AJP - Endo AJP: Heart and Circulatory Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 290: E530-E539, 2006. First published November 1, 2005; doi:10.1152/ajpendo.00412.2005
0193-1849/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/3/E530    most recent
00412.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balagopal, P.
Right arrow Articles by Hammond, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balagopal, P.
Right arrow Articles by Hammond, D.

Oxandrolone enhances skeletal muscle myosin synthesis and alters global gene expression profile in Duchenne muscular dystrophy

Prabhakaran Balagopal,1,2 Robert Olney,1,2 Dominique Darmaun,1 Edward Mougey,1 Maryann Dokler,1 Gary Sieck,2 and David Hammond1,2

1Nemours Children's Clinic, Jacksonville, Florida; and 2Mayo Clinic College of Medicine, Rochester, Minnesota

Submitted 31 August 2005 ; accepted in final form 26 October 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Earlier studies have shown that the progressive, unrelenting muscle loss associated with Duchenne muscular dystrophy (DMD) involves an imbalance between the rates of synthesis and degradation of muscle proteins. Although previous studies have suggested that oxandrolone may be beneficial in DMD, the mechanism of action of oxandrolone on muscle in DMD remains unclear. To address these issues, we combined stable isotope studies and gene expression analysis to measure the fractional synthesis rate of myosin heavy chain (MHC), the key muscle contractile protein, the transcript levels of the isoforms of MHC, and global gene expression profiles in four children with DMD before and after 3 mo of treatment with oxandrolone. Gastrocnemius muscle biopsies and blood samples were collected during the course of a primed 6-h continuous infusion of L-[U-13C]leucine on two separate occasions, before and after the 3-mo treatment with oxandrolone (0.1 mg·kg–1·day–1). Gene expression analysis was done with microarrays and RT-qPCR. In response to the treatment, MHC synthesis rate increased 42%, and this rise was accounted for, at least in part, by an upregulation of the transcript for MHC8 (perinatal MHC). Gene expression data suggested a decrease in muscle regeneration as a consequence of oxandrolone therapy, presumably because of a decrease in muscle degeneration. These findings suggest that 1) oxandrolone has a powerful protein anabolic effect on a key contractile protein and 2) larger and longer-term studies are warranted to determine whether these changes translate into meaningful therapy for these patients.

microarray; stable isotope; mass spectrometry


DUCHENNE MUSCULAR DYSTROPHY (DMD) is a severe and progressive form of human muscular dystrophy with a lethal outcome. Although the absence of the protein dystrophin, which is part of a glycoprotein complex located on the intracellular surface of the cellular membrane, was identified as the molecular basis of the disease (25, 28), and despite advances in our understanding of dystrophin function, the precise pathogenesis of the severe muscle damage remains unclear. The most striking manifestations of this disorder are loss of skeletal muscle mass and strength, resulting in severe disability. Previous studies in DMD have suggested that the loss of muscle is likely the result of an imbalance between muscle protein synthesis and degradation (18, 42). In DMD, dystrophin deficiency is present in muscle from fetal life onward. However, the loss of muscle is progressive. The progressive nature of the muscle loss implies that there are crucial secondary factors that compound the problems caused by dystrophin deficiency. The gradual loss of regenerating capacity of muscle, which depends on protein synthesis, may be an important factor in this pathogenetic process (18, 41, 42).

The absence of a cure for DMD underscores the importance of adjunctive therapeutic strategies. A recent study by Fenichel et al. (13) suggested an ameliorative effect of oxandrolone, an oral synthetic analog of testosterone, on muscle strength in DMD. Although a subsequent study by the same group did not find a significant change in the average manual muscle test (MMT) score, they found significant improvement in quantitative muscle testing (14), and no major adverse reactions were noted. The expected increase in linear growth was also seen in boys treated with oxandrolone. These results suggest that oxandrolone may slow down or stabilize the progression of weakness. Oxandrolone has also been used successfully to enhance lean body mass in other debilitating clinical situations such as human immunodeficiency syndrome infection and chronic alcoholic cirrhosis, lean body mass and upper- and lower-body maximal voluntary strength in the elderly, and linear growth in Turner syndrome and improves albumin levels, net protein balance, and lean body mass in severely burned children (20, 45, 48, 54). An acute anabolic effect of oxandrolone on the fractional synthesis rate (FSR) of mixed muscle protein has also been reported in healthy young men (46). In contrast to the rather less sensitive clinical measurements of muscle strength, changes in the FSR of proteins can easily be detected in the short term by their direct measurement using stable isotope tracer dilution techniques (3).

Because oxandrolone has proven protein anabolic effects in other diseases, and may have some beneficial effect in slowing the progress of weakness in DMD, we hypothesized that oxandrolone would provide an overall protein anabolic effect in DMD. To test this hypothesis, we measured the FSR of myosin heavy chain (MHC; a key muscle contractile protein) and albumin (the most abundant single protein in humans) before and after a 3-mo treatment with oxandrolone in DMD and determined mRNA expression levels of the isoforms of MHC by microarray analysis and RT-qPCR.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Subjects

Four boys (ages: 8.3, 10.4, 12.8, and 16.7 yr) with diagnosis of DMD were enrolled in the study. One of the subjects (age: 16.7 yr) was wheelchair dependent. The others were ambulatory. Informed written consent was obtained according to protocols approved by the local Institutional Review Board at Baptist Medical Center (Jacksonville, FL). Subjects were studied before and after treatment with oxandrolone (0.1 mg·kg–1·day–1 po) for 3 mo.

Materials

L-[U-13C]leucine was purchased from Cambridge Isotope Laboratories (Woburn, MA). Solutions were prepared under sterile conditions, filtered through a 0.2-µm filter, and stored at 4°C in sterile containers before infusion. Solutions were proven to be sterile and pyrogen free before use in human subjects. All electrophoresis reagents were purchased from Bio-Rad Laboratories (Richmond, CA). Trifluoroacetic acid was purchased from Pierce (Rockford, IL). TRIzol, SuperScript II RT, and Taq polymerase were purchased from Invitrogen (Carlsbad, CA); DNase and proteinase K were from Sigma (St. Louis, MO); SYBR Green I and RiboGreen were from Molecular Probes (Eugene, OR); and TaqStart Antibody was from BD Biosciences Clonetech (Palo Alto, CA).

Study Protocol

For at least 3 days before each study, all subjects were asked not to change their dietary habits or pattern of activity, and they maintained a dietary record. The subjects were admitted to the Clinical Research Center on the evening of the 4th day.

Muscle strength was measured using MMT, using the Medical Research Council system, at baseline, after 1 mo and at the end of the 3-mo intervention period. On the night before the study day, an intravenous line was inserted, and the line was kept patent by a slow infusion of saline. The isotope infusion study was performed in the morning in the postabsorptive state, after an overnight fast as reported earlier (33, 38). At 7:00 AM, a second catheter was inserted into a contralateral hand vein for blood sampling; the saline infusion was discontinued, and isotope infusion was performed as a 6-h primed (7.6 µmol/kg) continuous infusion of L-[U-13C]leucine (7.6 µmol·kg–1·h–1), as previously described (3, 22, 38, 52). Blood and gastrocnemius muscle biopsies (125 mg) were obtained as described earlier in our own previous studies (3). The muscle sample was cut into two aliquots (~100 mg for MHC FSR and ~25 mg for mRNA and microarray measurements), immediately frozen in liquid nitrogen, and kept at –80°C until analysis. At each visit, patients and caregivers were queried as to the occurrence of adverse effects, general physical examinations were performed, and blood chemistries were obtained.

Purification of MHC and Albumin

MHC was purified by a preparative continuous-elution electrophoresis technique described previously (2, 3). In brief, the tissue samples were homogenized in an SDS-pyrophosphate buffer (pH 7.4) and centrifuged. The supernatant containing the proteins was electrophoresed on a polyacrylamide gel (4%T-2.5%C resolving gel, pH 8.8, and 4%T-2.5%C stacking gel, pH 6.8) using a preparative electrophoresis cell (model 491 Prep Cell; Bio-Rad Laboratories, Hercules, CA) to separate MHC from other proteins. The purity of the MHC fractions in each sample was established by analytical SDS-PAGE on a 5% gel followed by silver staining (2). MHC samples were overloaded on the analytic gel to detect any contamination from other proteins. The pure MHC fractions were pooled together, and the protein was precipitated using TCA. Albumin was extracted from plasma by differential solubility in absolute ethanol from TCA-precipitated plasma proteins as described previously (5, 16, 31). The purified muscle MHC and albumin were hydrolyzed using 1.5 ml 6 N hydrochloric acid.

Measurement of Isotopic Enrichment in MHC, Albumin, and {alpha}-[13C]Ketoisocaproate

The measurements of [13C]leucine enrichment in MHC and albumin were performed by a gas chromatography-combustion-isotope ratio mass spectrometer (GC-combustion-IRMS) method, as described in detail elsewhere (1). The constituent amino acids resulting from muscle MHC and albumin hydrolysates were derivatized as their N-heptafluorobutyryl methyl esters for analysis of isotopic enrichment by GC/combustion/IRMS. Plasma enrichment of {alpha}-[13C]ketoisocaproate (KIC; [13C]KIC) was determined by GC-mass spectrometry (MS) with selected ion monitoring and electron impact ionization of an oxime t-butyldimethylsilyl derivative, as previously described (44).

The FSR of MHC (expressed as %/h) was calculated using the equation (3, 38, 53) FSR = [({Delta}EMHC/EKIC x t)] x 100, where {Delta}EMHC represents the difference in 13C enrichment in MHC between the biopsies. EKIC is the plateau value of 13C enrichment of KIC (the precursor pool), and t represents the time interval between the biopsies. Because of limitation in biopsy sample size, 13C enrichment in tissue free leucine was not determined, and [13C]KIC enrichment was used as a precursor pool in calculating FSR.

The FSR of albumin (expressed in %/24 h) was calculated using the precursor/product relationship: FSR = 24 x 100 x (EAlbumin)/(EKIC), where EAlbumin is the slope of the 13C enrichment in the bound leucine residues in albumin from 2 to 6 h of isotope infusion (atom %excess/h), and 100 and 24 convert the result to a percent and per day (5, 16, 53). The absolute synthesis rate (ASR) of albumin, which is the amount of albumin synthesized per kg body weight per day, was estimated as the product of FSR and intravascular mass of albumin (5, 16). The intravascular albumin pool size was calculated by multiplying plasma albumin concentration (in mg/l) by the plasma volume (in liters), and plasma volume was calculated by multiplying body weight by 0.045 (39). The ASR was then expressed as milligram per kilogram body weight.

Purification of RNA

RNA was isolated from the muscle biopsy samples with TRIzol, following the manufacturer's instructions. Purified RNA was further treated with DNase and proteinase K and was finally passed over an RNeasy minicolumn (Qiagen, Valencia, CA), following the suppliers' instructions. The purified RNA was quantified by fluorescence using RiboGreen dye.

Microarray Analysis

mRNA was linearly amplified (2 rounds) and biotin labeled using the protocol of Baugh et al. (8). Labeled product was purified on a Qiagen RNeasy column, and the integrity of each sample was assessed by 1% formaldehyde-agarose gel electrophoresis. Labeled, amplified RNA was applied to Affymetrix Human Genome U133 GeneChip sets (U133A and U133B). Hybridization and scanning were performed at the Center for Applied Genomics (Newark, NJ). Image analysis was performed with Affymetrix Microarray Suite, version 5.0. Color images of the microarrays were generated from the data in Bioconductor and inspected for regional abnormalities in hybridization (17).

Probe-level data were background corrected and normalized, and summary expression for each feature was calculated using the Robust Multiarray Average algorithms described by Irizarry et al. (26), using the affy package of Bioconductor (17).

Differences between pre- and posttreatment samples were determined using Significance Analysis of Microarrays (SAM) (49). Gene expression data were filtered for those genes with expression levels greater than background (an expression level >100 in >25% of the samples) and for those genes demonstrating adequate variability between the samples (intraquartile range >0.5; see Ref. 51). The resulting data set was analyzed by SAM, where paired t-tests (corrected for the large number of comparisons) were used to estimate significance. The algorithm reports the false discovery rate (q) for each gene, which is analogous to a P value.

Gene expression patterns were analyzed by MAPPFinder and GenMAPP (GenMAPP 2.0; see Ref. 10). GenMAPP assigns the Gene Ontology (GO) classifications to each gene represented on the array and color codes them as to whether they are expressed and how the expression levels differ between samples. MAPPfinder analyzes the resulting data set to identify GO classifications, where the percentage of genes found to be changed by oxandrolone treatment was different from the percentage that would be expected by random chance. These GO classifications are particularly relevant in determining whether related groups of genes changed in concert with treatment.

Real-Time RT-qPCR

RT reactions were conducted with 1.0 µg purified RNA, as previously described (40). The reaction for quantitative PCR was 20 mM Tris·HCl, pH 8.3, 50 mM KCl, 3 mM MgCl2, 0.1% Tween 20, 200 mM each dNTP, and 500 nM each primer and contained 50 mg/ml BSA, 0.4 x SYBR Green I, 0.4 units of Taq polymerase, 0.088 mg of Taq start antibody, and one-tenth of the RT reaction. Purified amplicon of the specific primer set was used for quantitative standards in parallel reactions. Cycling was conducted in a LightCycler (Roche Applied Science, Indianapolis, IN) with parameters of 95°C for 2 min and 40 cycles of 95°C for 0 s, 65–55°C for 5 s (stepdown protocol of 1°C per cycle for the first 10 cycles), and 72°C for 15 s (30 s for MHC2 and -6). Melting curves were determined at the end of each PCR run to confirm the identity of the sample and control amplicons.

The primers used were MHC1 (forward: GGAGGAACAATCCAACGTCAA, reverse: TGACCTGGGACTCAGCAATG), MHC2 (forward: AAGGATACCCAGATCCACC, reverse: CTCAGCATTACGCTTTTGC), MHC3 (forward: AAGCAAGCCTTTACCCAGC, reverse: CATCAACCATCAGATCCTCC), MHC4 (forward: GAGTGAACTACAGACTTCC, reverse: AGTGTCCTTCAGTATTCC), MHC6 (forward: AGAGAAACTACCACATCTTCTACC, reverse: AATGAATGTCCACTCAATGC), MHC7 (forward: AGACAACCTGGCAGATGC, reverse: TTTCTCCTTCTCCACTTTGG), MHC8 (forward: CAGAATACCAGTCTCATTAACACC, reverse: TCCTTCAAGCTCACGTACC), MHC11 (forward: TTCCAAATATCACAGACACC, reverse: CAATTATAGCTCATTGCAGC), MHC13 (forward: GAACACAAGCCTGATAAATACC, reverse: AAGCTCATTTTCCAGCTCC), and glyceraldehyde-3-phosphate dehydrogenase (forward: CTCCTGCACCACCAACTG, reverse: GCCTGCTTCACCACCTTC). Primers were designed using Vector NTI software and synthesized by Operon Biotechnologies.

Quantification was accomplished by determining the "threshold cycle" (the second derivative of the resulting fluorescence curve) at which the amplicon is detected during the PCR and comparing this with the standard curve calculated from the parallel quantification reactions. These calculations are done with the LightCycler software (version 3.5). For each sample, RT reactions were done in duplicate, and a single PCR reaction was done on each RT reaction. Results of the duplicates were averaged. Data were log transformed so as to approximate a normal distribution.

Data Analysis

Results are expressed as means ± SE. For all assays, pre- and postoxandrolone treatment results were compared using the paired Student's t-test, with a P value of <0.05 considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
One subject (age: 12.8 yr) with DMD participated only in the baseline of the study and did not complete the second study. He developed elevated liver transaminases (compared with baseline values). Other liver function tests were normal, there was no clinical evidence of hepatic dysfunction, and liver transaminases returned to baseline values when oxandrolone was discontinued. Oxandrolone was, therefore, not restarted, and muscle biopsy was not performed at 3 mo. The other three subjects tolerated oxandrolone treatment well and completed the study.

FSR of MHC and Albumin: Effect of Oxandrolone

We measured the FSR of MHC before and after treatment with oxandrolone. The FSR of MHC increased by 42 ± 6% (n = 3; P = 0.02) in response to the intervention. An increase was observed in each of the subjects (Fig. 1). Muscle strength measured by MMT did not deteriorate during the study period.


Figure 1
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1. Increase in the fractional synthesis rate (FSR) of skeletal muscle myosin heavy chain (MHC) in each patient with Duchenne muscular dystrophy (DMD) before and after oxandrolone treatment. {triangleup}, {circ}, and {square} represent 8.3-, 10.4-, and 16.7-yr-old DMD boys, respectively.

 
Figure 2 summarizes the results on albumin FSR, its concentration, and its ASR. We found that the FSR, concentration, and ASR increased 43 ± 5, 4.7 ± 0.6, and 49 ± 6%, respectively, in response to oxandrolone treatment. All these parameters increased in each of the subjects.


Figure 2
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 2. A: FSR of albumin. B: concentration of albumin. C: absolute synthesis rate (ASR) of albumin in each DMD patient before and after oxandrolone treatment. {triangleup}, {circ}, and {square} represent 8.3-, 10.4-, and 16.7-yr-old DMD boys, respectively.

 
MHC Isoform Transcripts by RT-qPCR and Gene Expression Profile: Effect of Oxandrolone

Microarray analysis. The Affymetrix U133 arrays contain 44,916 "features" representing 20,882 unique UniGene clusters, 5,829 genes not yet assigned to a UniGene cluster, and 68 controls. Across all the samples, genes from 12,129 UniGene clusters and 1,818 genes not yet assigned to a Unigene cluster were found to be expressed. The correlation coefficients (Pearson's) of the features between the pretreatment samples were 0.9841, 0.9924, and 0.9835. The complete microarray data set can be found in the Gene Expression Omnibus database (GEO; www.ncbi.nlm.nih.gov/geo), accession no. GSE1764.

The 30 most highly expressed genes in DMD muscle are listed in Table 1. Haslett et al. (21) performed microarray analysis on muscle tissue from 12 boys with DMD and 11 normal controls (6 male, 5 female). The raw data from these experiments were downloaded from GEO (accession no. GSE1004) and processed as described in MATERIALS AND METHODS. Table 1 includes the ranking of each gene from the Haslett data, showing good agreement between the data sets. Many of the most highly expressed genes are ubiquitously expressed (GAPD, translation factors, ribosomal proteins), but many are muscle specific, including sarcolipin, myoglobin, myosins, tropomyosin 1, troponin C, etc. These confirm that, despite the presence of fibrous tissue found in DMD muscle, the majority of RNA came from muscle cells.


View this table:
[in this window]
[in a new window]
 
Table 1. Thirty most highly expressed genes in DMD muscle

 
SAM was done using paired analysis. Genes from 42 UniGene Clusters and 23 genes not associated with a UniGene cluster were found to be upregulated (q < 0.05) with oxandrolone treatment. Genes with at least twofold upregulation are shown in Table 2. MHC8 was significantly upregulated; baseline expression was 10.0 ± 0.7 (log2 signal, means ± SE) with a change of 0.6 ± 0.2 (log2 signal ratio, q < 0.05). Although MHC4 was also identified as having been upregulated, the data show that in one of the three sample pairs, the gene was upregulated sevenfold. In the other two samples, there was no major change (Fig. 3). Genes from 1,128 UniGene Clusters and 37 genes not associated with a UniGene cluster were found to be downregulated (q < 0.05). Genes with at least 2.3-fold downregulation are shown in Table 3.


View this table:
[in this window]
[in a new window]
 
Table 2. Genes upregulated twofold or more in DMD muscle in response to oxandrolone

 

Figure 3
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. MHC4 (A) and MHC8 (B) expressions using microarray and RT-qPCR techniques, for each patient, before (pre) and after (post) oxandrolone treatment. {triangleup}, {circ}, and {square} represent 8.3-, 10.4-, and 16.7-yr-old DMD boys, respectively.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Genes downregulated twofold or more in DMD muscle in response to oxandrolone

 
The imbalance between the number of up- and downregulated genes raised concerns about a systemic difference between the pre- and posttreatment data sets. To determine whether there was global gene downregulation, the expression levels for ubiquitously expressed invariant "housekeeping" genes (11) were examined. Of 427 housekeeping genes, the expression of 89% of these genes was not significantly different between the pre- and posttreatment results. For comparison, 89% of these housekeeping genes were also unchanged between DMD and normal muscle, using the data of Haslett et al. (21).

MAPPFinder was used to identify those gene function classifications that were impacted by oxandrolone treatment. Table 4 shows a generalized pattern of downregulation of energy pathways, transcription, and translation in response to oxandrolone. MAPPFinder analysis was also done on the DMD vs. normal muscle data set of Haslett et al. (21). Table 5 lists selected genes from the muscle development GO category and their change in expression levels. The table shows that most of the genes upregulated in DMD muscle were downregulated or not altered by oxandrolone treatment. The muscle development genes that were downregulated by oxandolone included a number related to muscle differentiation from precursor cells. Four and a half LIM domains 1 (FHL1) is a transcription factor thought to play an important role during the early stages of skeletal muscle differentiation (34). Interferon-related developmental regulator 1 (IFRD1) is involved with myoblast fate determination (19). Vesicle-associated membrane protein 5 (myobrevin, VAMP5) is involved in vesicle trafficking events that are associated with myogenesis (55). MAP kinase 12 (MAPK12) is thought to be a signal transducer of the stress-sensing mechanism during differentiation between myoblasts and myotubes (24). Ankyrin repeat domain 2 (ANKRD2) is also part of the stress-sensing mechanism in muscle (29). Myogenic factor 6 (MYF6) is a myogenic transcription factor (43). Histone deacetylase 4 (HDAC4) is involved with transcription regulation mediated by the myogenic factors myocyte enhancer factors 2C and 2D (37). Insulin-like growth factor I (IGF-I) is a potent anabolic agent for skeletal muscle (6), promotes muscle regeneration (7), and acts in an autocrine manner in regenerating muscle (27). The data from Haslett et al. showed an upregulation of IGF-I in DMD muscle (Table 5). This gene was downregulated in response to oxandrolone.


View this table:
[in this window]
[in a new window]
 
Table 4. Biological processes with a greater than expected number of genes differentially regulated

 

View this table:
[in this window]
[in a new window]
 
Table 5. Expression levels of muscle development genes

 
To determine MHC mRNA expression levels with more precision, real-time RT-qPCR was done (Table 6). As in the microarray analysis, MHC8 (skeletal, perinatal) was upregulated 1.6-fold (log2 ratio of 0.68 ± 0.18; P = 0.048) by oxandrolone treatment (Fig. 3). No other MHC mRNAs were significantly altered.


View this table:
[in this window]
[in a new window]
 
Table 6. Myosin heavy chain mRNA expression determined by RT-qPCR

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
A limitation of this study is the small sample size. Because this was a demanding, labor-intensive study that involved multiple muscle biopsies and stable isotope infusions in a population of children with a devastating disease, recruitment typically was difficult. However, despite differences in age and disease stage, the findings of this study clearly demonstrate that the anabolic effect of oxandrolone on muscle in DMD may be mediated by a stimulation of the synthesis rate of MHC, a key contractile protein in skeletal muscle. A significant augmentation of the FSR of MHC in response to oxandrolone in children with DMD, as well as changes in gene expression profile and transcript levels of isoforms of MHC, was observed. This increase in the synthetic rate of MHC appears to be, at least in part, through an upregulation of the transcript for the perinatal isoform of MHC. The pathophysiology of DMD involves the accelerated degeneration of muscle tissue because of membrane weakness caused by the mutation in the dystrophin gene. In the early stages of the disease, accelerated regeneration of muscle allows for near-normal function. It is felt that it is the steady loss of regenerative capacity that results in the long-term decline in these patients (18, 41, 42). Consistent with this, Haslett et al. (21) and Chen et al. (9) compared global transcript levels from DMD muscle with those from normal muscle and found an overall upregulation of genes associated with muscle regeneration. The data presented here using the same technology showed that oxandrolone had the effect of downregulating many of these genes in DMD muscle. We therefore conclude that oxandrolone has the effect of reducing muscle regeneration. None of the subjects in this small, short-term study showed a decline in muscle function, and others have shown modest improvement in DMD patients treated with oxandrolone (14). Hence, if regeneration has been decreased with no change or improvement in muscle function, there must have been a concomitant decrease in muscle degeneration.

The stable-isotope studies carried out in the current studies revealed higher baseline FSR for MHC than those reported in normal subjects (3, 23). These higher rates of MHC synthesis are consistent with the previously reported high turnover rate of myofibrillar proteins (assessed by 3-methylhistidine and creatinine excretion) in DMD (4, 35, 36), mixed-muscle proteins in the mdx mouse (32), and the FSR of mixed-muscle protein in DMD and Becker dystrophy (42). We furthermore showed a clear rise in MHC synthesis in these subjects in response to oxandrolone. There was a modest increase in the expression level of MHC8 (perinatal MHC), which likely played some part. However, MHC8 represented only a fraction of the MHCs being produced by this tissue, and the modest increase does not seem enough to explain the changes. An alternate explanation is that there was an increase in the efficiency of the translation process for MHCs in general. A lack of a noticeable change (improvement) in muscle strength in the current study may, however, be related to the limited sensitivity of the MMT used for strength measurement, the duration of intervention, and the small sample size. The study by Fennichel et al. (14), on the other hand, demonstrated an improvement in the total muscle strength score in response to oxandrolone treatment for 6 mo (14).

Additionally, the increase in the synthesis rate and concentration of albumin, a nutritionally important liver protein, is intriguing. These, along with the increase in the ASR of albumin, suggest an overall increase in the turnover of albumin. The implications of these outcomes are not clear from this study, but animal studies have suggested that the peripheral breakdown of circulating albumin contributes substantially to the total amino acid output available for protein synthesis in other tissues (30), and various human studies have showed that amino acid availability is an essential component in regulating muscle protein metabolism (50). In any case, the increase in the concentration of albumin along with increased synthesis rates of albumin and MHC suggest that oxandrolone has an overall protein anabolic effect in DMD, and its effect is not limited to muscle only.

The gene expression data showed a generalized downregulation of genes involved in energy pathways, translation, and transcription. Despite this, there is evidence of increased efficiency of MHC synthesis. This implies that there has been a reduction in demands for synthesis of other proteins that was greater than the increase in demand for MHC synthesis. One potential mechanism, as stated above, is a putative reduction in muscle regeneration. Because muscle regeneration involves a high-energy cost and the need for accelerated protein synthesis, even a small reduction in muscle regeneration would be expected to substantially reduce the energy and synthesis needs of muscle tissue. This suggests that the major anabolic effect of oxandrolone may be in slowing down the degenerative process rather than upregulating the regeneration process, which is already overstretched. There is also a possibility that posttranslational changes may contribute to increased protein accretion. Indeed these hypotheses need to be validated independently.

The mechanism of action of anabolic steroids (androgens) on muscle on the molecular level remains poorly understood. The classical androgen pathway entails the steroid entering the cell by diffusion and binding to the androgen receptor. The complex translocates to the nucleus and acts as a transcription factor. This pathway has been implicated in a direct effect on muscle protein synthesis for testosterone (15) and oxandrolone (46). In the study presented here, we describe an increase in MHC synthesis with only a modest increase in MHC mRNA expression levels and a decrease in the genes involved in translation, suggesting this anabolic effect was not a direct genomic action. Androgens have been shown to stimulate recruitment of precursor cells into myoblasts (47), and long-term testosterone treatment has been shown to upregulate IGF-I gene expression (46), presumably through recruitment of myoblasts, since IGF-I is not expressed in mature muscle fibers (27). Our results, however, demonstrate a decrease in muscle regeneration and decreased IGF-I expression, further suggesting that this was not the predominant effect of oxandrolone here. Nongenomic effects of the androgen receptor have also been described, including a role in calcium regulation in skeletal muscles via an inositol triphosphate-mediated pathway (12). The effects of this pathway are unknown. Determining whether and how this or other pathways could be involved in slowing the muscle degeneration in DMD would require further studies.

In summary, we conclude that oxandrolone has anabolic effects on DMD muscle and also has the effect of decreasing muscle degeneration, easing the demands for muscle regeneration. We speculate that, by conserving regenerative capacity, long-term therapy with oxandrolone may prolong muscle function in these patients. Treatment approaches to incorporate these responses into a multidrug paradigm or other therapies could prove to be beneficial to DMD patients. Larger studies are needed to determine whether these tissue-level effects of oxandrolone translate into functional improvement for boys with DMD.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Microarray data were generated by the Service Facility of the Center for Applied Genomics, Public Health Research Institute, which is supported by the New Jersey Commission on Science and Technology. We received a travel grant from BTG for this study. This study was supported by grants from Nemours Research Programs.


    ACKNOWLEDGMENTS
 
We thank the volunteers for participating in this demanding study. We are grateful to Burnese Rutledge, Shiela Smith, and the nursing staff of the Clinical Research Center at the Wolfson Children's Hospital for superb assistance; Brenda Sager, Shawn Sweeten, Lynda Everline, Astride Altomare, Rebecca Macken, and Jeff Bailey for skilled technical assistance; Karen Lanier for excellent secretarial support; Dr. Michael Pollack for providing one DMD patient for the study; Dr. Jim Sylvester for helpful comments; Dr. Ted Kramer and Bio-Technology General Corp (BTG) for providing oxandrolone free of cost for the treatment; and Dr. Vicky Funanage for helpful comments and constant support.


    FOOTNOTES
 

Address for reprint requests and other correspondence: P. Balagopal, Dept. of Research, Nemours Children's Clinic and Mayo Clinic College of Medicine, 807 Children's Way, Jacksonville, FL 32207 (e-mail: bbalagop{at}nemours.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Balagopal P, Ford GC, Ebenstein DB, Nadeau DA, and Nair KS. Mass spectrometric methods for determination of [13C]leucine enrichment in human muscle protein. Anal Biochem 239: 77–85, 1996.[CrossRef][Web of Science][Medline]
  2. Balagopal P, Nair KS, and Stirewalt WS. Isolation of myosin heavy chain from small skeletal muscle samples by preparative continuous elution gel electrophoresis: application to measurement of synthesis rate in human and animal tissue. Anal Biochem 221: 72–77, 1994.[CrossRef][Web of Science][Medline]
  3. Balagopal P, Rooyackers OE, Adey DB, Ades PA, and Nair KS. Effects of aging on in vivo synthesis of skeletal muscle myosin heavy chain and sarcoplasmic protein in humans. Am J Physiol Endocrinol Metab 273: E790–E800, 1997.[Abstract/Free Full Text]
  4. Ballard FJ, Tomas FM, and Stern LM. Increased turnover of muscle contractile proteins in Duchenne muscular dystrophy as assessed by 3-methylhistidine and creatinine excretion. Clin Sci (Colch) 56: 347–352, 1979.[Medline]
  5. Ballmer PE, McNurlan MA, Milne E, Heys SD, Buchan V, Calder AG, and Garlick PJ. Measurement of albumin synthesis in humans: a new approach employing stable isotopes. Am J Physiol Endocrinol Metab 259: E783–E797, 1990.
  6. Bark TH, McNurlan MA, Lang CH, and Garlick PJ. Increased protein synthesis after acute IGF-I or insulin infusion is localized to muscle in mice. Am J Physiol Endocrinol Metab 275: E118–E123, 1998.[Abstract/Free Full Text]
  7. Barton-Davis ER, Shoturma DI, Musaro A, Rosenthal N, and Sweeney HL. Viral mediated expression of insulin-like growth factor I blocks the aging-related loss of skeletal muscle function. Proc Natl Acad Sci USA 95: 15603–15607, 1998.[Abstract/Free Full Text]
  8. Baugh LR, Hill AA, Brown EL, and Hunter CP. Quantitative analysis of mRNA amplification by in vitro transcription (Abstract). Nucleic Acids Res 29: E29, 2001.
  9. Chen YW, Zhao P, Borup R, and Hoffman EP. Expression profiling in the muscular dystrophies: identification of novel aspects of molecular pathophysiology. J Cell Biol 151: 1321–1336, 2000.[Abstract/Free Full Text]
  10. Doniger SW, Salomonis N, Dahlquist KD, Vranizan K, Lawlor SC, and Conklin BR. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data (Abstract). Genome Biol 4: R7, 2003.[CrossRef][Medline]
  11. Eisenberg E and Levanon EY. Human housekeeping genes are compact. Trends Genet 19: 362–365, 2003.[CrossRef][Web of Science][Medline]
  12. Estrada M, Espinosa A, Muller M, and Jaimovich E. Testosterone stimulates intracellular calcium release and mitogen-activated protein kinases via a G protein-coupled receptor in skeletal muscle cells. Endocrinology 144: 3586–3597, 2003.[Abstract/Free Full Text]
  13. Fenichel G, Pestronk A, Florence J, Robison V, and Hemlet V. A beneficial effect of oxandrolone in the treatment of Duchenne muscular dystrophy: a pilot study. Neurology 48: 1225–1226, 1997.[Abstract/Free Full Text]
  14. Fenichel GM, Griggs RC, Kissel J, Kramer TI, Mendell JR, Moxley RT, Pestronk A, Sheng K, Florence J, King WM, Pandya S, Robison VD, and Wang H. A randomized efficacy and safety trial of oxandrolone in the treatment of Duchenne dystrophy. Neurology 56: 1075–1079, 2001.[Abstract/Free Full Text]
  15. Ferrando AA, Sheffield-Moore M, Yeckel CW, Gilkison C, Jiang J, Achacosa A, Lieberman SA, Tipton K, Wolfe RR, and Urban RJ. Testosterone administration to older men improves muscle function: molecular and physiological mechanisms. Am J Physiol Endocrinol Metab 282: E601–E607, 2002.[Abstract/Free Full Text]
  16. Fu AZ and Nair KS. Age effect on fibrinogen and albumin synthesis in humans. Am J Physiol Endocrinol Metab 275: E1023–E1030, 1998.[Abstract/Free Full Text]
  17. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, Hornik K, Hothorn T, Huber W, Iacus S, Irizarry R, Leisch F, Li C, Maechler M, Rossini AJ, Sawitzki G, Smith C, Smyth G, Tierney L, Yang JY, and Zhang J. Bioconductor: open software development for computational biology and bioinformatics (Abstract). Genome Biol 5: R80, 2004.[CrossRef][Medline]
  18. Griggs RC and Rennie MJ. Muscle wasting in muscular dystrophy: decreased protein synthesis or increased degradation? Ann Neurol 13: 125–132, 1983.[CrossRef][Web of Science][Medline]
  19. Guardavaccaro D, Ciotti MT, Schafer BW, Montagnoli A, and Tirone F. Inhibition of differentiation in myoblasts deprived of the interferon-related protein PC4. Cell Growth Differ 6: 159–169, 1995.[Abstract]
  20. Hart DW, Wolfe SE, Ramzy PI, Chinkes DL, Beaufoerd RB, Ferrando A, Wolfe RR, and Herndon DN. Anabolic effects of oxandrolone after severe burn. Ann Surg 233: 556–564, 2001.[CrossRef][Web of Science][Medline]
  21. Haslett JN, Sanoudou D, Kho A, Bennett RR, Greenberg SA, Kohane IS, Beggs AH, and Kunkel LM. Expression profiling reveals altered satellite cell numbers and glycolytic enzyme transcription in nemaline myopathy muscle. Proc Natl Acad Sci USA 99: 15000–15005, 2002.[Abstract/Free Full Text]
  22. Hasten DL, Morris GS, Ramanadham S, and Yarasheski KE. Isolation of human skeletal muscle myosin heavy chain and actin for measurement of fractional synthesis rates. Am J Physiol Endocrinol Metab 275: E1092–E1099, 1998.[Abstract/Free Full Text]
  23. Hasten DL, Pak-Loduca J, Obert KA, and Yarasheski KE. Resistance exercise acutely increases MHC and mixed muscle protein synthesis rates in 78–84 and 23–32 yr olds. Am J Physiol Endocrinol Metab 278: E620–E626, 2000.[Abstract/Free Full Text]
  24. Ho RC, Alcazar O, Fujii N, Hirshman MF, and Goodyear LJ. p38-{gamma} MAPK regulation of glucose transporter expression and glucose uptake in L6 myotubes and mouse skeletal muscle. Am J Physiol Regul Integr Comp Physiol 286: R342–R349, 2004.[Abstract/Free Full Text]
  25. Hoffman E, Fischbeck K, Brown R, Johnson M, Medori R, Loike JD, Harris JB, Waterston R, Brooke M, Specht L, Kupsky W, Chamberlain J, Laskey T, Shapiro F, and Kunkel LM. Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne's or Becker's muscular dystrophy. N Engl J Med 318: 1363–1368, 1988.[Abstract]
  26. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, and Speed TP. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostat 4: 249–264, 2003.
  27. Keller HL, St Pierre SB, Eppihimer LA, and Cannon JG. Association of IGF-I and IGF-II with myofiber regeneration in vivo. Muscle Nerve 22: 347–354, 1999.[CrossRef][Web of Science][Medline]
  28. Koenig M, Monaco AP, and Kunkel LM. The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell 53: 219–226, 1988.[CrossRef][Web of Science][Medline]
  29. Kojic S, Medeot E, Guccione E, Krmac H, Zara I, Martinelli V, Valle G, and Faulkner G. The Ankrd2 protein, a link between the sarcomere and the nucleus in skeletal muscle. J Mol Biol 339: 313–325, 2004.[CrossRef][Web of Science][Medline]
  30. Komjati M and Waldhausl W. Contribution of plasma proteins to muscular de novo synthesis of glutamine. Metabolism 38: 52–55, 1989.[Medline]
  31. Korner A and Debro JR. Solubility of albumin in alcohol after precipitation by trichloroacetic acid: a simplified procedure for separation of albumin (Abstract). Nature 178: 1067, 1956.[Medline]
  32. Mac Lennan PA and Edwards RHT. Protein turnover is elevated in muscle of mdx mice in vivo. Biochem J 268: 795–797, 1990.[Web of Science][Medline]
  33. Matthews DE, Motil KJ, Rohrbaugh DK, Burke JF, Young VR, and Bier DM. Measurement of leucine metabolism in man from a primed, continuous infusion of L-[13C]leucine. Am J Physiol Endocrinol Metab 238: E473–E479, 1980.[Abstract/Free Full Text]
  34. McGrath MJ, Mitchell CA, Coghill ID, Robinson PA, and Brown S. Skeletal muscle LIM protein 1 (SLIM1/FHL1) induces {alpha}5beta1-integrin-dependent myocyte elongation. Am J Physiol Cell Physiol 285: C1513–C1526, 2003.[Abstract/Free Full Text]
  35. McKeran RO, Halliday D, and Purkiss P. Increased myofibrillar protein catabolism in Duchenne muscular dystrophy measured by 3-methylhistidine excretion in the urine. J Neurol Neurosurg Psychiatry 40: 979–981, 1977.[Abstract/Free Full Text]
  36. McKeran RO, Halliday D, Purkiss P, and Royston P. 3-Methylhistidine excretion as an index of myofibrillar protein catabolism in neuromuscular disease. J Neurol Neurosurg Psychiatry 42: 536–541, 1979.[Abstract/Free Full Text]
  37. McKinsey TA, Zhang CL, Lu J, and Olson EN. Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature 408: 106–111, 2000.[CrossRef][Medline]
  38. Nair KS, Halliday D, and Griggs RC. Leucine incorporation into mixed skeletal muscle protein in humans. Am J Physiol Endocrinol Metab 254: E208–E213, 1988.[Abstract/Free Full Text]
  39. Nikkila EA and Kekki M. Plasma triglyceride transport kinetics in diabetes mellitus. Metabolism 22: 1–22, 1973.[CrossRef][Web of Science][Medline]
  40. Olney R, Anhalt H, Neely K, and Wilson D. A quantitative assay for IGF-I and IGF binding protein mRNAs: expression in malignant melanoma cells. Mol Cell Endocrinol 110: 213–223, 1995.[CrossRef][Medline]
  41. Rennie MJ, Edwards RH, Millward DJ, Wolman SL, Halliday D, and Matthews DE. Effects of Duchenne muscular dystrophy on muscle protein synthesis. Nature 296: 165–167, 1982.[CrossRef][Medline]
  42. Rifai Z, Welle S, Moxley RT3, Lorenson M, and Griggs RC. Effect of prednisone on protein metabolism in Duchenne dystrophy. Am J Physiol Endocrinol Metab 268: E67–E74, 1995.[Abstract/Free Full Text]
  43. Roy K, de la Serna IL, and Imbalzano AN. The myogenic basic helix-loop-helix family of transcription factors shows similar requirements for SWI/SNF chromatin remodeling enzymes during muscle differentiation in culture. J Biol Chem 277: 33818–33824, 2002.[Abstract/Free Full Text]
  44. Salman EK, Haymond MW, Bayne E, Sager BK, Wiisanen A, Pitel P, and Darmaun D. Protein and energy metabolism in prepubertal children with sickle cell anemia. Pediatr Res 40: 34–40, 1996.[Web of Science][Medline]
  45. Schroeder ET, Zheng L, Yarasheski KE, Qian D, Stewart Y, Flores C, Martinez C, Terk M, and Sattler FR. Treatment with oxandrolone and the durability of effects in older men. J Appl Physiol 96: 1055–1062, 2004.[Abstract/Free Full Text]
  46. Sheffield-Moore M, Urban RJ, Wolfe SE, Jiang J, Catlin DH, Herndon Wolfe RR, and Ferrando AA. Short-term oxandrolone administration stimulates net muscle protein synthesis in young men. J Clin Endocrinol Metab 84: 2705–2711, 1999.[Abstract/Free Full Text]
  47. Singh R, Artaza JN, Taylor WE, Gonzalez-Cadavid NF, and Bhasin S. Androgens stimulate myogenic differentiation and inhibit adipogenesis in C3H 10T1/2 pluripotent cells through an androgen receptor-mediated pathway. Endocrinology 144: 5081–5088, 2003.[Abstract/Free Full Text]
  48. Strawford A, Barbieri T, and Van Loan M. Resistance exercise and supraphysiologic androgen therapy in eugonadal men with HIV-related weight loss: a randomized controlled trial. JAMA 281: 1282–1290, 1999.[Abstract/Free Full Text]
  49. Tusher VG, Tibshirani R, and Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 98: 5116–5121, 2001.[Abstract/Free Full Text]
  50. Volpi E, Lucidi P, Cruciani G, Monacchia F, Reboldi G, Brunetti P, Bolli GB, and De Feo P. Contribution of amino acids and insulin to protein anabolism during meal absorption. Diabetes 45: 1245–1252, 1996.[Abstract]
  51. von Heydebreck A, Huber W, and Gentleman R. Differential expression with the Bioconductor project. Bioconductor Project Working Papers 7: 1–15, 2004.
  52. Welle S, Thornton C, Jozefowicz R, and Statt M. Myofibrillar protein synthesis in young and old men. Am J Physiol Endocrinol Metab 264: E693–E698, 1993.[Abstract/Free Full Text]
  53. Wolfe RR. Radioactive and Stable Isotope Tracers in Biomedicine: Principles and Practice of Kinetic Analysis. New York: Wiley, 1992.
  54. Wolfe SE, Thomas SJ, Ferrando AA, Chinkes DL, Wolfe RR, and Herndon DN. Improved net protein balance, lean mass, and gene expression changes with oxandrolone treatment in the severely burned. Ann Surg 237: 801–810, 2003.[CrossRef][Web of Science][Medline]
  55. Zeng Q, Subramaniam VN, Wong SH, Tang BL, Parton RG, Rea S, James DE, and Hong W. A novel synaptobrevin/VAMP homologous protein (VAMP5) is increased during in vitro myogenesis and present in the plasma membrane. Mol Biol Cell 9: 2423–2437, 1998.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/3/E530    most recent
00412.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balagopal, P.
Right arrow Articles by Hammond, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balagopal, P.
Right arrow Articles by Hammond, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.