Am J Physiol Endocrinol Metab 292: E992-E999, 2007.
First published December 5, 2006; doi:10.1152/ajpendo.00492.2006

0193-1849/07 $8.00
Oxytocin-induced phasic and tonic contractions are modulated by the contractile machinery rather than the quantity of oxytocin receptor
Masaki Kawamata,1
Yutaka Tonomura,1
Tadashi Kimura,2
Yukihiko Sugimoto,3
Teruyuki Yanagisawa,4 and
Katsuhiko Nishimori1
1Department of Molecular Biology, Graduate School of Agriculture, Tohoku University, Sendai; 2Division of Obstetrics and Gynecology, Osaka University Graduate School of Medicine, Suita, Osaka; 3Department of Physiological Chemistry, Graduate School of Pharmaceutical Sciences, Kyoto University, Kyoto; and 4Department of Molecular Pharmacology, Graduate School of Medicine, 21st Century Center of Excellence Program, "CRESCENDO," Tohoku University, Sendai, Japan
Submitted 12 September 2006
; accepted in final form 28 November 2006
 |
ABSTRACT
|
|---|
To investigate the relationship between the oxytocin (OT) receptor (OTR) quantity and the contractile features systematically, we measured the mRNA expression levels of OTR and L-type Ca2+ channel
1C-subunit (
1C) and examined the regulatory mechanisms of OT-induced phasic or tonic contractions of the longitudinal smooth muscles in mouse uteri. The mRNA expression of OTR in 19.0 G (19.0 days of gestation) was greater than those in nonpregnant phases, and that of
1C in estrus and 19.0 G was higher than in diestrus. OT-induced contractions sparsely occurred in diestrus. The OT-induced all-or-none-type phasic contractions at low concentrations were abolished by verapamil in both estrus and 19.0 G. OT-induced tonic contractions had similar pD2 values in both estrus and 19.0 G. However, the magnitude in 19.0 G was much greater than that in estrus. The large tonic contractions also occurred in PGF2
receptor (FP) knockout mice in 19.0 G despite a small amount of OTR. Verapamil and Y-27632 partially inhibited the tonic contractions in 19.0 G. Cyclopiazonic acid-induced tonic contractions were reciprocally decreased with the increase in the OT-induced ones in 19.0 G. These results indicate that the phasic contractions are dependent on
1C. The tonic contractions in 19.0 G are dependent on both Ca2+ influxes via L-type Ca2+ channels and store-operated Ca2+ channels, and the force is augmented by the Rho signal pathway, which increases the Ca2+ sensitivity. Thus the uterine contractions are mainly controlled by the modification of contractile signal machinery rather than simply by the OTR quantity.
oxytocin; uterus; contraction; receptor quantity; mouse
OXYTOCIN (OT) is a well-known neurohypophysial hormone that stimulates uterine contractions to facilitate parturition (11). The near-term myometrium is extremely sensitive to OT, and the increased responsiveness to OT occurs in parallel with an increase in the number of uterine OT binding sites in rats (6, 42), humans (7), rabbits (28, 29), and cows (8). A corresponding increase in uterine OT receptor (OTR) mRNA in late pregnancy and at parturition has been reported in rats (23, 26, 38), humans (21), cows (13), and sheep (51, 55). In human uterus at term, the sensitivity to OT is 200- to 1,000-fold greater than that during the menstrual cycle (1). Thus, although there has not yet been conclusive evidence, it has been believed that the sensitivity to OT depends on the OTR quantity.
OT induces phasic or tonic contractions in myometrium. Phasic contractions are essential for the successful progression of labor, whereas tonic contractions may contribute to prevent atonic bleeding after parturition. During the course of parturition, prolonged tonic contractions might be harmful for fetuses because an increase of the intrauterine pressure would disturb the fetomaternal circulation (53). This is understandable when one appreciates that contractions occlude blood vessels within the myometrium (24). The relationship between the two types of contractions and the OTR quantity is also unknown. The mechanisms and signal pathways mediating the induction of the phasic and tonic contractions vary greatly in smooth muscles in different tissues and species (16).
There is a great advantage to examining the contractile response to OT in mouse myometrium. Using other species besides mice, it is difficult to determine the genuine OT-induced uterine contractions because of a possible cross-reactivity of OT with arginine vasopressin V1a receptor (V1aR), which coexists in myometrium in humans and other species. In mouse uteri, we revealed that V1aR was not detectable (17) and that OT did not induce any contractions in myometrium of otr knockout mice (50).
Early investigations described in vitro contractions and membrane activity in the mouse myometrium (37, 47). The influences of gestation (27), phosphatase inhibition (41), and intracellular Ca2+ concentration (30) have subsequently been reported. In this study, we analyzed the OT-induced phasic and tonic contractions in relation to the concentrations of OT to initiate the contractions, the pD2 values, and maximum responses in nonpregnant and pregnant mouse myometrium. Additionally, we examined the relationships between the OTR quantity and contractile response to clarify the regulation mechanisms of the two types of contractions.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Tissues and preparations.
Female C57BL/6 and PGF2
receptor (FP) knockout (FP KO; see Ref. 46) mice (813 wk) were used. All experiments complied with the Guidelines for the Care and Use of Laboratory Animals in Tohoku University. The cycles were determined by vaginal smears, and mice in either the estrous or diestrous phase were used. To obtain pregnant mouse myometrium, a female mouse was mated with a male overnight. The next morning, if a copulation plug was detected, was designated as 0.5 days of gestation (0.5 G). Myometrium of pregnant mice were obtained at 19.0 G. The animals were killed by cervical dislocation, and the uteri were isolated.
Quantitative RT-PCR.
We analyzed the expression levels of otr, the L-type Ca2+ channel
1C subunit (
1C), and calpains, including calpain 1, calpain 2, and calpain 4. Total RNA was extracted from longitudinal smooth muscle of uteri according to Chomczynski and Sacchi (3), and cDNA was produced from two micrograms of total RNA according to a previous study (17). For real-time quantitative PCR, 1 µl of the cDNA was added to 20 µl of reaction volume containing 10 µl DyNAmo SYBR Green qPCR kit (FINNZYMES) and 1 µl of 12.5 µM primers (forward and reverse). For each sample, a parallel reaction was set up with acidic ribosomal phosphoprotein PO (arbp) primers. The arbp was used as an endogenous control. The primer sequences used were as follows: arbp forward, ATAACCCTGAAGTGCTCGACAT; arbp reverse, GGGAAGGTGTACTCAGTCTCCA; otr forward, TTCTTCGTGCAGATGTGGAG; otr reverse, AGGACGAAGGTGGAGGAGTT;
1C forward, CCAACATCAACAATGCCAAC;
1C reverse, TCGGCTTCTTCACTCATCCT; calpain 1 forward, CGGTTGGAGGAGGTGGATGA; calpain 1 reverse, ATCACGCTTCAAGTGCACAG; calpain 2 forward, CACCCTCACCTGTGACTCCTATAA; calpain 2 reverse, ATCCTCCTCATCTTCGTCTT; calpain 4 forward, TCCACCTGAATGAGCATCTCT; and calpain 4 reverse, ATCTGTCCGGTGCCATTTT. The reactions were run in a DNA Engine Opticon System (MJ Research) with a cycling profile as follows: denaturation/activation at 95°C for 5 min, followed by 39 cycles of denaturation at 95°C for 5 s, annealing at 55°C for 30 s, and elongation at 72°C for 30 s. The annealing temperature of
1C or otr was 57 or 66.8°C, respectively. The plate read was performed after denaturation at 83°C for 1 min for the products of otr,
1C, and calpain 1 to detect the specific product. The amount of otr,
1C, or calpain mRNA was normalized to the respective arbp values. Each reaction was performed in duplicate.
Measurements of tension.
The myometrium of longitudinal smooth muscle was prepared for the in vitro contractile experiment. Contractions were recorded isometrically using a micro-easy-magnus system (UC-5A; UFER, Kyoto, Japan) as described in a previous study (17, 18). In brief, the myometrial strip was equilibrated under a resting tension of 2 mN in normal physiological salt solution containing (in mM) 140.0 NaCl, 5.0 KCl, 1.2 MgCl2, 1.8 CaCl2, 23.8 NaHCO3, and 11.1 glucose. The 65 mM KCl solution contained (in mM) 80.0 NaCl, 65 KCl, 1.2 MgCl2, 1.8 CaCl2, 23.8 NaHCO3, and 11.1 glucose. The 35 mM KCl solution was prepared by mixing 5 and 65 mM solution equally. These solutions were saturated with a 95% O2 and 5% CO2 mixture at 37°C, pH 7.4. Each strip was repeatedly exposed to 35 mM KCl solution for 15 min until the contractile responses became stable. All results are expressed as percent of the maximum response to 35 mM KCl solution. This concentration of KCl was sufficient to evoke the maximum contraction (37). Tonic contractions were induced in all samples by 35 or 65 mM KCl solution. The maximum responses in the same myometrium induced by 35 or 65 mM KCl solution were 1.44 ± 0.48, 1.19 ± 0.15, and 1.26 ± 0.17 mN or 1.15 ± 0.34, 1.17 ± 0.13, and 1.14 ± 0.13 mN in tissues from diestrus (n = 6), estrus (n = 8), and 19.0 G (n = 5), respectively. The pD2 values, maximum responses, and slope values of those concentration-response curves for OT were computer fitted to the equation as follows: E/Emax = [OT]n/([OT]n + EC50n), where E is effect, Emax is maximum effect, and n is hill coefficient. pD2 = log[EC50] (56). Agonist potency was expressed as the pD2 value, which is the negative logarithm of the concentration required to produce 50% of the maximum responses to the drug (EC50). L-type Ca2+ channels were inhibited with verapamil. Y-27632 was used as a Rho-kinase selective inhibitor. Cyclopiazonic acid (CPA) was used to deplete sarcoplasmic reticulum (SR) Ca2+ by inhibiting the SR Ca2+-ATPase.
Materials.
OT, verapamil, and CPA were obtained from Sigma-Aldrich (St. Louis, MO). Y-27632 was obtained from Calbiochem (San Diego, CA).
Statistics.
The results of the experiments are expressed as means ± SE. ANOVA and Student's t-test were used for statistical analysis of the results, and a P value <0.05 was accepted as being significantly different.
 |
RESULTS
|
|---|
Analysis of the expression level of otr, L-type Ca2+ channel
1C-subunit, and calpain mRNA in mouse uteri.
The mRNA expression levels of the otr were much greater in 19.0 G (n = 5) than in diestrus (n = 5) or estrus (n = 5) in longitudinal smooth muscle (P < 0.05; Fig. 1A). There was no difference between estrus and diestrus (Fig. 1A). The mRNA expression levels of the L-type Ca2+ channel
1C-subunit (
1C), which is a verapamil-sensitive subunit, were about 5-fold or 28-fold higher in estrus (n = 5) or 19.0 G (n = 5), respectively, than those in diestrus (n = 8, P < 0.05; Fig. 1B). We also examined the mRNA expression levels of calpains. Calpains are thought to induce the cleavage of the COOH terminus of
1C, resulting in the active form (9, 10, 12). The expression levels of calpain 1, 2, or 4 were
10.8 (n = 5, P < 0.001)-, 6.8 (n = 5, P < 0.01)-, or 4.1 (n = 5, P < 0.001)-fold higher in 19.0 G than in estrus, respectively, whereas there was no difference in diestrus and estrus.
OT-induced contractile responses of mouse uteri.
The contractions of myometrium in diestrus (n = 6), estrus (n = 8), and 19.0 G (n = 7) were analyzed. Representative recordings are shown in Fig. 2. No spontaneous contractions were observed in any tissues. Contractile responses by OT were obtained under normal physiological salt solution. In this condition, the phasic and tonic contractions induced by OT were clearly distinguished. After the administration of OT (0.01100 nM), phasic contractions were sparsely induced in some preparations of diestrus (Fig. 2A). The phasic contractions and weak tonic contractions were induced at low concentrations of OT in estrus (Fig. 2C). Large tonic contractions occurred predominantly and concentration dependently in addition to phasic contractions with high frequency in 19.0 G (Fig. 2E).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2. Contractile responses to oxytocin (OT) in mouse myometrium. Typical traces and summarized data for OT-induced contractions in diestrus (n = 6; A and B), estrus (n = 8; C and D), and 19.0 G (n = 7; E and F) are shown. Tonic contractions were induced in all tissues by 35 mM KCl solution, and the maximum responses were 1.67 ± 0.31 mN (n = 6), 1.83 ± 0.11 mN (n = 8), and 2.33 ± 0.49 mN (n = 7) in diestrus, estrus, and 19.0 G, respectively. OT was cumulatively added to the strips every 5 min under normal physiological salt solution. The cumulative concentration-response curves are shown for phasic and tonic contractions. The amplitude of the tonic contractions was measured from the baseline. The phasic contractions are measured by the subtraction of tonic ones from the phasic force of contractions. One hundred percent represents the maximum response of the contractions induced by 35 mM KCl. Data are means ± SE.
|
|
To analyze the differences in the phasic and tonic contractions, we obtained the cumulative concentration-response curves of the two types of contractions. To make the concentration-response curves, the amplitude of the tonic contractions was measured from the baseline, and the phasic contractions were measured by the subtraction of tonic ones from the phasic force of contractions. The summarized data are shown in Table 1. Phasic contractions were observed in four muscles in six diestrous myometrium; however, tonic contractions were hardly observed (Fig. 2B). A few phasic or weak tonic contractions were initiated at the concentration of 105 ± 68.4 nM (n = 4) or 4.17 ± 1.17 nM (n = 6) of OT, respectively. The contractile profile of the phasic contractions was significantly different from that of the tonic ones in estrus. Phasic contractions were more dominant than tonic ones at concentrations of OT from 0.3 to 100 nM (Fig. 2D). The pD2 values of the phasic (9.36 ± 0.10, n = 8) and tonic (8.20 ± 0.07, n = 8) contractions were significantly different (P < 0.001). The phasic or tonic contractions were initiated at the concentration of 0.38 or 1.93 nM of OT, respectively. The slope values of the phasic contractions were so high compared with those of tonic ones, showing the all-or-none nature of the phasic contractions (Table 1).
The contractile profiles of the phasic contractions were also significantly different from those of the tonic ones in 19.0 G. The subtracted values of phasic contractions were decreased since the tonic ones became predominant at the concentrations of 10100 nM of OT (Fig. 2F). There were significant differences in the pD2 values in the phasic (9.18 ± 0.16, n = 7) and tonic (8.46 ± 0.14, n = 7) contractions (P < 0.01). The maximum responses of the phasic (128.0 ± 25.7%) in 19.0 G were almost the same as in estrus (131.6 ± 13.4%), although tonic contractions (182.5 ± 20.5%) in 19.0 G were greater than those in estrus (30.7 ± 8.4%, P < 0.001). There were, however, no significant differences either in the pD2 values for the phasic (estrus: 9.36 ± 0.10; 19.0 G: 9.18 ± 0.16) and tonic (estrus: 8.20 ± 0.07; 19.0 G: 8.46 ± 0.14) contractions or in the slope values of the tonic contractions (estrus: 1.60 ± 0.28; 19.0 G: 1.55 ± 0.31). Interestingly, the tonic contractions in 19.0 G were initiated at a lower concentration of OT than were the phasic ones (0.135 vs. 1.18 nM, P < 0.001).
Large tonic contractions in 19.0 G of FP KO mice.
Sugimoto et al. (46) reported that FP KO mice failed to labor, and the expression levels of otr did not increase in uteri even at 20.0 G. We examined the expression levels of otr and contractile responses to OT in the longitudinal smooth muscle of FP KO mice in 19.0 G. The expression levels of otr were 6.0-fold lower in the myometrium of FP KO mice (n = 5) than that of wild-type mice in 19.0 G (n = 5, P < 0.01). The expression levels of
1C in the myometrium of FP KO mice at 19.0 G (n = 5) were similar to those of the wild type in 19.0 G (n = 5) and 5.2-fold higher than those of wild-type mice at estrus (n = 5, P < 0.05).
The OT-induced tonic contractions occurred in myometrium of FP KO mice in a concentration-dependent manner like wild-type mice in 19.0 G (Fig. 3, A and B). The maximum responses of the tonic contractions in FP KO mice (211.6 ± 12.0%, n = 7) were similar to the wild-type mice (182.5 ± 20.5%, n = 7).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 3. Large tonic contractions in 19.0 G of PGF2 receptor (FP) knockout (KO) mice. Typical traces (A) and summarized (B) data for OT-induced contractions are shown (n = 7). Tonic contractions were induced in all tissues by 35 mM KCl solution, and the maximum response was 1.78 ± 0.21 mN. The uterine contractions were measured by the same method as described in the legend to Fig. 2.
|
|
Effects of Ca2+-free condition, verapamil, or Y-27632 on the OT-induced contractions.
We examined the mechanism of the OT-induced phasic and tonic contractions mainly in 19.0 G of wild-type mice under a Ca2+-free condition, in the presence of an L-type Ca2+-channel blocker, verapamil, or a Rho-kinase inhibitor, Y-27632. The phasic contractions induced by 10 nM OT in estrus were abolished by the addition of verapamil (1 µM) with a reduction of the weak tonic contractions from 14.9 ± 7.5 to 9.7 ± 4.5% (n = 4; Fig. 4A). The tonic contractions induced by 10 nM OT in 19.0 G were reduced by verapamil from 188.6 ± 25.5 to 97.6 ± 14.6% (n = 5, P < 0.05; Fig. 4B).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4. Effects of Ca2+-free condition, verapamil, or Y-27632 on the OT-induced contractions. A and B: typical traces for the effects of verapamil (1 µM) on the uterine contractions induced by OT (10 nM) in estrus (n = 4; A) or 19.0 G (n = 5; B) are shown. C: typical trace for OT-induced contractions in 19.0 G under Ca2+-free solution (n = 4). OT was cumulatively added to the strips every 5 min. D and E: typical traces for OT-induced contractions in 19.0 G in the presence of verapamil (1 µM, n = 6; D) or Y-27632 (10 µM, n = 6; E). Cumulative concentration-response curves of CE and Fig. 2D are shown for phasic (F) or tonic (G) contractions in 19.0 G. One hundred percent represents the maximum response of the contractions induced by 35 mM KCl.
|
|
Under the Ca2+-free condition, OT (0.01100 nM) did not induce either type of contraction in 19.0 G (n = 4; Fig. 4C). In the presence of verapamil (1 µM), the OT-induced phasic contractions were abolished as in estrus (Fig. 4D). The maximum response of the tonic contractions was significantly decreased by verapamil from 182.5 ± 31.4 to 55.3 ± 13.1% (n = 6, P < 0.001; Fig. 4D).
The cumulative concentration-response relations for the phasic or tonic contractions of Fig. 4, CE, and Fig. 2F are summarized in Fig. 4, F and G, and the maximum amplitude, pD2 values, and slope values are shown in Table 2. In the presence of Y-27632, the maximum responses of the phasic contractions in 19.0 G were decreased from 128.0 ± 25.7% (n = 7) to 66.8 ± 22.0% (n = 6; Fig. 4F and Table 2) and those of tonic contractions from 182.5 ± 31.4% (n = 7) to 85.0 ± 12.9% (n = 6, P < 0.01; Fig. 4G and Table 2), whereas the generation of phasic contractions was not suppressed. The pD2 values of the phasic and tonic contractions were not changed by Y-27632.
Effects of CPA on mouse uteri.
Inhibition of the SR Ca2+ pump by CPA depolarizes the plasma membrane and increases intracellular Ca2+, inducing phasic and tonic contractions in rat uteri (48). Figure 5 shows the amplitudes of the phasic (left) and tonic (right) contractions induced by CPA (10 µM). CPA induced weak tonic contractions (8.1 ± 2.6%) and strong phasic ones (142.9 ± 18.9%) with high frequency in estrus (n = 6; Fig. 5, A and C). On the other hand, CPA induced strong tonic contractions in 19.0 G (n = 5; Fig. 5B). The amplitude of the tonic contractions spontaneously decreased after the maximum and became stable by 15 min in 19.0 G (transient, 130.0 ± 20.8%; stable, 65.6 ± 6.8%). The remaining tonic contractions, both in estrus and 19.0 G, were not inhibited by verapamil (1 µM; data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5. Effects of cyclopiazonic acid (CPA) on myometrium both in estrus and 19.0 G. A and B: typical traces for contractions induced by CPA (10 µM) in estrus (A) or 19.0 G (B). C: amplitude of the phasic (estrus) or apparently phasic (peak, 19.0 G) contractions (left) or stable tonic ones 15 min after the addition of CPA (right) was measured in estrus (open bar, n = 6) and 19.0 G (filled bar, n = 5). One hundred percent represents the magnitude of contractions induced by 35 mM KCl. Data are means ± SE, and significant differences were examined by ANOVA and t-test (*P < 0.05 and **P < 0.01, phasic vs. tonic; ###P < 0.001, estrus vs. 19.0 G).
|
|
To investigate whether capacitative Ca2+ entry from store-operated Ca2+ channels (SOCs) was involved in the tonic contractions induced by OT in 19.0 G, we examined the effects of CPA after the addition of OT (1100 nM). The amplitudes of the CPA-induced tonic contractions decreased in accordance with the increase in the OT concentration- and OT-induced tonic ones (Fig. 6). The OT-induced tonic contractions were reciprocally decreased with the increase in the CPA-induced ones (data not shown). These results suggest that OT and CPA used a common source of Ca2+ signaling for the genesis of the tonic contractions in 19.0 G and that, after the stimulation by OT at higher concentrations, Ca2+ entry from SOCs is involved in the strong tonic contractions.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6. Effects of CPA on the contractions induced by OT in 19.0 G. AC: typical traces for contractions induced by CPA (10 µM) after the addition of OT [1 (A), 10 (B), and 100 (C) nM]. CPA was added after the tonic contractions induced by OT became stable. D: tonic contractions induced by OT at each concentration and CPA-induced ones under the stimulation of OT at each concentration (0 nM: n = 5; 1 nM: n = 4; 10 nM: n = 5; 100 nM: n = 4). One hundred percent represents the maximum response of contractions induced by 35 mM KCl. Data are means ± SE, and significant differences were examined by ANOVA and t-test (OT-induced tonic contractions, 1 nM OT vs. other concentrations: **P < 0.01 and ***P < 0.001; CPA-induced tonic contractions, 0 nM OT vs. other concentrations: ##P < 0.01).
|
|
 |
DISCUSSION
|
|---|
In this study, we have shown the following. First, the quantity of OTR mRNA in 19.0 G was much greater than in diestrus and estrus. However, the pD2 values of the phasic contractions were similar in estrus and 19.0 G. Thus we think that the sensitivity to OT does not directly correspond to the OTR quantity. Interestingly, the phasic contractions were initiated at a lower concentration of OT in estrus than in 19.0 G.
The phasic contractions showed an all-or-none nature and were induced by Ca2+ influx via L-type Ca2+ channels, which reflects the spike activity induced by OT (37, 47). This result corresponds to that in a report using rat myometrium (39). Although the L-type Ca2+ channels activated by high KCl could generate the same force of contractions in both diestrus and estrus, the OT-induced phasic contractions seldom occurred in diestrus, reflecting the expression of L-type Ca2+ channels at a lower level that might be influenced by the levels of sex hormones estrogen and progesterone. The phasic contractions induced by OT in estrus seem to be related to the increase in the expression levels of
1C, a major pore component of the channels, which suggested the OTR signal might be coupled efficiently with the L-type Ca2+ channels in estrus. The large tonic contractions in 19.0 G are derived from the Ca2+ influx via L-type Ca2+ channels because verapamil strongly reduced the tonic ones. Furthermore, the expression levels of
1C as well as calpain 1, 2, and 4 were significantly higher in 19.0 G than in estrus. The pregnant myometrium near term might have sustained depolarization followed by Ca2+ influx via L-type Ca2+ channels. In pregnant rat myometrium, a high concentration of intracellular Ca2+ was sustained during the tonic contractions induced by OT (20). The higher level of expression of
1C may be partly involved in the tonic contractions in 19.0 G.
The nature of the tonic contractions was significantly different from that of the phasic contractions. Interestingly, the tonic contractions of 19.0 G were similar to those of estrus in terms of the pD2 and the slope values, although the maximum responses in 19.0 G were higher than those in estrus. Thus it is likely that the amplitude of the tonic contractions is dependent on the OTR quantity. Increasing the receptor density causes an increase in the maximal response with little effect on the EC50 (19); this was found by measuring the maximum phosphatidylinositol response to norepinephrine in DDT1MF-2 cells transfected with various densities of
1B-adrenergic receptors (5). The effects of verapamil and Y-27632 on the tonic contractions showed no decrease in the pD2 values, whereas the amplitude was decreased. The results of noncompetitive antagonism suggest that there seems to be no spare receptor in OTR in mouse uterus.
Uterotonic agents have been reported to increase myometrial contractions, not only by increasing the intracellular Ca2+ but also by increasing the Ca2+ sensitivity of the myometrial force production through a receptor-coupled, G protein-mediated mechanism (14, 15). One of the mechanisms of the increase in the Ca2+ sensitivity is mediated by RhoA-associated kinase (ROK; see Refs. 44 and 25). Using Y-27632, a ROK inhibitor (35), it was demonstrated that ROK was involved in the augmented tonic contractions in 19.0 G. The present study is the first investigation of the relationship between ROK activity and the tonic contractions induced by OT in mouse myometrium. The increased Ca2+ sensitivity is also related to the OT-induced phasic contractions in human (31, 34) and rat (49) myometrium. Y-27632 reduced the force of the contractions but did not affect the generation of either phasic or tonic contractions and the pD2 values of OT, which shows Y-27632 does not have any effects on OTR activation nor the Ca2+ channels. A higher expression of RhoA and ROK was observed in rat (36, 49) and human (33) uteri near term. There is a possibility that an increase of OTR might augment the Rho signals followed by the larger tonic contractions. However, the Ca2+ sensitivity also relates to the force of the spontaneous contractions (22, 52, 54) and the tonic contractions induced by depolarization by high KCl solution (22, 54, 57). These reports suggest that the pregnant myometrium gains the ability to augment the tonic contractions with an increase of Ca2+ sensitivity via Rho signals independent of the OT/OTR signals.
CPA induces large tonic contractions by capacitative Ca2+ entry in 19.0 G, but not in estrus. In pregnant rat myometrium, large tonic contractions are also induced by CPA in parallel with increases in intracellular Ca2+ concentration, but not in nonpregnant myometrium (48). This difference between the estrous and pregnant myometrium might be because of the SR volume (48), which is increased with gestation (43). The results of the present study suggest that OT induces large tonic contractions by capacitative Ca2+ entry in pregnant mouse myometrium. Similar conclusions were reported based on intracellular Ca2+ measurement in an immortalized myometrial cell line derived from a pregnant woman (32, 40). Therefore, a part of the large tonic contractions in 19.0 G myometrium might be because of the elevation of Ca2+ influx via SOCs.
The serum progesterone level was decreased in 19.0 G compared with 15.0 G and 17.0 G (data not shown). Near term, the fall in progesterone leads to a decline in uterine growth relative to fetal growth and hence increased tension development, which in turn results in increased contraction-association protein gene expression and contributes to myometrial activation (2). This might have an important role in the augmentation of the tonic contractions in 19.0 G. In the line with discussion, upregulation of OTR binding both Gq/11 and Gi could couple to the increased sensitivity to OT in pregnant rat myometrium (45) as seen in increased tonic contraction in this study. The present study and recent studies indicate that the tonic contractions in 19.0 G are mainly modulated by the contractile machinery rather than the OTR quantity. This concept is strongly supported by the data that OT could induce large tonic contractions in the myometrium of FP KO mice in 19.0 G despite the small expression of OTR. Actually, the expression levels of
1C, one main machinery of the tonic contractions, were similar in 19.0 G of FP KO mice to 19.0 G of wild-type mice. To investigate the molecular and signaling mechanisms of increased tonic contractions, the recently developed in vitro system using a cell clone from a telomerase-immortalized human myometrial cell population (4) may be promising.
In conclusion, we have described for the first time the relationship between the OTR quantity and the features of the phasic and tonic contractions. The responses of the phasic and tonic contractions are modulated by the contractile machinery under hormonal influences rather than by the OTR quantity in myometrium. Thus we should consider not only the receptor quantity but also the tissue hormonal and gestational conditions when we examine the regulation of uterine contractions during preterm birth or term parturition.
 |
GRANTS
|
|---|
This work was supported in part by Grants-in-Aid for Scientific Research (No. 14360046) from the Ministry of Education, Science, and Culture of Japan and by Sankyo Foundation of Life Science.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Keiichi Itoi for critical review of the manuscript.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: K. Nishimori, Dept. of Molecular Biology, Graduate School of Agriculture, Tohoku University, Sendai 981-8555, Japan (e-mail: knishimo{at}mail.tains.tohoku.ac.jp)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Caldeyro-Barcia R, Theobald GW. Sensitivity of the pregnant human myometrium to oxytocin (Abstract). Am J Obstet Gynecol 102: 1181, 1968.[Web of Science][Medline]
- Challis JRG, Matthews SG, Gibb W, Lye SJ. Endocrine and paracrine regulation of birth at term and preterm. Endocr Rev 21: 514550, 2000.[Abstract/Free Full Text]
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159, 1987.[Web of Science][Medline]
- Devost D, Zingg HH. Novel in vitro system for functional assessment of oxytocin action. Am J Physiol Endocrinol Metab 292: E1E6, 2007.[Abstract/Free Full Text]
- Esbenshade TA, Wang X, Williams NG, Minneman KP. Inducible expression of alpha 1B-adrenoceptors in DDT1 MF-2 cells: comparison of receptor density and response. Eur J Pharmacol 289: 305310, 1995.[CrossRef][Web of Science][Medline]
- Fuchs AR, Periyasamy S, Alexandrroa M, Soloff MS. Correlation between oxytocin receptor concentration and responsiveness to oxytocin in pregnant rat myometrium: effects of ovarian steroids. Endocrinology 113: 742749, 1983.[Abstract/Free Full Text]
- Fuchs AR, Fuchs F, Husslein P, Soloff MS. Oxytocin receptors in the human uterus during pregnancy and parturition. Am J Obstet Gynecol 150: 734741, 1984.[Web of Science][Medline]
- Fuchs AR, Helmer H, Behrens O, Liu HC, Antonian L, Chang SM, Fields MJ. Oxytocin and bovine parturition: a steep rise in endometrial oxytocin receptors precedes onset of labor. Biol Reprod 47: 937944, 1992.[Abstract]
- Gao T, Puri TS, Gerhardstein BL, Chien AJ, Green RD, Hosey MM. Identification and subcellular localization of the subunits of L-type calcium channels and adenylyl cyclase in cardiac myocytes. J Biol Chem 272: 1940119407, 1997.[Abstract/Free Full Text]
- Gerhardstein BL, Gao T, Bunemann M, Puri TS, Adair A, Ma H, Hosey MM. Proteolytic processing of the C terminus of the alpha(1C) subunit of L-type calcium channels and the role of a proline-rich domain in membrane tethering of proteolytic fragments. J Biol Chem 275: 85568563, 2000.[Abstract/Free Full Text]
- Gimpl G, Fahrenholz F. The oxytocin receptor system: structure, function, and regulation. Physiol Rev 81: 629683, 2001.[Abstract/Free Full Text]
- Helguera G, Olcese R, Song M, Toro L, Stefani E. Tissue-specific regulation of Ca2+ channel protein expression by sex hormones. Biochim Biophys Acta 1569: 5966, 2002.[Medline]
- Ivell R, Rust W, Einspanier A, Hartung S, Fields M, Fuchs AR. Oxytocin and oxytocin receptor gene expression in the reproductive tract of the pregnant cow: rescue of luteal oxytocin production at term. Biol Reprod 53: 553560, 1995.[Abstract]
- Izumi H, Byam-Smith M, Garfield RE. Gestational changes in oxytocin- and endothelin-1-induced contractility of pregnant rat myometrium. Eur J Pharmacol 278: 187194, 1995.[CrossRef][Web of Science][Medline]
- Izumi H, Bian K, Bukoski RD, Garfield RE. Agonists increase the sensitivity of contractile elements for Ca2+ in pregnant rat myometrium. Am J Obstet Gynecol 175: 199206, 1996.[CrossRef][Web of Science][Medline]
- Karaki H, Ozaki H, Hori M, Mitsui-Saito M, Amano K, Harada K, Miyamoto S, Nakazawa H, Won KJ, Sato K. Calcium movements, distribution, and functions in smooth muscle. Pharmacol Rev 49: 157230, 1997.[Abstract/Free Full Text]
- Kawamata M, Mitsui-Saito M, Kimura T, Takayanagi Y, Yanagisawa T, Nishimori K. Vasopressin-induced contraction of uterus is mediated solely by the oxytocin receptor in mice, but not in humans. Eur J Pharmacol 472: 229234, 2003.[CrossRef][Web of Science][Medline]
- Kawamata M, Tonomura Y, Kimura T, Yanagisawa T, Nishimori K. The differential coupling of oxytocin receptors to uterine contractions in murine estrous cycle. Biochem Biophys Res Commun 321: 695699, 2004.[CrossRef][Web of Science][Medline]
- Kenakin T. Human recombinant receptor system. In: Pharmacologic Analysis of Drug-Receptor Interaction (3rd ed.), edited by Mark P, Mattie B, and Mary AM. New York, Lippincott-Raven, 1997, chapt. 3, p. 5777.
- Kim BK, Ozaki H, Hori M, Takahashi K, Karaki H. Increased contractility of rat uterine smooth muscle at the end of pregnancy. Comp Biochem Physiol A Mol Integr Physiol 121: 165173, 1998.[CrossRef][Medline]
- Kimura T, Takemura M, Nomura S, Nobunaga T, Kubota Y, Inoue T, Hashimoto K, Kumazawa I, Ito Y, Ohashi K, Koyama M, Azuma C, Kitamura Y, Saji F. Expression of oxytocin receptor in human pregnant myometrium. Endocrinology 137: 780785, 1996.[Abstract]
- Kupittayanant S, Burdyga T, Wray S. The effects of inhibiting Rho-associated kinase with Y-27632 on force and intracellular calcium in human myometrium. Pflugers Arch 443: 112114, 2001.[CrossRef][Web of Science][Medline]
- Larcher A, Neculcea J, Breton C, Arslan A, Rozen F, Russo C, Zingg HH. Oxytocin receptor gene expression in the rat uterus during pregnancy and the estrous cycle and in response to gonadal steroid treatment. Endocrinology 136: 53505356, 1995.[Abstract]
- Larcombe-McDouall J, Buttell N, Harrison N, Wray S. In vivo pH and metabolite changes during a single contraction in rat uterine smooth muscle. J Physiol 518: 783790, 1999.[Abstract/Free Full Text]
- Lee YH, Hwang MK, Morgan KG, Taggart MJ. Receptor-coupled contractility of uterine smooth muscle: from membrane to myofilaments. Exp Physiol 86: 283288, 2001.[Abstract]
- Liu CX, Takahashi S, Murata T, Hashimoto K, Agatsuma T, Matsukawa S, Higuchi T. Changes in oxytocin receptor mRNA in the rat uterus measured by competitive reverse transcription-polymerase chain reaction. J Endocrinol 150: 479486, 1996.[Abstract/Free Full Text]
- Mackler AM, Ducsay CA, Veldhuis JD, Yellon SM. Maturation of spontaneous and agonist-induced uterine contractions in the peripartum mouse uterus. Biol Reprod 61: 873878, 1999.[Abstract/Free Full Text]
- Maggi M, Genazzani AD, Giannini S, Torrisi C, Baldi E, di Tomaso Munson PJ M, Rodbard D, Serio M. Vasopressin and oxytocin receptors in vagina, myometrium, and oviduct of rabbits. Endocrinology 122: 29702980, 1988.[Abstract/Free Full Text]
- Maggi M, Peri A, Giannini S, Fantoni G, Guardabasso V, Serio M. Oxytocin and V1 vasopressin receptors in rabbit endometrium during pregnancy. J Reprod Fertil 91: 575581, 1991.[Abstract/Free Full Text]
- Matthew A, Kupittayanant S, Burdyga T, Wray S. Characterization of contractile activity and intracellular Ca2+ signalling in mouse myometrium. J Soc Gynecol Investig 11: 207212, 2004.[Web of Science][Medline]
- McKillen K, Thornton S, Taylor CW. Oxytocin increases the [Ca2+]i sensitivity of human myometrium during the falling phase of phasic contractions. Am J Physiol Endocrinol Metab 276: E345E351, 1999.[Abstract/Free Full Text]
- Monga M, Campbell DF, Sanborn BM. Oxytocin-stimulated capacitative calcium entry in human myometrial cells. Am J Obstet Gynecol 181: 424429, 1999.[CrossRef][Web of Science][Medline]
- Moore F, Da Silva C, Wilde JI, Smarason A, Watson SP, Lopez Bernal A. Up-regulation of p21- and RhoA-activated protein kinases in human pregnant myometrium. Biochem Biophys Res Commun 269: 322326, 2000.[CrossRef][Web of Science][Medline]
- Moran CJ, Friel AM, Smith TJ, Cairns M, Morrison JJ. Expression and modulation of Rho kinase in human pregnant myometrium. Mol Hum Reprod 8: 196200, 2002.[Abstract/Free Full Text]
- Narumiya S, Ishizaki T, Uehata M. Use and properties of ROCK-specific inhibitor Y-27632. Methods Enzymol 325: 273284, 2000.[Web of Science][Medline]
- Niiro N, Nishimura J, Sakihara C, Nakano H, Kanaide H. Up-regulation of rho A and rho-kinase mRNAs in the rat myometrium during pregnancy. Biochem Biophys Res Commun 230: 356359, 1997.[CrossRef][Web of Science][Medline]
- Osa T. Some factors affecting the contractile responses of pregnant mouse myometrium. Jpn J Physiol 23: 401417, 1973.[Web of Science][Medline]
- Ou CW, Chen ZQ, Qi S, Lye SJ. Increased expression of the rat myometrial oxytocin receptor messenger ribonucleic acid during labor requires both mechanical and hormonal signals. Biol Reprod 59: 10551061, 1998.[Abstract/Free Full Text]
- Phillippe M, Basa A. Effects of sodium and calcium channel blockade on cytosolic calcium oscillations and phasic contractions of myometrial tissue. J Soc Gynecol Investig 4: 7277, 1997.[CrossRef][Web of Science][Medline]
- Shlykov SG, Yang M, Alcorn JL, Sanborn BM. Capacitative cation entry in human myometrial cells and augmentation by hTrpC3 overexpression. Biol Reprod 69: 647655, 2003.[Abstract/Free Full Text]
- Smith GD, Liu XT, Phillippe M. Divergence in murine myometrium spontaneous and oxytocin-stimulated contractile responses to serine/threonine protein phosphatase-1 inhibition. Biol Reprod 63: 781788, 2000.[Abstract/Free Full Text]
- Soloff MS, Alexandrova M, Fernstrom MJ. Oxytocin receptors: triggers for parturition and lactation? Science 204: 13131315, 1979.[Abstract/Free Full Text]
- Somlyo AP. Excitation-contraction coupling and the ultrastructure of smooth muscle. Circ Res 57: 497507, 1985.[Free Full Text]
- Somlyo AP, Somlyo AV. From pharmacomechanical coupling to G-proteins and myosin phosphatase. Acta Physiol Scand 164: 437448, 1998.[CrossRef][Web of Science][Medline]
- Strakova Z, Soloff MS. Coupling of oxytocin receptor to G proteins in rat myometrium during labor: Gi receptor interaction. Am J Physiol Endocrinol Metab 272: E870E876, 1997.[Abstract/Free Full Text]
- Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y, Nishimura T, Oida H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K, Murata T, Hirata M, Ushikubi F, Negishi M, Ichikawa A, Narumiya S. Failure of parturition in mice lacking the prostaglandin F receptor. Science 277: 681683, 1997.[Abstract/Free Full Text]
- Suzuki H, Kuriyama H. Comparison between prostaglandin E2 and oxytocin actions on pregnant mouse myometrium. Jpn J Physiol 25: 345356, 1975.[Web of Science][Medline]
- Taggart MJ, Wray S. Contribution of sarcoplasmic reticular calcium to smooth muscle contractile activation: gestational dependence in isolated rat uterus. J Physiol 511: 133144, 1998.[Abstract/Free Full Text]
- Tahara M, Morishige K, Sawada K, Ikebuchi Y, Kawagishi R, Tasaka K, Murata Y. RhoA/Rho-kinase cascade is involved in oxytocin-induced rat uterine contraction. Endocrinology 143: 920929, 2002.[Abstract/Free Full Text]
- Takayanagi Y, Yoshida M, Bielsky IF, Ross HE, Kawamata M, Onaka T, Yanagisawa T, Kimura T, Matzuk MM, Young LJ, Nishimori K. Pervasive social deficits, but normal parturition, in oxytocin receptor-deficient mice. Proc Natl Acad Sci USA 102: 1609616101, 2005.[Abstract/Free Full Text]
- Wathes DC, Smith HF, Leung ST, Stevenson KR, Meier S, Jenkin G. Oxytocin receptor development in ovine uterus and cervix throughout pregnancy and at parturition as determined by in situ hybridization analysis. J Reprod Fertil 106: 2331, 1996.[Abstract/Free Full Text]
- Woodcock NA, Taylor CW, Thornton S. Effect of an oxytocin receptor antagonist and rho kinase inhibitor on the [Ca2+]i sensitivity of human myometrium. Am J Obstet Gynecol 190: 222228, 2004.[CrossRef][Web of Science][Medline]
- Wray S, Jones K, Kupittayanant S, Li Y, Matthew A, Monir-Bishty E, Noble K, Pierce SJ, Quenby S, Shmygol AV. Calcium signaling and uterine contractility. J Soc Gynecol Investig 10: 252264, 2003.[CrossRef][Web of Science][Medline]
- Wray S, Burdyga T, Noble K. Calcium signalling in smooth muscle. Cell Calcium 38: 397407, 2005.[CrossRef][Web of Science][Medline]
- Wu WX, Verbalis JG, Hoffman GE, Derks JB, Nathanielsz PW. Characterization of oxytocin receptor expression and distribution in the pregnant sheep uterus. Endocrinology 137: 722728, 1996.[Abstract]
- Yanagisawa T, Ishii K, Hashimoto H, Taira N. Differential coupling to positive inotropic responses of cyclic AMP produced by stimulation of beta1- and beta2-adrenergic receptors. J Cardiovasc Pharmacol 13: 6475, 1989.[Web of Science][Medline]
- Yanagisawa T, Okada Y. KCl depolarization increases Ca2+ sensitivity of contractile elements in coronary arterial smooth muscle. Am J Physiol Heart Circ Physiol 267: H614H621, 1994.[Abstract/Free Full Text]
Copyright © 2007 by the American Physiological Society.