|
|
||||||||
1Neurosignaling Laboratory, 2Neurobehavior Laboratory, and 3Antioxidant and Gene Regulation Laboratory, Pennington Biomedical Research Center, Baton Rouge; and 4Louisiana State University Agricultural Center, Baton Rouge, Louisiana
Submitted 11 December 2006 ; accepted in final form 14 March 2007
| ABSTRACT |
|---|
|
|
|---|
hypothalamus; food intake; neuropeptide; mammalian target of rapamycin
Included within this nutrient-sensing system is the ability to detect changes in protein or amino acid availability. A large body of literature indicates that changes in dietary protein influence feeding behavior (1, 3, 17, 25, 28, 3335). In addition, variations in individual amino acids are also detected by a central nutrient-sensing system, as illustrated by the rapid aversion that develops to diets that are severely imbalanced for an essential amino acid (12, 16, 29, 31) and by the fact that rats will preferentially self-select between two imbalanced diets to meet amino acid requirements (11). Taken together, the above observations support the existence of neural mechanisms that sense and respond to changes in protein or amino acid availability.
Recent work by Cota et al. (5) suggests that hypothalamic neurons participate in this protein-sensing system and that the serine/threonine kinase mammalian target of rapamycin (mTOR) is a cellular mediator of this effect. mTOR is an intracellular signaling molecule sensitive to both amino acid and growth factor signaling and is classically described as a "metabolic sensor" (7, 9). mTOR is expressed within hypothalamic Agrp and Pomc-expressing neurons and is necessary for acute suppression of food intake following central leucine administration (5). These observations are therefore consistent with a model in which hypothalamic mTOR contributes to the regulation of food intake by amino acids.
The current work focuses on the ability of amino acids to directly influence hypothalamic cells. This work demonstrates that amino acids inhibit Agrp gene expression via an mTOR-dependent mechanism, and suggests that this direct effect may contribute to alterations in food intake that occur in response to variations in amino acid availability.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Effects of a low-protein diet on food intake and hypothalamic Agrp gene expression. Male rats weighing 262 ± 1.52 g were randomly assigned to semipurified, isocaloric diets containing protein at either 20% of total energy (20% protein; control) or 10% of total energy (79 rats/group). Diet composition is provided in Table 1. Powdered diets were placed within food cups that were weighed daily, and rats were maintained on wire-bottomed cages for accurate measures of spillage. Daily food intake and body weight was monitored for 7 days, and, on day 7, rats were killed and brains collected and stored. Mediobasal hypothalamic punches were subsequently collected, and mRNA was isolated using Tri-Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's instructions. Expression of Agrp was determined using real-time PCR as described below.
|
In vitro culture of GT17 hypothalamic cell line in varying levels of amino acids. All in vitro experiments used the GT17 hypothalamic cell line, which was a generous gift from Dr. Pamela Mellon (University of California, San Diego, CA). Before study, cells were cultured in DMEM (with amino acids) containing 25 mM glucose, 10% FBS, 50 units of penicillin, and 50 µg/ml streptomycin at 37°C in 5% CO2 until becoming confluent. For subsequent studies in which amino acid concentrations were varied, DMEM with typical amino acids (100%) and DMEM without amino acids (0%) were mixed to create appropriate ratios for culture. All media contained 10 mM glucose. Chronic (16 h) experiments to assess changes in Agrp gene expression also included 1% FBS, whereas serum was absent in more acute studies of mTOR signaling.
Effects of reduce amino acid availability on Agrp gene expression in vitro. To test the effects of reduced amino acid availability on Agrp gene expression, GT17 cells were cultured for 16 h in media containing five levels of amino acids (5, 10, 25, 40, and 100%), with 100% being standard DMEM. After 16 h of culture, cells were collected, RNA was extracted, and levels of Agrp mRNA were determined using real-time PCR.
To determine whether changes in leucine concentration influence Agrp gene expression, cells were cultured for 16 h in DMEM containing no amino acids but supplemented with 40, 80, 120, and 200 µM leucine. Leucine at 40 µM represents the concentration in 5% amino acids. After 16 h of culture, cells were harvested, and Agrp mRNA levels were determined.
Effects of amino acids on mTOR signaling in hypothalamic cells. To determine whether amino acids directly impact mTOR signaling within hypothalamic cells, GT17 cells were preincubated in 5% amino acids for 7 h. Media were then removed and replaced with media containing 100% amino acids, and cells were collected 0, 10, 20, 30, 60, and 120 min following amino acid stimulation for protein extraction and Western Blot analysis of phospho-ribosomal protein S6 kinase (S6K1), as described below. To serve as a positive control, a separate experiment was conducted as above, except that cells were treated with insulin (10 mM) and then collected at the above time points for protein extraction and Western Blot analysis of phospho-S6K1.
To determine whether inhibition of mTOR signaling would block the effects of amino acids or insulin on phosphorylation of S6K1, cells were preincubated in low (5%) amino acids for 7 h as above. During the last half-hour of incubation, some groups were pretreated with rapamycin (50 nM), a pharmacological inhibitor of mTOR. Cells were then transferred to the following four conditions: 100% amino acids, insulin (10 mM), 100% amino acids plus rapamycin, or insulin plus rapamycin. After exposure to high amino acids or insulin (20 min), cells were harvested for protein extraction and Western Blot analysis of phospho-S6K1.
Effect of pharmacological inhibition of mTOR on amino acid-dependent inhibition of Agrp gene expression. GT17 cells were cultured under four different conditions consisting of basal conditions (DMEM, 1% FBS, and 10 mM glucose) with 5% amino acids or 100% amino acids. Within each group, cells were treated with either vehicle or rapamycin (50 nM) for 16 h. Subsequently, cells were harvested for RNA extraction and assessment of Agrp gene expression via real-time PCR.
Real-time PCR analysis. Total RNA was isolated with Tri-Reagent (Molecular Research Center) and quantified spectrophotometrically. Confirmation of intact 18S and 28S RNA bands was achieved by ethidium bromide staining after electrophoresis of samples in 1% agarose/formaldehyde gels. Taqman probes and primers for genes of interest were designed using PrimerExpress Software (Applied Biosystems, Branchburg, NJ) and were synthesized by Biosearch Technologies (Novato, CA). Real-time RT-PCR reactions were prepared with a Taqman 100Rxn Core Reagent Kit (Applied Biosystems). PCR amplification was carried out in optical 96-well plates in an ABI PRISM 7700 sequence detector (Applied Biosystems) under the following conditions: 48°C for 30 min, then 95°C for 10 min for one cycle, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. All expression data were normalized to 18S rRNA expression levels. Primers and probes are as follows: mouse Agrp: forward GTACCGCCACGAACCTCTGT, reverse TCCCCTGCCTTTCCCAAA, probe TCGCACCTAGCCAATGGATGTT; rat Agrp: forward TTGGCAGAGGTGCTAGATCCA, reverse AGGACTCGTGCAGCCTTACAC, probe CGAGTCTCGTTCTCCGCGTCGC; 18S rRNA: forward ACGGCCGGTACAGTGAAACT, reverse GAGCGAGCGACCAAAGGA, probe CCATAACTGATTTAATGAGCCATTCG.
Protein extraction and Western blot.
GT17 cells were harvested and placed in ice-cold lysis buffer containing 62.5 mM Tris·HCl pH 6.8, 1% SDS, and 1% protease inhibitor, and cells were homogenized via sonification. Cell lysate was then centrifuged at 10,000 g for 10 min, and supernate was collected as total protein lysates. Total protein (40 µg) was separated via SDS-PAGE and transferred to polyvinylidene difluoride membranes. Membranes were washed in TBS plus 0.1% Tween 20 (TBS-T) and blocked in TBS-T plus 5% BSA/nonfat dry milk for 1 h before incubation with primary antibodies (Cell Signaling Technology, Beverly, MA) to either phospho-S6K1 (1:2,000 dilution), total S6K1 (1:2,000 dilution), or
-actin (1:5,000 dilution) Membranes were then washed and incubated with corresponding secondary antibodies. Positive signal was imaged using a chemiluminescent substrate (ECL Reagent; Amersham Biosciences, Piscataway, NJ) and exposure to autoradiograph film. After being probed with the phospho-specific antibody, the membrane was stripped using 0.5 N NaOH for 20 min and reprobed for total antibody followed by
-actin antibody.
Statistical analysis.
Data were analyzed using the SAS software package (SAS V8; SAS Institute, Cary NC) using a two-tailed t-test or ANOVA using the general linear model (GLM) procedure. Repeated-measures analysis of changes in food intake and body weight over time was conducted using the GLM procedure of SAS. When experiment-wide tests were significant, post hoc comparisons were made using the LSMEANS statement with the PDIFF option and thus represent least-significant difference tests for preplanned comparisons. Gene expression was normalized to 18S rRNA expression levels before analysis. Densitometric analysis of the Western blot results was conducted on scanned images using the QuantityOne 1-D Analysis software (Bio-Rad). Pixel density for phosphorylated S6K was determined and normalized to levels of
-actin. Data are presented as means ± SE.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
Activation of mTOR is necessary for amino acid-dependent inhibition of Agrp gene expression. To test whether mTOR signaling contributes to amino acid-dependent inhibition of Agrp gene expression, GT17 cells were cultured in either 5 or 100% amino acids in the presence or absence of rapamycin (50 nm). As before, Agrp mRNA levels were significantly higher in cells cultured in 5% amino acids verses those cultured in 100% (P = 0.002; Fig. 7). Treatment with rapamycin had no effect on the already elevated Agrp gene expression in cells cultured in 5% amino acids. However, rapamycin pretreatment increased Agrp mRNA levels in cells cultured in 100% amino acids such that Agrp levels were significantly higher than those of cells cultured in 100% amino acids without rapamycin (P = 0.01) and similar to those cells cultured in 5% amino acids. Taken together, these observations suggest that mTOR signaling is necessary for the inhibition of Agrp gene expression by amino acids.
|
| DISCUSSION |
|---|
|
|
|---|
It is well-accepted that the manipulation of dietary protein can exert significant effects on feeding behavior (1, 25, 28, 33). Low-protein diets increase food intake (34, 35), whereas high-protein diets tend to suppress food intake (3, 17). If simultaneously offered a choice of a low- and high-protein diet, animals tend to selectively balance the consumption of each diet such that adequate protein is consumed (14). These observations highlight the significant effects that protein can exert on feeding behavior and suggest that physiological systems exist that monitor and regulate protein consumption. Although it is possible that protein status is sensed generally, several lines of observation suggest that mechanisms exist for the sensing of individual amino acids. For instance, it is well-established that diets that are severely amino acid imbalanced induce aversive responses, leading to decreased food intake (16, 26). However, if offered a choice between two diets that are imbalanced for different amino acids, rats will effectively self-select between these two diets to meet their amino acid requirements, even though each diet would be aversive if offered alone (11). Clearly these observations indicate that animals can sense changes in dietary protein, as well as variations in individual amino acids. A large body of work implicates the anterior piriform cortex in the aversive response to amino acid imbalances, and infusion of the limiting amino acid directly into the piriform cortex is sufficient to block the aversive response to amino acid imbalance (12). However, although it is clear that the anterior piriform cortex plays a critical role in the aversive response to amino acid imbalance, whether this brain area is also involved in the homeostatic regulation of feeding behavior is less clear.
One brain area that is widely accepted to play a key role in the homeostatic regulation of food intake is the hypothalamus (8). Hypothalamic neurons are sensitive to a wide range of hormones and nutrients, and thus a logical hypothesis is that these neurons might also play a role in protein sensing (20, 32). In particular, hypothalamic neurons containing the orexigenic neuropeptides AgRP and neuropeptide Y (NPY) respond to a variety of hormones and nutrients. Feeding a low-protein diet resulted in an increase in food intake, consistent with previous work (34, 35). This increased intake was accompanied by a significant increase in hypothalamic Agrp gene expression. It is unlikely that the increase in Agrp expression is secondary to the increased food intake, since increases in food intake and body weight would be predicted to suppress Agrp mRNA levels. Considering that Npy gene expression is also increased by low-protein diets (34), these data are most consistent with a model in which decreases in dietary protein activate NPY/AgRP neurons and lead to increases in food intake.
Whereas the above observations suggest that dietary amino acids influence central mechanisms regulating energy balance, these experiments do not delineate whether the detection mechanism exists within the brain or instead within peripheral tissues such as the liver or gastrointestinal tract. Brain amino acid concentrations are sensitive to changes in dietary amino acid availability as well as the concentrations of amino acids within the circulation, which supports the possibility that the brain could be directly sensitive to changes in amino acid availability (4, 6, 13). To discriminate between a direct effect of amino acids on the brain vs. an indirect effect within the periphery, third-ventricular cannulas were used to directly deliver amino acids in the brain, thus bypassing any peripheral sensing mechanism. In this model, central delivery of amino acids significantly decreased food intake (5). This observation does not rule out contributions from peripheral mechanisms, such as recent evidence that gut-derived PYY contributes to the reduction in food intake following high-protein diets (2). However, these observations do indicate that central sensing mechanisms are sufficient to mediate the effects of amino acids on feeding behavior.
A second question regarding the mechanism of central protein sensing is the nature of the signal itself. One possibility is that the brain tracks the availability of many amino acids simultaneously. However, an alternate possibility is that specific amino acids serve as markers for total protein availability. In support of this latter alternative, multiple observations suggest that the branched-chain amino acids, and particularly leucine, are well-suited to serve as nutrient signals (5, 15, 21). To test whether leucine alone was sufficient to alter feeding behavior, the effects of direct brain delivery of leucine were determined and compared with the amino acid mixture. In this paradigm, leucine alone decreased food intake similarly to the amino acid mixture. This comparison is significant considering that the amount of leucine delivered (1 µg) was the same in both treatments, but the amino acid mixture contained a large variety of additional amino acids. The efficacy of an amino acid mixture to suppress food intake was therefore similar to that of the same dose of leucine alone. In addition, subsequent experiments using higher leucine doses produced more robust decreases in food intake. Work recently published by Cota et al. (5) supports a key role of leucine, with intracerebroventricular administration of leucine significantly suppressing food intake but a similar dose of the branched-chain amino acid valine having no effect. Taken together with the current results, these observations indicate that amino acids can act locally within the brain to suppress food intake and that leucine in particular may function as a key amino acid signal within the brain, much as it does within peripheral tissues (18).
The above observations indicate that dietary amino acids suppress food intake and Agrp gene expression and that a direct action of specific amino acids on the brain may contribute to this effect. To more closely examine the cellular mechanisms mediating amino acid regulation of Agrp gene expression, we focused on the GT17 hypothalamic cell line. GT17 cells express Agrp and respond to hormonal and nutrient cues in a manner similar to hypothalamic neurons in vivo (19). Consistent with the in vivo effects of a low-protein diet, reducing amino acids levels to 10 or 5% of baseline (basal DMEM is considered 100% amino acids) resulted in a significant increase in Agrp mRNA levels in GT17 cells. This observation not only complements the in vivo observations reported here, they also indicate that changes in amino acid availability can have direct effects on Agrp gene expression.
Our previous in vivo observations indicate that leucine may act as key signal of amino acid availability. To test this hypothesis in vitro, cells cultured in low amino acid conditions were supplemented with increasing levels of leucine. Leucine replacement dose-dependently decreased Agrp gene expression in a setting of reduced amino acids, suggesting that leucine alone is sufficient to inhibit Agrp gene expression in vitro, much as it regulated feeding behavior in vivo.
If amino acids act directly to inhibit food intake and Agrp gene expression, what is the cellular mechanism mediating these effects? A large body of work suggests that amino acids, and particularly leucine, act intracellularly on the serine-threonine kinase mTOR (15, 21). mTOR is classically associated with cellular nutrient sensing and is proposed to link nutrient and growth factor signaling to cellular protein metabolism, particularly protein translation (7, 9). mTOR phosphorylates a variety of downstream signaling molecules, but S6K1 and eukaryotic initiation factor 4E-binding protein 1 are established mediators of its cellular effects on protein metabolism. Recent work by Cota et al. (5) implicates mTOR in leucine-dependent inhibition of feeding and demonstrates that mTOR signaling is active within AgRP neurons (5). Available evidence therefore suggests that mTOR is a cellular mediator of amino acid action.
To test whether amino acids directly activate mTOR signaling within a hypothalamic cell line, GT17 cells were exposed to an acute change from low to high amino acids. In this paradigm, exposure to increased amino acids increased S6K1 phosphorylation. In addition, this induction was blocked by pretreatment with rapamycin, indicating that the effects were dependent on mTOR signaling. Insulin is also a well-known activator of mTOR signaling. As with amino acids, insulin treatment also rapidly induced phosphorylation of S6K, and this effect was also sensitive to rapamycin pretreatment.
The above observations indicate that amino acids activate mTOR signaling in GT17 cells, thus raising the possibility that mTOR may mediate the effects of amino acids on Agrp gene expression. To test this hypothesis, GT17 cells were exposed to either 5 or 100% amino acids as before but were also treated with the mTOR inhibitor rapamycin. As expected, cells exposed to 5% amino acids had significantly higher levels of Agrp mRNA compared with those cultured in 100% amino acids. Rapamycin treatment had no effect in cells cultured in low amino acids, which was expected considering that mTOR signaling is reduced in situations of low amino acids. Contrastingly, rapamycin treatment significantly increased Agrp mRNA levels in cells cultured in high amino acids, effectively blocking the amino acid-dependent inhibition of Agrp expression. This observation suggests that the activation of mTOR signaling is a necessary component for amino acid inhibition of Agrp gene expression in a hypothalamic cell line.
The work presented herein represents a series of experiments supporting a direct effect of amino acids on Agrp gene expression. Changes in dietary protein exert significant effects on feeding behavior, and, based on the current work, it appears likely that at least some of these effects are mediated by a direct effect of amino acids on hypothalamic AgRP neurons. In addition, these observations also specifically implicate leucine as an important amino acid signal, since many of the effects of amino acids were replicated by leucine alone. Finally, these observations support recent work implicating mTOR as an intracellular mediator of amino acid action within the hypothalamus and indicate that amino acids can exert direct effects on Agrp gene expression via a mechanism that requires intact mTOR signaling.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. L. White, A. Whittington, M. J. Barnes, Z. Wang, G. A. Bray, and C. D. Morrison HF diets increase hypothalamic PTP1B and induce leptin resistance through both leptin-dependent and -independent mechanisms Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E291 - E299. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Proulx, D. Cota, S. C. Woods, and R. J. Seeley Fatty Acid Synthase Inhibitors Modulate Energy Balance via Mammalian Target of Rapamycin Complex 1 Signaling in the Central Nervous System Diabetes, December 1, 2008; 57(12): 3231 - 3238. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zheng and H.-R. Berthoud Neural Systems Controlling the Drive to Eat: Mind Versus Metabolism Physiology, April 1, 2008; 23(2): 75 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Luhovyy, T. Akhavan, and G. H. Anderson Whey Proteins in the Regulation of Food Intake and Satiety J. Am. Coll. Nutr., December 1, 2007; 26(6): 704S - 712S. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |