HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 291/3/E611    most recent 00034.2006v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via ISI Web of Science (2) Citing Articles via Google Scholar Google Scholar Articles by Phan, L. K. Articles by Leibel, R. L. Search for Related Content PubMed PubMed Citation Articles by Phan, L. K. Articles by Leibel, R. L.

The mahoganoid mutation (Mgrn1^md) improves insulin sensitivity in mice with mutations in the melanocortin signaling pathway independently of effects on adiposity

¹Division of Molecular Genetics, Department of Pediatrics; ²Institute of Human Nutrition; and ³Naomi Berrie Diabetes Center, Columbia University, New York, NY

Submitted 7 April 2006 ; accepted in final form 23 April 2006

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Mahoganoid (Mgrn1^md) is a mutation of the mahogunin (Mgrn1) gene. The hypomorphic allele suppresses the yellow pigmentation and obesity of the A^y mouse that ubiquitously overexpresses agouti signaling protein (ASP). To assess the physiological effects of MGRN1 on energy and glucose homeostasis, we generated animals doubly mutant for Mgrn1^md and A^y, Lep^ob, or a null allele of Mc4r, and diet-induced obesity (DIO) mice segregating for Mgrn1^md. Mgrn1^md suppressed the obesity, hyperglycemia, and hyperinsulinemia of A^y mice. Mgrn1^md suppressed A^y-induced obesity by reducing food intake, and reduced adiposity in Lep^ob/Lep^ob females, but did not alter the body weight or body composition of mice fed a high-fat diet. There was no effect of Mgrn1^md on weight gain, body composition, energy intake, or energy expenditure in Mc4r-null animals. Mgrn1^md reduced circulating insulin concentrations in DIO, A^y, and Mc4r-null but not Lep^ob/Lep^ob mice. The effect of Mgrn1^md on circulating insulin concentrations was not due primarily to reductions in fat mass, since the plasma insulin concentrations of Mgrn1^md mice segregating for either A^y or Mc4r-null alleles, adjusted for fat mass and plasma glucose, were reduced compared with A^y and Mc4r mice, respectively. The effect of Mgrn1^md on insulin sensitivity of Mc4r-null mice suggests that Mgrn1^md may be increasing insulin sensitivity via the hypothalamic melanocortin-3 receptor pathway.

agouti; insulin resistance; melanocortin-4 receptor; obesity; mahogany

Mg and md are negative modifiers of adiposity and yellow coat pigmentation in A^y mice (18). Whereas Atrn^mg completely suppresses A^y-induced obesity on a uniform C57BL/6J background (18), the effect is much less striking in diet-induced obesity (DIO) in C3Heb/FeJ mice (8, 20). Atrn^mg has no effect on the obesity of mice null for Mc4r, Lepr, Lep, tub, or Cpe (8, 20). In nonalbino mice, Mgrn1^md darkens hairs on the dorsum, ears, and tail in a dose-dependent manner (18) and suppresses A^y-induced yellow pigmentation and obesity (18). Homozygous Mgrn1^md non-A^y mice are hyperphagic but lean on a C3H/HeJ background (8), suggesting that Mgrn1^md may reduce body fat by increasing energy expenditure and that Mgrn1^md has effects on energy homeostasis distinct from epistatic effects on overexpression of agouti signaling protein (ASP). Genetic studies position MGRN1 and ATRN functionally at the same level or upstream of melanocortin-1 receptor (MC1R) and melanocortin-3 receptor (MC3R)/melanocortin-3 receptor (MC4R), and downstream of ASP, on the basis of the ability of Mgrn1^md and Atrn^mg to suppress the effects of A^y on coat color and obesity (18) and their inability to suppress the yellow coat of a null mutation (extension) of MC1R (Mc1r^e) (18, 22). The parallel molecular pathways of peripheral ASP/MC1R and central agouti-related protein (AgRP)/MC3R/MC4R suggest that wild-type MGRN1 acts through analogous mechanisms in the skin and hypothalamus, decreasing signaling through cutaneous MC1R to increase pheomelanin (yellow pigment) synthesis, and through hypothalamic MC3R/MC4R to increase food intake, decrease energy expenditure, and decrease insulin sensitivity (Fig. 1). In this study, we assessed whether the effects of Mgrn1^md on adiposity and insulin homeostasis were specific to circumstances of overexpression of ASP in the A^y mouse or were generalizable to other genetic or dietary causes of obesity such as leptin deficiency (Lep^ob) or DIO.

View larger version (33K): [in this window] [in a new window]   Fig. 1. Schematic of sites of action of attractin [ATRN; mutant in mahogany (mg)] and mahogunin [MGRN1; mutant in mahoganoid (md)]. Melanocortin pathway is an integral part of the control of energy homeostasis. -MSH, derived from proteolytic processing of proopiomelanocortin, is an agonist at MC3R/MC4R receptors in the hypothalamus, producing catabolic effects on energy homeostasis. Binding of -MSH activates melanocortin-1 receptors (MC1R) on melanocytes, inducing eumelanin (black pigment) synthesis and darkening of the hair shaft. A and B: in wild-type mice, agouti-related protein (AgRP) centrally and agouti signaling protein (ASP) peripherally are antagonists/inverse agonists (dashes) at melanocortin-3 receptor (MC3R)/melanocortin-4 receptor (MC4R) and MC1R, respectively, producing anabolic effects on energy balance and pheomelanin (yellow pigment) production in the melanocyte. ATRN binds ASP, but not AgRP, and may colocalize ASP to MC1R in wild-type mice and to MC3R/MC4R in Ay mice that overexpress ASP both centrally and peripherally. C and D: Atrnmg and Mgrn1md suppress the obesity and yellow pigmentation of Ay mice (ectopically overexpressing ASP) but do not suppress the obesity of Mc4r-null or yellow coat of Mc1re mice, suggesting that both Atrnmg and Mgrn1md are functionally downstream of ASP and at or upstream of MC1R/MC4R. These findings suggest that ATRN and MGRN1 are required for ASP effects in both the skin and the brain.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

N₇F₁₄ B6.C3H-Mgrn1^md-A/a (Mgrn1^md/Mgrn1^md and Mgrn1^md/+), B6.V-Lep^ob (N₃₀), B6.Cg-A^y (N₆₆), C57BL/6J (F₂₁₇), and C3H/HeJ (F₂₄₃) mice were obtained from the Jackson Laboratory (Bar Harbor, ME). Mc4r-null breeder pairs B6.129 (F₁₆N₁) were a generous gift of Dr. David White (Millennium Pharmaceuticals, Cambridge, MA). Mice were housed in a barrier facility under pathogen-free conditions with a 12:12-h light-dark cycle at 22 ± 1°C ambient temperature. Pups were weaned at 21 days and given ad libitum access to 9% kcal as fat (low fat) Picolab Rodent Chow 20 (Purina Mills, Richmond, IN), or to 45% kcal as fat (high fat) D12451 [GenBank] (Research Diets, New Brunswick, NJ), and water, unless otherwise noted. Columbia's Institutional Animal Care and Use Committee approved all protocols.

Genotyping of Mice

Genomic DNA was amplified by polymerase chain reaction (PCR) and restricted with Dde I to determine Lep^ob genotype (5). Gene dosage for Mc4r was assessed by PCR as described previously (31). The A^y mutation was identified by coat color at the time of weaning (18). PCR was used to genotype mice for the Mgrn1^md mutation (21). Allele-specific primers were used for the wild-type and Mgrn1^md containing a retrovirus-like repetitive intracisternal type A particle (IAP) element: wild-type F1 5' TGTCAAATCTGCTCTCCCTAGTCCC 3'; wild-type R1 5' GCCACTGCCTGACTTTTGC TCTCTC 3'; Mgrn1^md IAP-F₂ 5 'AGAATAAAGCTTTGTCGC AGAA3' [94°C-30 sec, 60–55°C touchdown-30 s, 72°C-30 s]. PCR products of different sizes (382 bp wild-type, 89 bp-Mgrn1^md) were electrophoresed in 3% agarose and stained with ethidium bromide.

Generation of Double Mutants with Mgrn1^md

To generate double-mutant animals, Mgrn1^md/Mgrn1^md males were bred to A^y/+, Mc4r–/Mc4r–, or Lep^ob/+ females. F1 offspring were obligate heterozygotes at Mgrn1^md and were scored for A^y by coat color and for Mc4r or Lep^ob by genotyping tail tip DNA (5, 31). Mgrn1^md/+, A^y/+ and Mgrn1^md/+, +/+ mice were intercrossed to generate Mgrn1^md/Mgrn1^md, A^y/+ animals. Doubly heterozygous Mgrn1^md/+, Mc4r–/+ or Mgrn1^md/+, Lep^ob/+ mice were intercrossed to produce Mgrn1^md/Mgrn1^md, Mc4r–/Mc4r– or Mgrn1^md/Mgrn1^md, Lep^ob/Lep^ob animals. All F₂ animals were genotyped for the relevant mutations and phenotyped longitudinally for body weight and naso-anal length.

Measurement of Plasma Glucose, Insulin, and Leptin

At the time of death by CO₂ asphyxiation, 0.5–1 ml of whole blood was withdrawn by cardiac puncture and transferred to a tube containing 50 µl anticoagulant (82 µM EDTA and 10,000 U/ml heparin) and protease inhibitor (1,000 U/ml aprotinin). Samples were centrifuged at 14,000 rpm for 15 min, and plasma was decanted. Plasma glucose was measured by using an enzymatic (glucose oxidase, trinder reagent) assay (Sigma Diagnostic, St. Louis, MO). Plasma insulin was quantified using 1–2-3 Ultra-Sensitive Mouse Insulin ELISA (Alpco Diagnostics, Windham, NH). Plasma leptin was measured with an ACTIVE Murine Leptin Enzyme-Linked Immunosorbent (ELISA) kit (Diagnostic Systems Laboratories, Webster, TX). Samples were run in duplicate, and absorbance means were calculated for each animal.

Body Composition

Body fat and nonfat mass were measured by dual-energy X-ray absorptiometry (DEXA) using a PIXImus2 Mouse Densitometer (GE Medical Systems, Madison, WI) with software version 1.46. Field and phantom calibrations were performed as recommended by the manufacturer. The tissue calibration scan was performed with an aluminum/lucite phantom (bone mineral density = 0.0592 g/cm², percentage fat = 12.5%) prior to each use of the instrument. All DEXA scans excluded the head to include all other body parts in the imaging field.

Food Intake

At 6 wk of age, 10 F₂ male littermates of each genotype, +/+, md/md, A^y/+, and A^y/+ Mgrn1^md/Mgrn1^md, were individually housed with ad libitum access to a pelleted diet that provided 10% of calories as fat [D12450B(i); Research Diets]. After a 1-wk acclimation period, animals were anesthetized with ketamine/zylazine (0.1 ml/30 g) to obtain body weight, length (naso-anal), and initial body composition using DEXA. To facilitate measures of energy intake, mice were individually housed in cages with no bedding. Preweighed chow pellets were provided to mice ad libitum, and uningested pellets were collected and weighed every 2–3 days for a period of 7–10 days. Mean energy intake per day was calculated by genotype. After the last measurement of energy intake, animals were euthanized and body weight, length, and body composition (by DEXA) were measured. A similar procedure was employed for 10 F₂ male littermates of each genotype, Mc4r^–/–, Mc4r^–/– Mgrn1^md/Mgrn1^md, +/+, and md/md, but the period of food intake measurement was increased to 2 wk, and animals were anesthetized for body composition at the beginning of study with isoflurane.

Calculation of Energy Expenditure

Body composition was obtained by DEXA for each animal at the beginning and end of the food intake experiments to assess the energy content of any change in body mass. The energy contents of lean and fat mass used for this calculation were 1.24 and 9.4 kcal/g, respectively (34). Fecal loss was not measured. We assumed that all animals lost the same fraction of ingested calories in the feces (29). We employed the following formulas to calculate energy expenditure for the period of the food intake study:

Statistical Analyses

Statistical analyses were conducted using GraphPad Prism (version 3.02 for Windows; GraphPad Software, San Diego, CA) and Statistical Analysis Software (SAS, version 8.2; SAS Institute, Cary, NC). ANOVA with Bonferonni correction for post hoc comparisons was used to make comparisons among the various genotypes. ANOVA with repeated measures (over time) was used to analyze the weight curves. For adjustment and analysis of the plasma insulin concentrations, analysis of covariance (ANCOVA) was used with body fat and plasma glucose concentrations treated as covariates. For data presented in Table 4, between-group comparisons were made using a two-tailed unpaired Student's t-test. All data and figures are presented as means ± SE. Differences between means were considered significant at P 0.05.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

Body weight. Figure 2 shows the effects of Mgrn1^md on weight gain of A^y, Mc4r^–/–, ob/ob, and DIO mice. As expected, A^y and Mc4r^–/– mice were heavier than their wild-type siblings (9% fat diet). At 30–32 wk of age (208.2 ± 6.5 days), the body weight of A^ymd animals was less than A^y and slightly greater than +/+ controls. Homozygosity for Mgrn1^md did not suppress weight gain in Mc4r^–/– animals. The small reduction in body weight of Mc4rmd female mice starting at 8 wk of age was not significant relative to Mc4r^–/–. Mgrn1^md suppressed body weight gain in female but not male ob/ob mice; body weight of obmd female mice was 19% less than that of ob/ob mice at 24 wk. Additionally, ob/ob, md/+ females were heavier than obmd and lighter than ob/ob mice. Mgrn1^md did not suppress the body weight of DIO mice. No difference in weight was noted between md/md vs. +/+ controls.

View larger version (24K): [in this window] [in a new window]   Fig. 2. Effects of Mgrn1md on body weight of Ay, Lepob, Mc4r-null, and diet-induced obesity (DIO) mice. Animals were housed as littermates and fed ad libitum mouse chow diets containing 9% or 45% (DIO) of calories as fat. Animals were weighed monthly. Genotype abbreviations, A and B: Aymd, Ay/+, Mgrn1md/Mgrn1md; Ay, Ay/+, md+/+; Mc4rmd, Mc4r–/Mc4r–, Mgrn1md/Mgrn1md; Mc4r–/–, Mc4r–/Mc4r–, md+/+. C and D: obmd, Lepob/Lepob, Mgrn1md/Mgrn1md; ob/ob, Lepob/Lepob, md+/+. A–D: md/md, [Ay, ob, or Mc4r]+/+, Mgrn1md/Mgrn1md; +/+ (wild type). Plots are means ± SE at the designated time point. ANOVA with repeated measures, post hoc comparisons, Bonferonni corrected. *P < 0.05 vs. +/+; **P < 0.0001 vs. +/+; P < 0.05 vs. obmd; P < 0.05 vs. ob/ob md/+.

Effects of Inactivation of Mgrn1 on Food Intake and Energy Expenditure

To assess physiological mechanism(s) for the decreased body fat of A^ymd vs. A^y mice, we compared their food intake and energy expenditure on a standard 10% kcal fat diet. Consistent with previous reports (8, 9), A^y mice (with energy intake of 17.5 ± 0.6 kcal/day) consumed 10–36% more calories than their lean littermates (Fig. 3A). Mgrn1^md decreased energy intake in A^ymd (12.1 ± 0.3 kcal/day) mice, whose energy consumption was not different from +/+ (11.5 ± 0.2 kcal/day) animals. In the 1-wk energy balance study, A^y animals did not have increased energy stored (Fig. 3B) or decreased energy expenditure (Fig. 3C) vs. +/+ animals, and energy expenditure of A^ymd animals was equal to A^y and littermate +/+ controls (Fig. 3C). Mc4r-null mice were hyperphagic, ingesting 36% more calories per day than +/+ animals (Fig. 3D). Change in energy stored and calculated energy expenditure were increased in Mc4r-deficient animals vs. +/+ animals (Fig. 3, E and F). No significant differences in energy intake, energy stored, or energy expenditure were detected between Mc4r^–/– and Mc4rmd. Data from both crosses indicated that energy intake of md/md animals was not different from +/+.

View larger version (25K): [in this window] [in a new window]   Fig. 3. Effects of Mgrn1md on energy intake, energy stored, and calculated energy expenditure of Ay and Mc4r-null male mice at 8 wk of age. A–C: Aymd, Ay/+, Mgrn1md/Mgrn1md; Ay, Ay/+, md+/+. D–F: Mc4rmd, Mc4r–/Mc4r–, Mgrn1md/Mgrn1md; Mc4r–/–, Mc4r–/Mc4r–, md+/+; md/md, (Ay or Mc4r)+/+, Mgrn1md/Mgrn1md; +/+ (wild type). Values shown are means ± SE. ANOVA with Bonferonni correction of post hoc comparisons.

Male and female A^ymd mice, at 8 or 30–32 wk of age, had reduced plasma concentrations of glucose (reduced 18–29%) and insulin (reduced 36–85%) vs. A^y (Table 2). Plasma insulin concentrations of female Mc4rmd mice were 72% lower than Mc4r^–/– females, P < 0.001; no such difference was observed in male mice (Table 2). Mc4r^–/–, md/+ females displayed intermediate plasma insulin concentrations (data not shown). Plasma glucose and insulin concentrations of Mc4rmd and Mc4r^–/– males were similar at 30–32 wk of age. However, at 8 wk, Mc4rmd male mice had reduced plasma glucose (reduced 35%) and insulin (reduced 74%) concentrations vs. Mc4r^–/–, P < 0.005 (Table 2), despite body weight, body composition, and energy intake and expenditure that were not significantly different from Mc4r^–/– (Table 1 and Fig. 3). Homozygosity for Mgrn1^md did not alter the plasma insulin or glucose concentrations of DIO males. In DIO females, fasting plasma glucose was not different between +/+ and md/md. However, fasting plasma insulin was significantly reduced (35%) in md/md vs. +/+ DIO females, P < 0.05 (Table 2). Mgrn1^md had no effect on the hyperglycemia and hyperinsulinemia of ob/ob mice at 24 wk of age (Table 2).

View larger version (25K): [in this window] [in a new window]   Fig. 4. Plasma insulin concentrations adjusted for fat mass and plasma glucose. A and C: Aymd, Ay/+, Mgrn1md/Mgrn1md; Ay, Ay/+, md+/+. B and D: Mc4rmd, Mc4r–/Mc4r–, Mgrn1md/Mgrn1md; Mc4r–/–, Mc4r–/Mc4r–, md+/+. E: obmd, Lepob/Lepob, Mgrn1md/Mgrn1md; ob/ob, Lepob/Lepob, md+/+. A–E: md/md, (Ay, ob, or Mc4r)+/+, Mgrn1md/Mgrn1md; +/+ (wild type). Analysis of covariance (ANCOVA). Values are means ± SE.

View larger version (24K): [in this window] [in a new window]   Fig. 5. Effect of Mgrn1md on the relationship of plasma insulin concentration to fat mass in Ay (A), Mc4r-null (B), and DIO (C) mice. Animals were housed as siblings and fed ad libitum a diet containing 9% kcal as fat. D: homeostatic model assessment (HOMA) was used as an index of insulin sensitivity (%sensitivity). Effect of Mgrn1md on the relationship of insulin sensitivity to plasma leptin (leptin as surrogate for fat mass). DEXA, dual-energy X-ray absorptiometry.

Plasma leptin concentrations are increased relative to body fat in A^y and Mc4r-null mice (Table 2) (8, 31). Homozygosity for Mgrn1^md lowered (57–84%) plasma leptin concentrations in A^y animals. There was no effect of Mgrn1^md on plasma leptin concentrations of DIO or 30- to 32-wk Mc4r-null mice. However, Mc4rmd mice at 8 wk of age had a 35% reduction in plasma leptin vs. Mc4r^–/– mice. We used linear regression analysis to assess the extent to which decreased plasma leptin concentrations in A^ymd vs. A^y and Mc4rmd vs. Mc4r^–/– reflected changes in fat mass. Slopes of adiposity vs. plasma leptin were not significantly different among the genotypes examined (data not shown), indicating that Mgrn1^md had no primary effect on circulating leptin concentration per unit of fat mass. Hence, the effects of Mgrn1^md on insulin sensitivity were not mediated by effects on ambient leptin.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Results are summarized in Table 4.

Mgrn1^md could, in theory, reduce body fat by effects on energy intake, energy expenditure, or nutrient partitioning. A^y animals display reduced energy expenditure and increased food intake (8, 35). Hyperphagia is the major factor in the development of A^y obesity, since pair feeding of A^y to wild-type mice results in A^y animals of near-normal body fat content (33). We found that Mgrn1^md reduced the fat mass of A^y mice by suppressing food intake. No effect of Mgrn1^md on energy expenditure of A^y was detected. Mgrn1^md had no effect on energy intake or expenditure of 8 wk old Mc4r^–/– male mice. In an earlier study (18), md/md animals on the C3H/HeJ background were 20% heavier than +/+ controls. We found no difference in weight between md/md and +/+ controls when Mgrn1^md was congenic on C57BL/6J. Such previously reported differences are not unexpected given the effects of strain background on monogenic obesities (25–27, 32). The effects of Mgrn1^md on body weight and adiposity in A^y and Lep^ob obesity shown here are not due to strain admixture, since these crosses were between animals segregating for the respective mutant alleles that were fully congenic on C57BL/6J. Additionally, the phenotypes of the wild-type mice were not statistically different among the crosses (data not shown).

Mahogany mice with Atrn mutations (Atrn^mg or Atrn^mg-3J) develop vacuolation and abnormal myelination in hippocampus, cerebellar cortex, medulla, midbrain, and thalamus (10), resulting in muscular tremors (16) that may account for some of their increased energy expenditure. Therefore, reduced adiposity and body weight may be due, in part, to increased energy expended in Atrn^mg and Atrn^mg-3J mice (10). Like Atrn^mg and Atrn^mg-3J mice, Mgrn1^nc (but not the Mgrn1^md mice used in this study) show progressive spongiform neurodegeneration that is apparent in the hippocampus at 2 mo and subsequently in other regions, such as the cerebral cortex, thalamus, brain stem, caudate-putamen, and granular layer of the cerebellum (13). We noted no tremors, ataxic, or movement disorders, and found no gross or microscopic evidence of abnormal myelination or vacuolation in the brain or spinal cords of Mgrn1^md animals at 1 yr of age (21). Mgrn1^nc is a null allele, whereas the Mgrn1^md mutation reduces Mgrn1 expression by about 95% in the brain (13, 21). Mgrn1^nc mice are coisogenic on a mixed C3H x 101 stock, whereas Mgrn1^md are congenic on C57BL/6J. CAST/Ei-Atrn^mg-6J/Atrn^mg-6J animals developed severe tremors (visible at 10 days of age), vacuolization, and sprawling gait and did not survive past 3–4 wk of age (23). Atrn^mg-6J, when backcrossed onto the C3H/SnJ strain, showed delayed central nervous system myelination and vacuolization and reduced tremors, and sprawling was no longer evident (24). Hence, the differences in neurological phenotypes between Mgrn1^nc and Mgrn1^md probably reflect combined effects of mutation severity and background modifier genes.

The reduced body weight observed in A^y/+, Mgrn1^md/Mgrn1^md males and females, and Lep^ob/Lep^ob, Mgrn1^md/Mgrn1^md females at 6–8 mo is apparently not a result of neurodegeneration, since we noted no neurological phenotypes and found no gross or microscopic evidence of abnormal myelination or vacuolation in the brain or spinal cords of Mgrn1^md animals at 1 yr of age (22). In addition, our md/md animals did not demonstrate altered energy expenditure, and their body weights and adiposities were comparable to littermate controls.

Insulin and leptin circulate in plasma at concentrations proportional to body fat mass (1, 6, 24, 36). A^y, Mc4r-null, and +/+ DIO mice demonstrated the expected correlations between body fat mass (by DEXA) and plasma insulin concentrations, suggesting that the increased plasma insulin in these animals is primarily a function of the increased fat mass. In contrast, introduction of Mgrn1^md in A^y, Mc4r-null, or +/+ DIO mice altered the significant correlation between fat mass and circulating insulin concentrations, indicating that hypoactivity of MGRN1 lowers plasma insulin concentrations and increases insulin sensitivity by a mechanism independent of effects on fat mass. Intracerebroventricular administration of the MC3R/MC4R agonist, MTII, increases Glut4 mRNA expression in skeletal muscle and enhances insulin action in mice independently of its effects on food intake or body weight (14). We detected minimal effect of Mgrn1^md on adiposity of Mc4r null. However, plasma insulin, adjusted for fat mass and circulating glucose, was reduced by over 80% in Mc4r^–/Mc4r^–, Mgrn1^md/Mgrn1^md mice. Thus Mgrn1^md affects systemic insulin homeostasis by a mechanism not dependent on the integrity of the MC4R pathway.

The ability of Atrn^mg and Mgrn1^md to suppress the weight gain of A^y (18, 20), but not Mc4r-null animals, suggests that both ATRN and MGRN1 act functionally at the same level as, or upstream of, MC4R and downstream of ASP in the melanocortin pathway. The hypomorphic allele, Atrn^mg, does not suppress the obesity of ob/ob mice (8, 20); however, the null Atrn^mg-3J allele suppresses DIO (20). Mgrn1^md did not suppress DIO but did reduce the obesity of ob/ob female mice in a gene dosage-dependent fashion; however, the effect is modest in contrast to the effect of Mgrn1^md on A^y-induced obesity. The phenotypic effects of Mgrn1^md on A^y, Lep^ob, Mc4r^–/–, and DIO mice suggest that the action of Mgrn1^md is not specific to the MC4R pathway. The striking effects of Mgrn1^md on insulin sensitivity in Mc4r-null mice indicate that Mgrn1^md does not act via the MC4R-signaling pathway to regulate insulin homeostasis. The effects on insulin sensitivity could be mediated through MC3R. The preferential effects of MC3R on fuel efficiency and caloric partitioning and hyperinsulinemia of male Mc3r-null mice are consistent with MC3R-mediated effects on insulin homeostasis (3, 4, 7). MC3R allelic variants have been weakly associated with insulin sensitivity in human subjects (12).

Atrn^mg appears to rescue the A^y obesity phenotype by increasing physical activity. Homozygosity for Atrn^mg also suppresses the hyperinsulinemia of A^y, but it is not clear that this effect is not fully accounted for by reduced body fat (8). Mahogany and mahoganoid are loss-of-function mutations that act epistatically to A^y to suppress both the yellow coat color and obesity caused by ectopic overexpression of ASP (18); the expression patterns of Atrn and Mgrn1 mRNA are similar (11, 13, 17). These findings suggest that ATRN and MGRN1 are required for ASP effects in both the skin and the brain, and that they function in the same genetic pathway. Atrn transgenes are unable to rescue the brain vacuolization phenotype of Mgrn1^nc, and Mgrn1 have no effects on Atrn expression levels (13), placing MGRN1 functionally downstream of ATRN. MGRN1 is an intracellular C3HC4 RING finger domain protein that has E3 ubiquitin ligase activity (13, 21). It is probable that MGRN1 affects energy and insulin homeostasis via the agouti-signaling pathway by 1) increasing expression, activity, or localization of the inverse agonist/antagonist to MC3R/MC4R receptors; 2) influencing the physical proximity or increasing binding of a possible coreceptor, such as ATRN, to ASP; or 3) targeting ATRN-associated proteins for ubiquitination (Fig. 1). Identifying the molecular targets of MGRN1 could identify new molecular mediators of the regulation of energy and insulin homeostasis.

	GRANTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-52431-14, P30-DK-26687, 2-T32-DK-007647.

	ACKNOWLEDGMENTS

 
We thank Anya Brodsky, Kevin Chung, Rachel Donocoff, and Alison O'Neill for help in phenotypic studies and Beverly Diamond for assistance with statistical analyses.

	FOOTNOTES

 

Address for reprint requests and other correspondence: R. L. Leibel, Russell Berrie Medical Science Pavilion, 1150 St. Nicholas Ave., Room 620, New York, NY 10032 (e-mail: rl232{at}columbia.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

	REFERENCES

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 

1. Bagdade JD, Bierman EL, and Porte DJ. The significance of basal insulin levels in the evaluation of the insulin response to glucose in diabetic and nondiabetic subjects. J Clin Invest 46: 1549–1557, 1967.[ISI][Medline]
2. Brommage R. Validation and calibration of DEXA body composition in mice. Am J Physiol Endocrinol Metab 285: E454–E459, 2003.[Abstract/Free Full Text]
3. Butler AA, Kesterson RA, Khong K, Cullen MJ, Pelleymounter MA, Dekoning J, Baetscher M, and Cone RD. A unique metabolic syndrome causes obesity in the melanocortin-3 receptor-deficient mouse. Endocrinology 141: 3518–3521, 2000.[Abstract/Free Full Text]
4. Chen AS, Marsh DJ, Trumbauer ME, Frazier EG, Guan XM, Yu H, Rosenblum CI, Vongs A, Feng Y, Cao L, Metzger JM, Strack AM, Camacho RE, Mellin TN, Nunes CN, Min W, Fisher J, Gopal-Truter S, MacIntyre DE, Chen HY, and Van der Ploeg LH. Inactivation of the mouse melanocortin-3 receptor results in increased fat mass and reduced lean body mass. Nat Genet 26: 97–102, 2000.[CrossRef][ISI][Medline]
5. Chung WK, Chua SC, Lee GH, and Leibel RL. Polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP) and electrophoretic assays for the mouse obese (Lepob) mutation. Obes Res 5: 183–185, 1997.[ISI][Medline]
6. Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, Bauer TL, and Caro JF. Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med 334: 292–295, 1996.[Abstract/Free Full Text]
7. Cummings DE and Schwartz MW. Melanocortins and body weight: a tale of two receptors. Nat Genet 26: 8–9, 2000.[CrossRef][ISI][Medline]
8. Dinulescu DM, Fan W, Boston BA, McCall K, Lamoreux ML, Moore KJ, Montagno J, and Cone RD. Mahogany (mg) stimulates feeding and increases basal metabolic rate independent of its suppression of agouti. Proc Natl Acad Sci USA 95: 12707–12712, 1998.[Abstract/Free Full Text]
9. Frigeri LG, Wolff GL, and Teguh C. Differential responses of yellow Avy/A and agouti A/a (BALB/c X VY) F1 hybrid mice to the same diets: glucose tolerance, weight gain, and adipocyte cellularity. Int J Obes 12: 305–320, 1988.[ISI][Medline]
10. Gunn TM, Inui T, Kitada K, Ito S, Wakamatsu K, He L, Bouley DM, Serikawa T, and Barsh GS. Molecular and phenotypic analysis of Attractin mutant mice. Genetics 158: 1683–1695, 2001.[Abstract/Free Full Text]
11. Gunn TM, Miller KA, He L, Hyman RW, Davis RW, Azarani A, Schlossman SF, Duke-Cohan JS, and Barsh GS. The mouse mahogany locus encodes a transmembrane form of human attractin. Nature 398: 152–156, 1999.[CrossRef][Medline]
12. Hani EH, Dupont S, Durand E, Dina C, Gallina S, Gantz I, and Froguel P. Naturally occurring mutations in the melanocortin receptor 3 gene are not associated with type 2 diabetes mellitus in French Caucasians. J Clin Endocrinol Metab 86: 2895–2898, 2001.[Abstract/Free Full Text]
13. He L, Lu XY, Jolly AF, Eldridge AG, Watson SJ, Jackson PK, Barsh GS, and Gunn TM. Spongiform degeneration in mahoganoid mutant mice. Science 299: 710–712, 2003.[Abstract/Free Full Text]
14. Heijboer AC, van den Hoek AM, Pijl H, Havekes LM, Romijn JA, and Corssmit EP. Intracerebroventricular administration of melanotan II increases insulin sensitivity of glucose disposal in mice. Diabetologia 48: 1621–1626, 2005.[CrossRef][ISI][Medline]
15. Huszar D, Lynch CA, Fairchild-Huntress V, Dunmore JH, Fang Q, Berkemeier LR, Gu W, Kesterson RA, Boston BA, Cone RD, Smith FJ, Campfield LA, Burn P, and Lee F. Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell 88: 131–141, 1997.[CrossRef][ISI][Medline]
16. Kuramoto T, Kitada K, Inui T, Sasaki Y, Ito K, Hase T, Kawagachi S, Ogawa Y, Nakao K, Barsh GS, Nagao M, Ushijima T, and Serikawa T. Attractin/mahogany/zitter plays a critical role in myelination of the central nervous system. Proc Natl Acad Sci USA 98: 559–564, 2001.[Abstract/Free Full Text]
17. Lu X, Gunn TM, Shieh K, Barsh GS, Akil H, and Watson SJ. Distribution of Mahogany/Attractin mRNA in the rat central nervous system. FEBS Lett 462: 101–107, 1999.[CrossRef][ISI][Medline]
18. Miller KA, Gunn TM, Carrasquillo MM, Lamoreux ML, Galbraith DB, and Barsh GS. Genetic studies of the mouse mutations mahogany and mahoganoid. Genetics 146: 1407–1415, 1997.[Abstract]
19. Moussa NM and Claycombe KJ. The yellow mouse obesity syndrome and mechanisms of agouti-induced obesity. Obes Res 7: 506–514, 1999.[ISI][Medline]
20. Nagle DL, McGrail SH, Vitale J, Woolf EA, Dussault BJ Jr, DiRocco L, Holmgren L, Montagno J, Bork P, Huszar D, Fairchild-Huntress V, Ge P, Keilty J, Ebeling C, Baldini L, Gilchrist J, Burn P, Carlson GA, and Moore KJ. The mahogany protein is a receptor involved in suppression of obesity. Nature 398: 148–152, 1999.[CrossRef][Medline]
21. Phan LK, Lin F, LeDuc CA, Chung WK, and Leibel RL. The mouse mahoganoid coat color mutation disrupts a novel C3HC4 RING domain protein. J Clin Invest 110: 1449–1459, 2002.[CrossRef][ISI][Medline]
22. Robbins LS, Nadeau JH, Johnson KR, Kelly MA, Roselli-Rehfuss L, Baack E, Mountjoy KG, and Cone RD. Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72: 827–834, 1993.[CrossRef][ISI][Medline]
23. Roderick T, Donahue L, Samples R, Kim J, and Naggert J. Mice with mutations in the mahogany gene Atrn have cerebral spongiform changes. J Neuropathol Exp Neurol 60: 724–730, 2001.[ISI][Medline]
24. Rosenbaum M, Nicolson M, Hirsch J, Heymsfield SB, Gallagher D, Chu F, and Leibel RL. Effects of gender, body composition, and menopause on plasma concentrations of leptin. J Clin Endocrinol Metab 81: 3424–3427, 1996.[Abstract]
25. Rossmeisl M, Rim JS, Koza RA, and Kozak LP. Variation in type 2 diabetes—related traits in mouse strains susceptible to diet-induced obesity. Diabetes 52: 1958–1966, 2003.[Abstract/Free Full Text]
26. Smith BK, Andrews PK, and West DB. Macronutrient diet selection in thirteen mouse strains. Am J Physiol Regul Integr Comp Physiol 278: R797–R805, 2000.[Abstract/Free Full Text]
27. Surwit RS, Kuhn CM, Cochrane C, McCubbin JA, and Feinglos MN. Diet-induced type II diabetes in C57BL/6J mice. Diabetes 37: 1163–1167, 1988.[Abstract]
28. Tang W, Gunn TM, McLaughlin DF, Barsh GS, Schlossman SF, and Duke-Cohan JS. Secreted and membrane attractin result from alternative splicing of the human ATRN gene. Proc Natl Acad Sci USA 97: 6025–6030, 2000.[Abstract/Free Full Text]
29. Terpstra AH, Beynen AC, Everts H, Kocsis S, Katan MB, and Zock PL. The decrease in body fat in mice fed conjugated linoleic acid is due to increases in energy expenditure and energy loss in the excreta. J Nutr 132: 940–945, 2002.[Abstract/Free Full Text]
30. Wallace TM, Levy JC, and Matthews DR. Use and abuse of HOMA modeling. Diabetes Care 27: 1487–1495, 2004.[Abstract/Free Full Text]
31. Weide K, Christ N, Moar KM, Arens J, Hinney A, Mercer JG, Eiden S, and Schmidt I. Hyperphagia, not hypometabolism, causes early onset obesity in melanocortin-4 receptor knockout mice. Physiol Genomics 13: 47–56, 2003.[Abstract/Free Full Text]
32. West DB, Boozer CN, Moody DL, and Atkinson RL. Dietary obesity in nine inbred mouse strains. Am J Physiol Regul Integr Comp Physiol 262: R1025–R1032, 1992.[Abstract/Free Full Text]
33. Wolff GL, Kodell RL, Kaput JA, and Visek WJ. Caloric restriction abolishes enhanced metabolic efficiency induced by ectopic agouti protein in yellow mice. Proc Soc Exp Biol Med 221: 99–104, 1999.[Abstract]
34. Wright RA and Heymsfield SB. Nutritional Assessment of the Adult Hospitalized Patient. Boston, MA: Blackwell Scientific Publications, 1984.
35. Yen TT, Gill AM, Frigeri LG, Barsh GS, and Wolff GL. Obesity, diabetes, and neoplasia in yellow A(vy)/- mice: ectopic expression of the agouti gene. FASEB J 8: 479–488, 1994.[Abstract]
36. Zhang Y, Guo KY, Diaz PA, Heo M, and Leibel RL. Determinants of leptin gene expression in fat depots of lean mice. Am J Physiol Regul Integr Comp Physiol 282: R226–R234, 2002.[Abstract/Free Full Text]

This Article Abstract Full Text (PDF) All Versions of this Article: 291/3/E611    most recent 00034.2006v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via ISI Web of Science (2) Citing Articles via Google Scholar Google Scholar Articles by Phan, L. K. Articles by Leibel, R. L. Search for Related Content PubMed PubMed Citation Articles by Phan, L. K. Articles by Leibel, R. L.