have observed (14, 22). Our nutritional interventions also produced perturbations in the level of several hormones or metabolites known to strongly influence adipocyte gene expression. In C57BL/6J mice, diet-induced obesity increased glucose, leptin, and insulin levels and decreased adipose tissue apoE expression. Conversely, fasting in C57BL/6J mice decreased glucose, leptin, and insulin levels and increased apoE expression in adipose tissue. Given the important information indicating that adipocytes can be direct targets of leptin, glucose, and insulin (1, 12, 20), the observations in Tables 1 and 2 and Figs. 1 and 2 suggest leptin, glucose, and insulin could play roles in the modulation of adipose tissue apoE expression in response to nutritional perturbation. Although the role of insulin and glucose will require comprehensive evaluation in other in vivo models, our results address and definitively rule out a need for leptin in the modulation of adipose tissue apoE expression. Chronic weight loss after adipose tissue transplant to partially restore circulating leptin levels increased apoE expression in adipose tissue, but caloric restriction of ob/ob mice over 7 days did as well. Furthermore, adipose tissue apoE expression responded briskly to an acute fast in ob/ob mice.
Important aspects of the regulation of adipose tissue apoE and the elucidation of an important role of endogenous adipocyte apoE in adipocyte lipid turnover are very recent observations. The extent to which exogenous circulating apoE can substitute for endogenous adipocyte apoE function also remains to be more fully explored. With respect to this question, however, we have previously shown that, even after incubation in apoE-containing serum for 1014 days, TG content remains lower in apoE/ adipocytes than in wild-type adipocytes (10). We have also shown that, in freshly isolated adipose tissue, the absence of endogenous apoE expression leads to a marked defect in TG uptake from exogenous VLDL that contains apoE (10). With information now available, the changes in adipose tissue apoE expression in response to nutritional intervention can be rationalized in the following way. In adipocytes, apoE expression leads to increased TG mass, increased TG synthesis, and decreased TG hydrolysis. In view of these observations, the increased apoE expression that accompanies fasting could be viewed as a homeostatic response to limit further loss of adipocyte TG. Conversely, suppression of apoE expression in adipocytes in the obese state could represent a mechanism for minimizing further growth of adipose tissue TG stores. Although changes in adipose tissue apoE with both fasting and weight loss are statistically significant at the protein and mRNA levels, the suppression of expression in obesity is larger in magnitude than the increased expression observed with weight loss or fasting. On the basis of our previous observation (10), suppression of adipose tissue apoE will reduce adipocyte acquisition of TG from VLDL. This could contribute to altered VLDL composition and, therefore potentially, to disordered systemic VLDL metabolism that accompanies obesity.
 |
GRANTS
|
|---|
This work was supported by the Secretaria de Universidades, Investigación y Tecnología de la Junta de Andalucia (to R. M. Luque) and by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-30677 (to R. D. Kineman) and DK-71711 (to T. Mazzone).
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank Dr. Giamila Fantuzzi for critical evaluation of the manuscript and assistance with the adipose transplantative experiments and Stephanie Thompson for assistance with manuscript preparation.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: T. Mazzone, Section of Endocrinology, Diabetes and Metabolism (MC 797), Univ. of Illinois at Chicago, 1819 W. Polk St., Chicago, IL 60612 (e-mail: tmazzone{at}uic.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Bluher M, Wilson-Fritch L, Leszyki J, Laustsen PG, Corvera S, Kahn R. Role of insulin action and cell size on protein expression patterns in adipocytes. J Biol Chem 279: 3190231909, 2004.[Abstract/Free Full Text]
- Cancello R, Henegar C, Vignerie N, Taleb S, Poitou C, Rouault C, Coupaye M, Pelloux V, Hugol D, Bouillot JL, Bouloumie A, Barbatelli G, Cinti S, Svensson PA, Barsh GS, Zucker JD, Basdevant A, Langin D, Clement K. Reduction of macrophage infiltration and chemoattractant gene expression changes in white adipose tissue of morbidly obese subjects after surgery-induced weight loss. Diabetes 54: 22772286, 2005.[Abstract/Free Full Text]
- Curat CA, Miranville A, Sengenes C, Diehl M, Tonus C, Busse R, Bouloumie A. From blood monocytes to adipose tissue-resident macrophages: induction of diapedesis by human mature adipocytes. Diabetes 53: 12851292, 2004.[Abstract/Free Full Text]
- Curtiss LK, Boisvert WA. Apolipoprotein E and atherosclerosis. Curr Opin Lipidol 11: 243251, 2000.[CrossRef][ISI][Medline]
- Di Gregorio GB, Yao-Borengasser A, Rasouli N, Varma V, Lu T, Miles LM, Ranganathan G, Peterson CA, McGehee RE, Kern PA. Expression of CD68 and macrophage chemoattractant protein-1 genes in human adipose and muscle tissues: association with cytokine expression, insulin resistance, and reduction by pioglitazone. Diabetes 54: 23052313, 2005.[Abstract/Free Full Text]
- Duan H, Li Z, Mazzone T. Tumor necrosis factor-
modulates monocyte/macrophage apoprotein E gene expression. J Clin Invest 96: 915922, 1995.[ISI][Medline] - Gavrilova O, Marcus-Samuels B, Graham D, Kim JK, Shulman GI, Castle AL, Vinson C, Eckhaus M, Reitman ML. Surgical implantation of adipose tissue reverses diabetes in lipoatrophic mice. J Clin Invest 105: 271278, 2000.[ISI][Medline]
- Harris FM, Tesseur I, Brecht WJ, Xu Q, Mullendorff K, Chang S, Wyss-Coray T, Mahley RW, Huang Y. Astroglial regulation of apolipoprotein E expression in neuronal cells. J Biol Chem 279: 38623868, 2004.[Abstract/Free Full Text]
- Huang ZH, Fitzgerald ML, Mazzone T. Distinct cellular loci for the ABCA1-dependent and independent efflux mediated by endogenous apoE expression. Arterioscler Thromb Vasc Biol 26: 157162, 2006.[Abstract/Free Full Text]
- Huang ZH, Reardon CA, Mazzone T. Endogenous apoE expression modulates adipocyte triglyceride content and turnover. Diabetes 55: 3394402, 2006.[Abstract/Free Full Text]
- Kim WS, Rahmanto AS, Kamill A, Rye KA, Guillemin GJ, Gelissen IC, Jessup W, Hill AF, Garner B. Role of ABCG1 and ABCA1 in regulation of neuronal cholesterol efflux to apolipoprotein E discs and suppression of amyloid-
peptide generation. J Biol Chem 282: 28512861, 2007.[Abstract/Free Full Text] - Lin Y, Berg AH, Iyengar P, Lam TKT, Giacca A, Combs TP, Rajala MW, Du X, Rollman B, Li W, Hawkins M, Barzila N, Rhodes CJ, Fantus G, Brownlee M, Scherer PE. The hyperglycemia-induced inflammatory response in adipocytes: the role of reactive oxygen species. J Biol Chem 280: 46174626, 2005.[Abstract/Free Full Text]
- Lucic D, Huang ZH, Gu D, Altenburg MK, Maeda N, Mazzone T. Regulation of macrophage apoE secretion and sterol efflux by the LDL receptor. J Lipid Res 48: 366372, 2007.[Abstract/Free Full Text]
- Lumeng CN, Bodzin JL, Saltiel AR. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest 117: 175184, 2007.[CrossRef][ISI][Medline]
- Luque RM, Huang ZH, Shah B, Mazzone T, Kineman RD. Effects of leptin replacement on hypothalamic-pituitary growth hormone axis function and circulating ghrelin levels in ob/ob mice. Am J Physiol Endocrinol Metab 292: E891E899, 2007.[Abstract/Free Full Text]
- Luque RM, Kineman RD. Impact of obesity on the growth hormone axis: evidence for a direct inhibitory effect of hyperinsulinemia on pituitary function. Endocrinology 147: 27542763, 2006.[Abstract/Free Full Text]
- Mahley RW, Weisgraber KH, Huang Y. Apolipoprotein E4: a causative factor and therapeutic target in neuropathology, including Alzheimer's disease. Proc Natl Acad Sci USA 103: 56445651, 2006.[Abstract/Free Full Text]
- Mazzone T. ApoE secretion by macrophages; its potential physiological function(s). Curr Opin Lipidol 7: 303307, 1996.[ISI][Medline]
- Mazzone T, Gump H, Diller P, Getz GS. Macrophage free cholesterol content regulates apolipoprotein E synthesis. J Biol Chem 262: 1165711662, 1987.[Abstract/Free Full Text]
- Park BH, Wang MY, Lee Y, Yu X, Ravazzola M, Orci L, Unger RH. Combined leptin actions on adipose tissue and hypothalamus are required to deplete adipocyte fat in lean rats: implications for obesity treatment. J Biol Chem 281: 4028340291, 2006.[Abstract/Free Full Text]
- Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante AW. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 112: 17961808, 2003.[CrossRef][ISI][Medline]
- Yue L, Rasouli N, Ranganathan G, Kern PA, Mazzone T. Divergent effects of PPAR
agonists and TNF
on adipocyte apoE expression. J Biol Chem 279: 4762647632, 2004.[Abstract/Free Full Text] - Zechner R, Moser R, Newman TC, Fried SK, Breslow JL. Apolipoprotein E gene expression in mouse 3T3-L1 adipocytes and human adipose tissue and its regulation by differentiation and lipid content. J Biol Chem 266: 1058310588, 1991.[Abstract/Free Full Text]
Copyright © 2007 by the American Physiological Society.