Am J Physiol Endocrinol Metab 291: E1274-E1280, 2006.
First published July 11, 2006; doi:10.1152/ajpendo.00117.2006
0193-1849/06 $8.00
Glucose, dexamethasone, and the unfolded protein response regulate TRB3 mRNA expression in 3T3-L1 adipocytes and L6 myotubes
Sherif Z. Yacoub Wasef,
Katherine A. Robinson,
Mary N. Berkaw, and
Maria G. Buse
Department of Medicine, Division of Endocrinology, Diabetes, and Medical Genetics, Medical University of South Carolina, Charleston, South Carolina
Submitted 13 March 2006
; accepted in final form 2 July 2006
 |
ABSTRACT
|
|---|
Tribbles 3 (TRB3) is a recently recognized atypical inactive kinase that negatively regulates Akt activity in hepatocytes, resulting in insulin resistance. Recent reports link TRB3 to nutrient sensing and regulation of cell survival under stressful conditions. We studied the regulation of TRB3 by glucose, insulin, dexamethasone (Dex), and the unfolded protein response (UPR) in 3T3-L1 adipocytes and in L6 myotubes. In 3T3-L1 adipocytes, incubation in high glucose with insulin did not increase TRB3 mRNA expression. Rather, TRB3 mRNA increased fourfold with glucose deprivation and two- to threefold after incubation with tunicamcyin (an inducer of the UPR). Incubation of cells in no glucose or in tunicamcyin stimulated the expression of CCAAT/enhancer-binding protein homologous protein. In L6 myotubes, absent or low glucose induced TRB3 mRNA expression by six- and twofold, respectively. The addition of Dex to 5 mM glucose increased TRB3 mRNA expression twofold in 3T3-L1 adipocytes but decreased it 16% in L6 cells. In conclusion, TRB3 is not the mediator of high glucose or glucocorticoid-induced insulin resistance in 3T3-L1 adipocytes or L6 myotubes. TRB3 is induced by glucose deprivation in both cell types as a part of the UPR, where it may be involved in regulation of cell survival in response to glucose depletion.
insulin resistance; insulin signaling; glucose transport; glucose depletion; glucocorticoid
IN 1999, A NOVEL PROTEIN KINASE was found to be expressed in neuronal cells undergoing apoptosis as a result of either neurotrophic factor deprivation or disruption of calcium homeostasis. It was named neuronal cell death inducible putative kinase (16). Also known as SKIP3 and Tribbles 3 (TRB3), it has a kinase-like domain with no kinase activity (22). It is induced by endoplasmic reticulum (ER) stress in neuronal cells (22) and in thyrocytes (26) and by hypoxia in human cancer cells (3). Activating transcription factor 4 (ATF4) and CCAAT/enhancer-binding protein homologous protein (CHOP) cooperate in activating the TRB3 promoter, thus suggesting an important role for TRB3 in ER stress-inducible apoptosis (21, 20). TRB3 was also shown to have complex interactions with the mitogen-activated protein kinase (MAPK) pathways (12).
TRB3 became of major interest in diabetes research when it was shown to interact with and inhibit the activity of Akt (protein kinase B), a kinase playing a central role in insulin signaling and cell proliferation. TRB3 overexpression in the liver resulted in hyperglycemia and inactivation of Akt, and its knockdown increased phosphorylation of Akt and its substrates (6). Furthermore, peroxisome proliferator-activated receptor (PPAR)
coactivator-1
(PGC-1
), a coactivator induced by fasting, glucagon, glucocorticoids, and adrenergic stimuli that results in activation of gluconeogenic enzymes and increased hepatic glucose output (33, 10), was found to be an upstream modulator of TRB3 expression in the liver, an effect mediated by PPAR
(13). TRB3 may mediate free fatty acid-induced insulin resistance in hepatocytes (30). A preliminary report indicates that, in 3T3-L1 adipocytes, TRB3 overexpression inactivated Akt, decreased glucose transporter 4 (GLUT4), translocation, and decreased glucose uptake by 50% (1).
In view of previous work linking defective Akt phosphorylation to high glucose-induced insulin resistance in 3T3-L1 adipocytes (18, 19), and to altered insulin signaling in primary adipocytes treated with dexamethasone (Dex) (4), we sought to investigate a potential role for TRB3 in the pathogenesis of both models of insulin resistance. We found no increase of TRB3 mRNA in the glucose toxicity model of insulin resistance in 3T3-L1 adipocytes, but TRB3 mRNA was elevated in 3T3-L1 adipocytes and in L6 myotubes exposed to low or no glucose and in 3T3-L1 adipocytes exposed to Dex. The low glucose- but not the Dex-induced increase in TRB3 mRNA expression appeared to be mediated, at least in part, by the unfolded protein response (UPR).
 |
MATERIALS AND METHODS
|
|---|
Materials.
Unless otherwise noted, materials were purchased from Sigma Chemical (St. Louis, MO) and were of the highest quality available.
-Minimal essential growth medium (MEM) and Dulbeccos modified Eagles medium (DMEM) were purchased from GIBCO Invitrogen (Grand Island, NY). Human recombinant insulin was a gift from Lilly Research Laboratories (Indianapolis, IN). A polyclonal antibody specific for Akt1/2, a
-tubulin antibody, and an anti-CHOP antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). A phosphospecific polyclonal antibody used to detect the phosphorylation status of Akt on Ser473 was purchased from Cell Signaling (Beverly, MA). Horseradish peroxidase-conjugated goat anti-rabbit IgG was purchased from Jackson Immunoresearch Laboratories (West Grove, PA), and enhanced chemiluminescence reagents were purchased from Pierce (Rockford, IL). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA). Primers for the real-time PCR (RT-PCR) assay were designed using the primer express software (Applied Biosystems, Foster City, CA), and were synthesized by Invitrogen, except for adiponectin primers, which were a kind gift from Dr. Richard Klein, and the 18S primers, which were as previously described (14). Gene Amp RNA PCR core kit and SYBR Green PCR Master Mix were purchased from Applied Biosystems (Foster City, CA).
Cell culture.
3T3-L1 fibroblasts were grown and differentiated into adipocytes in 3.5-cm culture dishes, as previously described (18, 8). Cells were grown to confluence in DMEM containing 25 mM glucose and 10% fetal bovine serum (FBS) at 37°C in a humidified atmosphere containing 5% CO2. Two days after confluence, cells were placed into DMEM containing 25 mM glucose, 0.5 mM isobutylmethylxanthine, 1 µM Dex, 10 µg/ml insulin, and 10% FBS for 3 days and then for 2 days into DMEM containing 25 mM glucose, 10 µg/ml insulin, and 10% FBS. Thereafter, cells were maintained in and refed every 2 days with DMEM, 25 mM glucose, and 10% FBS until used in experiments 1014 days after the start of treatment, at which time between 90 and 95% of the cells exhibited the adipocyte phenotype (18).
Cryopreserved L6 rat skeletal muscle cells (a kind gift of Dr. Amira Klip) were passaged as described previously (17, 31) in MEM growth medium containing 100 U/ml penicillin, 100 µg/ml streptomycin, 250 µg of amphotericin, and 10% FBS. To obtain differentiated myotube cultures, cells were seeded at 20,000 cells/ml into MEM medium containing 2% FBS and maintained in culture for
1 wk postconfluence before being used in experiments.
Before experiments, 3T3-L1 adipocytes and L6 muscle cells were preincubated for 18 h at 37°C with DMEM containing 1% FBS and 0, 2.5, 5, 10, or 25 mM glucose or 5 mM glucose with 100 nM Dex. 3T3-L1 adipocytes were also preincubated in 5 or 25 mM glucose in the presence of 0.6 nM insulin. In addition, time course studies of 5 mM glucose with 1 µg/ml actinomycin D, 5 mM glucose with or without 2.55 µg/ml tunicamycin, and timed incubations without glucose were conducted. Cells in all experimental conditions were studied in parallel.
RT-PCR measurement of RNA expression.
RNA was isolated from the cells with TRIzol according to the manufacturers protocol and was reverse transcribed to cDNA using random hexamers and the Gene Amp RNA PCR core kit according to the manufacturers protocol. Primer sequences are as follows, from the 5' to the 3' end: TRB3 in 3T3-L1 cells (mouse): forward TCTCCTCCGCAAGGAACCT, reverse TCTCAACCAGGGATGCAAGAG; adiponectin: forward AGGAGATCCAGGTCTTATTG, reverse CCCACACTGAATGCTGAG; TRB3 in L6 cells (rat): forward GCCTACGTGGGACCAGAGATAC, reverse CTCCAGACATCAGCCGCTTT; 18S: forward GAGCGAAAGCATTTGCCAAG, reverse GGCATCGTTTATGGTCGGAA; CHOP: forward CCACCACACCTGAAAGCAGAA, reverse AGGTGAAAGGCAGGGACTCA. RT-PCR was performed on an Applied Biosystems ABI Prism 7000 Sequence Detection System, using SYBR Green PCR Master Mix. Twenty-five microliters of reaction volume were used per well, and all samples were run in duplicate. The expression of target genes was normalized to 18S RNA measured simultaneously.
Glucose transport.
3T3-L1 adipocytes, with or without pretreatment with 100 nM Dex for 18 h, as described above, were deprived of FBS for 2 h and then incubated in glucose-free Krebs-Ringer bicarbonate-HEPES buffer at 37°C without or with 100 nM insulin for 15 min. Glucose transport was initiated by the addition of 3H-labeled 2-deoxyglucose (2-DG; 50 µM, 0.05 µCi/ml). [14C]sucrose (50 µM, 0.05 µCi/ml) was added as an extracellular space marker. After 3 min at 37°C, 2-DG transport was terminated by the addition of phloretin (48 µM). The cells were placed on ice, washed 3 times with ice-cold PBS, and solubilized with 1% Triton X-100. 3H and 14C concentrations in the cell extracts were determined by liquid scintillation spectrometry. The intracellular concentration of 2-DG was calculated by correcting for the label present in the extracellular space and was normalized to the protein concentration in the extracts, which was measured spectrophotometrically against BSA standards using Coomassie protein assay reagent (18).
Western blot for Akt, phospho-Akt, and CHOP.
In experiments where insulin-induced Akt phosphorylation was measured, cells grown on 100-mm dishes, preincubated under different conditions, were deprived of insulin (if present) and FBS for 2 h and then acutely stimulated with 100 nM insulin for 15 min. After being washed twice with HEPES-EDTA-sucrose (HES) buffer [20 mM HEPES (pH 7.4), 1 mM EDTA, 255 mM sucrose, 1 mM sodium vanadate, 1 mM sodium floride, 1 mM sodium pyrophosphate, 1 µM microcystin, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, and 10 µg/ml aprotinin], cells were lysed by shearing them 10 times through a 22-gauge needle. We chose to measure insulin-stimulated Akt activation in crude plasma membrane (PM) preparation, because membranes are enriched in activated Akt (19). Cell lysateswere centrifuged at 19,000 g for 20 min at 4°C. The pellet was layered onto a 1.12-M sucrose cushion that was centrifuged at 100,000 g for 60 min. The PM layer was collected and centrifuged at 40,000 g for 20 min. The pellet was resuspended in HES buffer containing 1% Triton X-100 and solubilized for >1 h at 4°C. It was then centrifuged at 10,000 g for 10 min, and the supernatant was analyzed by SDS-PAGE, loading 20 µg of protein/lane (19). For quantitation of CHOP protein, cells from 35-mm dishes were lysed as described above in 50 mM HEPES (pH 7.4), 1 mM EDTA, and 150 mM NaCl containing the protease inhibitors described above. To prepare total lysates, adipocytes were centrifuged for 5 min at 1,500 g. The infranatant was saved and adjusted to 1% Triton X-100, 0.5% deoxycholate, and 0.1% SDS, solubilized for 1 h at 4°C, and centrifuged for 5 min at 10,000 g. The supernatant was analyzed by SDS-PAGE, loading 20 µg of protein/lane. Proteins were then transferred to polyvinylidene difluoride membranes in 25 mM Tris, 192 mM glycine, and 10% methanol. After transfer, membranes were blocked with 5% nonfat dry milk in phosphate-buffered saline and 0.1% Tween-20 and probed with either a polyclonal antibody specific for Akt1/2 (Santa Cruz Biotechnology, Santa Cruz, CA), a phosphospecific polyclonal antibody used to detect the phosphorylation status of Akt on Ser473, a
-tubulin rabbit antibody, or anti-CHOP antibody. Horseradish peroxidase-conjugated goat anti-rabbit secondary antibodies and enhanced chemiluminescence substrate kit were used for protein detection (19).
Glucose measurement.
Glucose concentrations in the medium were measured using the Beckman glucose analyzer.
Statistical analysis.
Correlation between two parameters and the significance of the correlation was determined using Pearson correlation analysis. The significance of difference between means was evaluated by two-tailed unpaired Students t-test or by one-way ANOVA. Multiple comparison techniques with Dunnetts test for all pairwise comparisons vs. a control or Tukeys test for all pairwise comparisons were used to further examine the differences given an overall significant ANOVA F-test. P < 0.05 was considered significant.
 |
RESULTS
|
|---|
TRB3 does not mediate glucose toxicity in 3T3-L1 adipocytes but increases with glucose deprivation.
TRB3 mRNA expression in 3T3-L1 adipocytes incubated for 18 h in 5 mM glucose (G5), 5 mM glucose with 0.6 nM insulin (G5I), 25 mM glucose (G25), and 25 mM glucose with 0.6 nM insulin (G25I) was assessed. TRB3 mRNA level was significantly increased twofold in G5I but was not increased in G25I (Fig. 1A). Since insulin-resistant glucose transport develops only after incubation in G25I, but not under the other conditions (18, 19), we concluded that increased TRB3 expression does not mediate insulin resistance in this model. Incubation of cells for 18 h in glucose concentrations of 0, 2.5, 5, 10, and 25 mM (G0, G2.5, G5, G10, and G25, respectively), or in G5I and G25I, revealed an increase in TRB3 mRNA expression in G2.5 by 47% and a 4-fold increase in G0. Furthermore, there was a significant negative correlation between TRB3 mRNA level and the final glucose concentration in the medium at the end of the 18-h incubation (Fig. 1B).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 1. A: Tribbles 3 (TRB3) mRNA expression increases following 18-h incubation of 3T3-L1 adipocytes in 5 mM glucose + 0.6 nM insulin. *P < 0.005 by Students t-test, P < 0.05 by ANOVA followed by Dunnetts test. TRB3 mRNA expression was decreased in cells incubated in 25 mM glucose + 0.6 nM insulin by Students t-test (P < 0.05), but not by ANOVA. TRB3 mRNA is expressed as the ratio of TRB3 mRNA/18S mRNA, and values are normalized to those observed in cells incubated in 5 mM glucose (G5). Means ± SE are shown. (n = 711). B: inverse correlation between glucose concentrations in medium at the end of incubation and the expression of TRB3 mRNA. Pearson correlation coefficient: 0.33 (P = 0.03). G0, G2.5, G5, G10, and G25, 18-h incubation in 0, 2.5, 5, 10, and 25 mM glucose, respectively; G5I, 5 mM glucose + 0.6 nM insulin; G25I, 25 mM glucose + 0.6 nM insulin. Compared with G5, TRB3 expression was significantly higher in G0, G2.5, and G5I and lower in G25I by Students t-test (*P < 0.05, **P < 0.01, ***P < 0.005, n = 4 for G10 and 711 for the other conditions).
|
|
Higher levels of TRB3 mRNA at low glucose concentrations are due to increased mRNA synthesis and occur later than 6 h postincubation.
One microgram per milliliter actinomycin D, an inhibitor of mRNA transcription (5), was added to cells incubated in either 0 or 25 mM glucose (G0 and G25, respectively). TRB3 mRNA expression was assessed at baseline, 1, 2, and 6 h after incubation and plotted against time (Fig. 2A). TRB3 mRNA levels decreased to <50%, 2 h postincubation, in both G0 and G25. Furthermore, the trend line for log TRB3 mRNA expression was similar for G0 and G25, denoting an equal rate of decay.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 2. A: mRNA expression decays similarly in actinomycin D-treated cells, irrespective of glucose concentration. Computer-generated trend line for log (TRB3/18S) mRNA expression. Cells were incubated with 1 µg/ml actinomycin D in 25 mM (G25x) or no glucose (G0x) containing medium. Parallel decay of mRNA suggests that glucose concentration does not affect mRNA stability (slope ± SE for G0x = 0.142 ± 0.033, r = 0.97. Slope ± SE for G25x = 0.141 ± 0.035, r = 0.943, n = 35). B: time course for TRB3 and CCAAT/enhancer-binding protein homologous protein (CHOP) mRNA expression in 3T3-L1 adipocytes. CHOP mRNA level is significantly increased 4, 6, 8, and 12 h after incubation in G0x. TRB3 mRNA level significantly increases 12 h after incubation in G0x, but not at earlier time points. (*P < 0.05, **P < 0.01, ***P < 0.005, n = 38).
|
|
To evaluate the time required for TRB3 and CHOP mRNA to increase in 3T3-L1 cells incubated in no glucose, we conducted a time course experiment where RNA was isolated at times 0, 2, 4, 6, 8, and 12 h after incubation in medium devoid of glucose (Fig. 2B). Compared with baseline, CHOP mRNA was significantly increased as early as 4 h after incubation, whereas TRB3 mRNA was significantly increased 12 h after incubation, but not at the earlier time points.
The glucose deprivation-induced increase in TRB3 mRNA may be mediated by the UPR.
3T3-L1 cells incubated in G0 for 18 h, but not in G25 or in Dex, had a 93% increase in GADD153/CHOP protein (growth arrest and DNA damage-inducible gene, CHOP) compared with G5 (Fig. 3A), a result consistent with previous reports of glucose deprivation causing the UPR (25). To further investigate the relationship between UPR and TRB3, we tested the effect of tunicamycin, an inducer of the UPR by prevention of protein glycosylation (2) on CHOP protein and on TRB3 mRNA expression. Tunicamycin caused an increase in CHOP protein (Fig. 3B) and in TRB3 mRNA levels as early as 4 h after treatment, with the peak increase being between 6 and 8 h postincubation (Fig. 3C).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 3. Relationship between TRB3 and the unfolded protein response. A: Western blot for CHOP protein in 3T3-L1 adipocytes incubated overnight with 0, 5, 25, or 5 mM glucose with 100 nM dexamethasone (Dex). CHOP protein increased by 93% in cells incubated in no glucose (*P < 0.01, n = 16), but not in the other conditions. B: addition of 2.5 µg/ml tunicamycin for 4 h to 3T3-L1 adipocytes incubated in 5 mM glucose (G5) caused a 3-fold increase in CHOP protein (*P < 0.01, n = 4). C: real-time PCR analysis of TRB3/18S mRNA in 3T3-L1 adipocytes exposed to 2.5 or 5 µg/ml tunicamycin for variable lengths of time, showing a significant increase in TRB3 expression (*P < 0.05, **P < 0.01, n = 48).
|
|
Glucose depletion increases TRB3 mRNA level in L6 myotubes.
L6 myotubes are widely used as a model for skeletal muscle, since they express GLUT4 and accelerate glucose transport in response to insulin. Consistent with our results in fat cells, L6 cells incubated without glucose or with 2.5 mM glucose had a 6- and 2-fold increase in TRB3 mRNA expression, respectively, compared with those incubated in 5 mM glucose (Fig. 4).

View larger version (5K):
[in this window]
[in a new window]
|
Fig. 4. TRB3 mRNA by RT-PCR in L6 myotubes. G0, G2.5, G5, G10, and G25, incubation overnight in 0, 2.5, 5, 10, and 25 mM glucose, respectively. Compared with G5, G0 and G2.5 had 6- and 2-fold higher mRNA expression, respectively, whereas G25 had 24% less TRB3 mRNA expression (*P < 0.05, ** P < 0.01, n = 6).
|
|
Dex increases TRB3 mRNA expression in 3T3-L1 adipocytes but not in L6 myotubes.
In 3T3-L1 adipocytes, exposure to 100 nM Dex for 18 h increased TRB3 mRNA expression 2-fold while decreasing adiponectin mRNA expression by one-half (Fig. 5, A and B). In L6 myotubes, exposure to Dex at the same dose and for the same duration of time decreased TRB3 mRNA expression by 16% (Fig. 5C). In 3T3-L1 cells, basal and acutely insulin-stimulated glucose transport were significantly reduced after preincubation with 100 nM Dex (Fig. 5D). PM-associated Akt phosphorylation decreased by 18% after incubation in 100 nM Dex, by 33% after incubation in 5 mM glucose with 0.6 nM insulin, and by 50% after incubation in 25 mM glucose with 0.6 nM insulin, whereas no change was seen in cells incubated in no glucose, 2.5 mM, 10 mM, or 25 mM glucose (Fig. 5E). We previously reported that total Akt expression was unchanged after preincubation with the various glucose concentrations, with or without 0.6 nM insulin (19). Preincubation with 100 nM Dex had no effect on the expression of total Akt, as determined by Western blot of the PM preparation (99.5 ± 14.1% of that observed in controls, n = 10; data not shown).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5. Effects of Dex in 3T3-L1 adipocytes and L6 myotubes. A: 3T3-L1 adipocytes incubated overnight in 100 nM Dex expressed 2 times more TRB3 mRNA than control cells (P < 0.05, n = 10). B: the same conditions caused a 53% reduction in adiponectin mRNA expression (P < 0.001, n = 7). C: in L6 myotubes, the same conditions decreased TRB3 mRNA expression by 16% (P < 0.001, n = 12). D: addition of 100 nM Dex to the medium of 3T3-L1 adipocytes for 18 h caused a significant reduction in basal and insulin-stimulated glucose transport (*P < 0.05, **P < 0.01, n = 6). E: acute insulin-stimulated Ser473 Akt phosphorylation by Western blot. The abscissae indicate the conditions during 18 h of incubation. All samples were stimulated with 100 nM insulin for 15 min before the cells were lysed and the plasma membranes prepared as described in MATERIALS AND METHODS. Under these conditions, >95% of Ser473 phosphorylation is attributable to the acute insulin stimulation, and the basal phosphorylation (not shown) is barely detectable. Cells incubated in 100 nM Dex had 18% less phosphorylated Akt (p-Akt) than control cells by Students t-test (P < 0.05), but this did not reach statistical significance by ANOVA followed by Dunnetts test (P < 0.08). Akt phosphorylation was reduced 33% in cells incubated with 5 mM glucose + 0.6 nM insulin and 50% in cells incubated with 25 mM glucose + 0.6 nM insulin (P < 0.05 by Students t-test and by ANOVA). However, low or absent glucose did not affect Akt activation.
|
|
 |
DISCUSSION
|
|---|
We (19) have previously shown that preincubation of 3T3-L1 adipocytes for 18 h in medium containing 0.6 nM insulin in the presence of 5 or 25 mM glucose resulted in decreased Akt translocation to the PM in response to acute insulin stimulation, as well as a decrease in serine (and threonine) phosphorylation of PM-associated Akt. The inhibition of Akt activation was greater in cells preincubated in G25I than in G5I, and only the former developed insulin resistance, as shown by a decrease in the acute maximal insulin-stimulated glucose transport (18, 19). Given the recently identified role of TRB3 as a negative modulator of Akt activity in the liver of mice (6), we sought to investigate a possible role for TRB3 in mediation of glucose toxicity in fat cells by interfering with Akt in cells incubated with high glucose in the presence of insulin. Contrary to the anticipated results, TRB3 mRNA expression did not increase in G25I but did increase in G5I. We hypothesized that such an increase is not a direct insulin effect but is the result of decreased glucose concentrations in the medium due to incubation with insulin for 18 h. Indeed, G0 and G2.5 had a significantly higher TRB3 level than G5, both in 3T3-L1 and in L6 cells (Figs. 1B and 4). TRB3 mRNA expression negatively correlated with glucose concentrations in medium at the end of incubation, whether the paucity of glucose was the result of preincubation at low glucose concentrations (G0 and G2.5) or of glucose consumption by cells due to the presence of insulin (G5I; Fig. 1B). While this article was in preparation, the induction of TRB3 by glucose or amino acid deprivation in PC3 cells was reported, which is consistent with our findings (29). TRB3 seems to be induced by some cellular stressors, such as ER stress (3, 2022) and nutrient starvation (29), but not by other stressors, such as osmotic stress or serum deprivation (29).
Next, we found the rate of decline of TRB3 mRNA expression in cells incubated in 25 mM or no glucose, in the presence of actinomycin D, to be similar, suggesting that the increased TRB3 expression in the absence of glucose is mediated by an increased rate of transcription rather than increased mRNA stability (Fig. 2A). The second observation was that the TRB3 mRNA half-life was less than 2 h. Since the increase in TRB3 mRNA expression with glucose deprivation took 12 h to occur (Fig. 2B), low glucose may not be exerting its effects directly on TRB3 gene expression but may be acting through an intermediary event, such as the UPR.
UPR is a complex pathway initiated in response to accumulation of unfolded proteins in the ER lumen, causing an enhanced transcription of genes involved in ER protein folding and a generalized slowing of protein synthesis at the level of translation, presumably to alleviate the ER load (2, 15, 24, 27). Glucose deprivation (15, 25) and tunicamcyin (2) are known inducers of the UPR. The mammalian transcription factor ATF4 (9) and the proapoptotic transcription factor CHOP (34) are downstream UPR mediators. ATF4 mediates thapsigargin and arsenite-induced activation of TRB3 promoter in HepG2 cells (21). Furthermore, ATF4 and CHOP were shown to cooperate in mediation of tunicamycin-dependent TRB3 promoter induction (20). In our hands, glucose deprivation significantly increased CHOP mRNA as early as 4 h after incubation (Fig. 2B). Both lack of glucose and tunicamycin exposure increased CHOP protein in 3T3-L1 adipocytes (Fig. 3, A and B). Tunicamycin increased TRB3 mRNA expression (Fig. 3C). These findings are consistent with glucose deprivation inducing the UPR, and upregulating TRB3 mRNA, possibly through the ATF4/CHOP pathway. However, we observed no effect of increased TRB3 expression on insulin-induced Akt activation (compare G0 with G5;
Fig. 5E). Although Akt activation was decreased in cells preincubated in G5I (with increased TRB3 induction), it was even more suppressed in cells preincubated in G25I, where TRB3 was unchanged. Thus the glucose/insulin-induced downregulation of Akt activation (19) appears to be independent of TRB3 expression.
Glucocorticoids cause insulin resistance in fat and muscle in part by decreasing insulin-stimulated Akt phosphorylation (4, 28). Since TRB3 negatively regulates Akt (6), we investigated the potential role of TRB3 in glucocorticoid-induced insulin resistance. In agreement with previous studies (4, 28, 7), exposure of 3T3-L1 cells to Dex mildly decreased PM-associated Akt phosphorylation, basal, and acutely insulin-stimulated glucose transport and adiponectin mRNA expression. TRB3 mRNA levels increased twofold in 3T3-L1 adipocytes, but no increase was found in L6 myotubes (Fig. 5, A and C). A similar discrepancy was reported, with Dex causing a two- to threefold induction of TRB3 mRNA in Fao hepatocytes (6) but no change in primary rat hepatocytes (11). Tissue and/or species specificity may explain the variability in glucocorticoid effects on TRB3 mRNA expression in different cells. Although Dex induced TRB3 mRNA in 3T3-L1 adipocytes, this effect may not account for the glucocorticoid-induced insulin resistance, since Akt phosphorylation was not impaired with glucose deprivation despite an even greater TRB3 mRNA induction. It should be noted, however, that mRNA expression does not necessarily correlate with protein expression. We were unable to quantify TRB3 protein because the available antibody (6) was not sensitive enough to detect endogenous TRB3 in our hands.
In conclusion, TRB3 does not mediate glucotoxicity in 3T3-L1 adipocytes and is probably not the mediator of glucocorticoid-induced insulin resistance. It is induced by glucose deprivation in 3T3-L1 adipocytes and in L6 myotubes, likely as a part of the UPR. Glucocorticoids induce TRB3 mRNA in 3T3-L1 and decrease its expression in L6 cells. By its interactions with ATF4/CHOP, TRB3 may be involved in regulation of cell survival in response to stressful conditions, such as nutrient starvation. Although TRB3 can interact with Akt in vitro and has been shown to blunt Akt activation when markedly overexpressed in liver cells (6), the moderate changes in TRB3 expression observed in 3T3-L1 adipocytes (2- to 4-fold) did not blunt insulin-induced Akt activation. One needs to keep in mind that TRB3 also appears to regulate the activation of several MAPKs, likely at the MAPKK step, and that the effects are cell type specific and can both synergize and antagonize (12). In view of recent reports linking ER stress to peripheral insulin resistance and to the development of atherosclerosis (23, 32), further studies are needed to elucidate the role of TRB3 in apoptosis and in diabetes.
 |
GRANTS
|
|---|
This work was supported in part by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-02001 to M. G. Buse.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Richard Klein for the gift of adiponectin primers, Dr. Gian Re for helpful discussions, and Dr. Amira Klip for the gift of L6 myoblasts. This work was presented in part at the 65th Annual Meeting of the American Diabetes Association, June 2005 (San Diego, CA), and was published as an abstract (Diabetes 54, Suppl 1: A322, 2005).
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: M. G. Buse, 96 Jonathan Lucas St., CSB 823, Charleston, SC 29425 (e-mail: busemg{at}musc.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Babendure JL, Heredia J, Imamura T, Lu JC, Montminy M, and Olefsky JM. TRB3 overexpression inhibits GLUT4 translocation and glucose uptake in 3T3-L1 adipocytes (Abstract). Diabetes 54: A54, 2005.
- Benedetti C, Fabbri M, Sitia R, and Cabibbo A. Aspects of gene regulation during the UPR in human cells. Biochem Biophys Res Commun 78: 530536, 2000.
- Bowers AJ, Scully S, and Boylan JF. SKIP3, a novel Drosophila tribbles ortholog, is overexpressed in human tumors and is regulated by hypoxia. Oncogene 22: 28232835, 2003.[CrossRef][ISI][Medline]
- Buren J, Liu HX, Jensen J, and Eriksson JW. Dexamethasone impairs insulin signalling and glucose transport by depletion of insulin receptor substrate-1, phosphatidylinositol 3-kinase and protein kinase B in primary cultured rat adipocytes. Eur J Endocrinol 146: 419429, 2002.[Abstract]
- Chen YH, Hung PF, and Kao YH. IGF-I downregulates resistin gene expression and protein secretion. Am J Physiol Endocrinol Metab 288: E1019E1027, 2005.[Abstract/Free Full Text]
- Du K, Herzig S, Kulkarni RN, and Montminy M. TRB3: a tribbles homolog that inhibits Akt/PKB activation by insulin in liver. Science 300: 15741577, 2003.[Abstract/Free Full Text]
- Fasshauer M, Klein J, Neumann S, Eszlinger M, and Paschke R. Hormonal regulation of adiponectin gene expression in 3T3-L1 adipocytes. Biochem Biophys Res Commun 290: 10841089, 2002.[CrossRef][ISI][Medline]
- Frost S and Lane M. Evidence for the involvement of vicinal sulfhydryl groups in insulin-activated hexose transport by 3T3-L1 adipocytes. J Biol Chem 260: 26462652, 1985.[Abstract/Free Full Text]
- Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, Sadri N, Yun C, Popko B, Paules R, Stojdl DF, Bell JC, Hettmann T, Leiden JM, and Ron D. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol Cell 11: 619633, 2003.[CrossRef][ISI][Medline]
- Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz G, Yoon C, Puigserver P, Spiegelman B, and Montminy M. CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413: 179183, 2001.[CrossRef][Medline]
- Iynedjian PB. Lack of evidence for a role of TRB3/NIPK as an inhibitor of PKB-mediated insulin signalling in primary hepatocytes. Biochem J 386: 113118, 2005.[CrossRef][ISI][Medline]
- Kiss-Toth E, Bagstaff SM, Sung HY, Jozsa V, Dempsey C, Caunt JC, Oxley KM, Wyllie DH, Polgar T, Harte M, Oneill LA, Qwarnstrom EE, and Dower SK. Human tribbles, a protein family controlling mitogen-activated protein kinase cascades. J Biol Chem 279: 4270342708, 2004.[Abstract/Free Full Text]
- Koo SH, Satoh H, Herzig S, Lee CH, Hedrick S, Kulkarni R, Evans RM, Olefsky J, and Montminy M. PGC-1 promotes insulin resistance in liver through PPAR-alpha-dependent induction of TRB-3. Nat Med 10: 530534, 2004.[CrossRef][ISI][Medline]
- Lagathu C, Bastard JP, Auclair M, Maachi M, Capeau J, and Caron M. Chronic interleukin-6 (IL-6) treatment increased IL-6 secretion and induced insulin resistance in adipocyte: prevention by rosiglitazone. Biochem Biophys Res Commun 311: 372379, 2003.[CrossRef][ISI][Medline]
- Ma Y and Hendershot LM. The unfolding tale of the unfolded protein response. Cell 107: 827830, 2001.[CrossRef][ISI][Medline]
- Mayumi-Matsuda K, Kojima S, Suzuki H, and Sakata T. Identification of a novel kinase-like gene induced during neuronal cell death. Biochem Biophys Res Commun 258: 260264, 1999.[CrossRef][ISI][Medline]
- Mitsumoto Y and Klip A. Development regulation of the subcellular distribution and glycosylation of GLUT1 and GLUT4 glucose transporters during myogenesis of L6 muscle cells. J Biol Chem 267: 49574962, 1992.[Abstract/Free Full Text]
- Nelson BA, Robinson KA, and Buse MG. High glucose and glucosamine induce insulin resistance via different mechanisms in 3T3-L1 adipocytes. Diabetes 49: 981991, 2000.[Abstract]
- Nelson BA, Robinson KA, and Buse MG. Defective Akt activation is associated with glucose- but not glucosamine-induced insulin resistance. Am J Physiol Endocrinol Metab 282: E497E506, 2002.[Abstract/Free Full Text]
- Ohoka N, Yoshii S, Hattori T, Onozaki K, and Hayashi H. TRB3, a novel ER stress-inducible gene, is induced via ATF4-CHOP pathway and is involved in cell death. EMBO J 24: 12431255, 2005.[CrossRef][ISI][Medline]
- Ord D and Ord T. Characterization of human NIPK (TRB3, SKIP3) gene activation in stressful conditions. Biochem Biophys Res Commun 330: 210218, 2005.[CrossRef][ISI][Medline]
- Ord D and Ord T. Mouse NIPK interacts with ATF4 and affects its transcriptional activity. Exp Cell Res 286: 308320, 2003.[CrossRef][ISI][Medline]
- Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E, Tuncman G, Gorgun C, Glimcher LH, and Hotamisligil GS. Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306: 457461, 2004.[Abstract/Free Full Text]
- Pahl HL. Signal transduction from the endoplasmic reticulum to the cell nucleus. Physiol Rev 79: 683701, 1999.[Abstract/Free Full Text]
- Park HR, Tomida A, Sato S, Tsukumo Y, Yun J, Yamori T, Hayakawa Y, Tsuruo T, and Shin-ya K. Effect on tumor cells of blocking survival response to glucose deprivation. J Natl Cancer Inst 96: 13001310, 2004.[Abstract/Free Full Text]
- Park S, Hwang I, Shong M, and Kwon OY. Identification of genes in thyrocytes regulated by unfolded protein response by using disulfide bond reducing agent of dithiothreitol. J Endocrinol Invest 26: 132137, 2003.[ISI][Medline]
- Patil C and Walter P. Intracellular signaling from the endoplasmic reticulum to the nucleus: the unfolded protein response in yeast and mammals. Curr Opin Cell Biol 13: 349355, 2001.[CrossRef][ISI][Medline]
- Ruzzin J, Wagman AS, and Jensen J. Glucocorticoid-induced insulin resistance in skeletal muscles: defects in insulin signalling and the effects of a selective glycogen synthase kinase-3 inhibitor. Diabetologia 48: 21192130, 2005.[CrossRef][ISI][Medline]
- Schwarzer R, Dames S, Tondera D, Klippel A, and Kaufmann J. TRB3 is a PI 3-kinase dependent indicator for nutrient starvation. Cell Signal 18: 899909, 2006.[CrossRef][ISI][Medline]
- Ugi S, Maegawa H, Egawa K, Nishio Y, and Kashiwagi A. PP2A activation and TRB3 induction are the two independent mechanisms of FFA-induced insulin resistance (Abstract). Diabetes 54: A336, 2005.
- Walgren JL, Amani Z, McMillan JM, Locher M, and Buse MG. Effect of R(+)alpha-lipoic acid on pyruvate metabolism and fatty acid oxidation in rat hepatocytes. Metabolism 53: 165173, 2004.[CrossRef][ISI][Medline]
- Werstuck GH, Khan MI, Femia G, Kim AJ, Tedesco V, Trigatti B, and Shi Y. Glucosamine-induced endoplasmic reticulum dysfunction is associated with accelerated atherosclerosis in a hyperglycemic mouse model. Diabetes 55: 93101, 2006.[Abstract/Free Full Text]
- Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, and Spiegelman BM. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413: 131138, 2001.[CrossRef][Medline]
- Zinszner H, Kuroda M, Wang X, Batchvarova N, Lightfoot RT, Remotti H, Stevens JL, and Ron D. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev 12: 982995, 1998.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
X.-H. Yao and B. L. G. Nyomba
Hepatic insulin resistance induced by prenatal alcohol exposure is associated with reduced PTEN and TRB3 acetylation in adult rat offspring
Am J Physiol Regulatory Integrative Comp Physiol,
June 1, 2008;
294(6):
R1797 - R1806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Liu, D. J. Burkin, and S. J. Kaufman
Increasing {alpha}7{beta}1-integrin promotes muscle cell proliferation, adhesion, and resistance to apoptosis without changing gene expression
Am J Physiol Cell Physiol,
February 1, 2008;
294(2):
C627 - C640.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. C. LaRosa, J.-J. M. Riethoven, H. Chen, Y. Xia, Y. Zhou, M. Chen, J. Miner, and M. E. Fromm
Trans-10, cis-12 conjugated linoleic acid activates the integrated stress response pathway in adipocytes
Physiol Genomics,
November 14, 2007;
31(3):
544 - 553.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. F. Gregor and G. S. Hotamisligil
Thematic review series: Adipocyte Biology. Adipocyte stress: the endoplasmic reticulum and metabolic disease
J. Lipid Res.,
September 1, 2007;
48(9):
1905 - 1914.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-H. Yao and B. L. Gregoire Nyomba
Abnormal glucose homeostasis in adult female rat offspring after intrauterine ethanol exposure
Am J Physiol Regulatory Integrative Comp Physiol,
May 1, 2007;
292(5):
R1926 - R1933.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2006 by the American Physiological Society.