AJP - Endo Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 290: E409-E415, 2006. First published October 11, 2005; doi:10.1152/ajpendo.00433.2005
0193-1849/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/3/E409    most recent
00433.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welle, S.
Right arrow Articles by Pinkert, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welle, S.
Right arrow Articles by Pinkert, C. A.

Myofibrillar protein synthesis in myostatin-deficient mice

Stephen Welle,1 Kirti Bhatt,1 and Carl A. Pinkert2

Departments of 1Medicine and 2Pathology and Laboratory Medicine in the Center for Aging and Developmental Biology, University of Rochester, Rochester, New York

Submitted 9 September 2005 ; accepted in final form 3 October 2005


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Either increased protein synthesis or prolonged protein half-life is necessary to support the excessive muscle growth and maintenance of enlarged muscles in myostatin-deficient mice. This issue was addressed by determining in vivo rates of myofibrillar protein synthesis in mice with constitutive myostatin deficiency (Mstn{Delta}E3/{Delta}E3) or normal myostatin expression (Mstn+/+) by measuring tracer incorporation after a systemic flooding dose of L-[ring-2H5]phenylalanine. At 5–6 wk of age, Mstn{Delta}E3/{Delta}E3 mice had increased muscle mass (40%), fractional rates of myofibrillar synthesis (14%), and protein synthesis per whole muscle (60%) relative to Mstn+/+ mice. With maturation, fractional rates of synthesis declined >50% in parallel with decreased DNA and RNA [total, 28S rRNA, and poly(A) RNA] concentrations in muscle. At 6 mo of age, Mstn{Delta}E3/{Delta}E3 mice had even greater increases in muscle mass (90%) and myofibrillar synthesis per muscle (85%) relative to Mstn+/+ mice, but the fractional rate of synthesis was normal. Estimated myofibrillar protein half-life was not affected by myostatin deficiency. Muscle DNA concentrations were reduced in both young and mature Mstn{Delta}E3/{Delta}E3 mice, whereas RNA concentrations were normal, so the ratio of RNA to DNA was ~30% greater than normal in Mstn{Delta}E3/{Delta}E3 mice. Thus the increased protein synthesis and RNA content per muscle in myostatin-deficient mice cannot be explained entirely by an increased number of myonuclei.

muscle growth; ribonucleic acid; deoxyribonucleic acid; ubiquitin; cathepsin B


MYOSTATIN IS A TGF-beta FAMILY MEMBER that is a key regulator of muscle mass. In mice, constitutive knockout of the segment of the myostatin gene that encodes the active part of the myostatin peptide results in double muscling caused by both muscle fiber enlargement and an increased number of muscle fibers (8). Naturally occurring mutations of the myostatin gene cause increased muscle mass in cattle (10) and humans (13).

For muscle protein mass to increase during normal growth, the rate of protein synthesis must exceed the rate of protein breakdown. Net protein balance must be even more positive with myostatin deficiency. After muscles have stopped growing, there is an equilibrium between muscle protein synthesis and protein breakdown. At equilibrium, the protein mass of a muscle fiber or a whole muscle depends on both the rate of protein synthesis and the protein half-life. Protein turnover is important even after growth has ceased, because it is required for replacement of protein molecules that have been damaged by reactive radicals in the cells. Protein synthesis requires considerable energy (20), and the energy required to maintain even a normal rate of protein synthesis in the enormous muscles of myostatin-deficient mice could be a major component of their elevated metabolic rate (9).

The only reported study of the effect of myostatin on protein metabolism was done in vitro with C2C12 myoblasts and myotubes derived from these cells (16). Addition of myostatin to the culture medium, at 6 µg/ml, inhibited the rate of protein synthesis by >50% without affecting the rate of protein breakdown. These data do not prove that myostatin has an important role in regulating muscle protein synthesis in vivo, because muscle fibers might respond to myostatin differently than C2C12 myotubes and because the concentration of active myostatin in muscle in vivo could be less than the concentration required to inhibit protein synthesis. We therefore examined the rates of myofibrillar protein synthesis in vivo in normal mice and in mice with constitutive myostatin deficiency. We examined myofibrillar rather than total tissue protein synthesis because myofibrils occupy the majority of the volume of muscle fibers. Limiting the analysis to myofibrillar proteins excluded the possibility that results would be influenced by turnover of proteins produced by mononuclear cells, such as satellite cells and vascular endothelial cells, which comprise a very small fraction of the muscle volume.

Myostatin signaling involves activation, via phosphorylation, of the transcription regulators Smad2 and Smad3 (6). Smad signaling is inhibited by the nuclear protein c-ski (6). Overexpression of c-ski causes muscle hypertrophy (1, 15), and it is possible that interference with myostatin signaling explains this hypertrophy. The rate of incorporation of [14C]phenylalanine (per mg protein) into skeletal muscle proteins is normal in mice overexpressing c-ski, whereas a greater retention of [3H]phenylalanine in muscle proteins 48 h after [3H]phenylalanine injection in c-ski mice suggests a reduced rate of protein degradation (1). An inhibitory effect of c-ski overexpression on proteolysis is further supported by the observation that muscles of these mice have only one-half the normal concentration of mRNAs encoding ubiquitin and cathepsin B. If these effects of c-ski overexpression are explained by inhibition of the myostatin signaling pathway, then myostatin-deficient mice should also have reduced expression of these mRNAs. We therefore examined levels of mRNAs encoding ubiquitin and cathepsin B.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Generation of myostatin-deficient mice. In the course of producing mice for conditional deletion of the third exon of the myostatin gene, which encodes the entire active portion of the myostatin peptide, we have generated mice lacking the third exon (studies of postdevelopmental myostatin depletion will be done after we identify a suitable Cre recombinase transgene). With standard gene targeting methods (11, 12), the wild-type myostatin gene (generously provided by Dr. Se-Jin Lee) was replaced in AB1 ES cells (129S6/SvEvTac; subcloned from ES cells generously provided by Dr. A. Bradley) with the gene shown in Fig. 1. The construct contained a loxP sequence upstream of exon 3 and a floxed neomycin resistance (neoR) gene downstream of exon 3. A HindIII site near the neoR gene permitted identification of clones with homologous recombination by Southern blotting of HindIII-digested genomic DNA with a probe provided by Dr. S. J. Lee (8). We identified two ES cell clones with homologous recombination. These cells were grown and injected into C57BL/6NTac blastocysts (from mice obtained from Taconic Farms, Germantown, NY), which were implanted in pseudopregnant mice. Four chimerae were produced and bred to C57BL/6J wild-type mice (The Jackson Laboratory, Bar Harbor, ME). One founder chimera sired several F1 offspring with a floxed myostatin allele (designated Mstnf/+), as identified by PCR of DNA from tail biopsies obtained at weaning (PCR primers are listed in Table 1). Another chimera generated 13 pups, but none harbored the floxed allele and the other two did not produce any offspring after 4 mo of breeding with wild-type mice. The F1 Mstnf/+ mice were mated with EIIa-Cre transgenic mice (C57BL/6 background, obtained from The Jackson Laboratory) to generate mice chimeric with respect to the different Cre-mediated recombination events shown in Fig. 1 (4). These chimeric mice were then mated with C57BL/6J mice, and offspring lacking the EIIa-Cre gene were screened by PCR to identify mice with deletion of both exon 3 and the neoR gene (designated Mstn{Delta}E3/+). Mstn{Delta}E3/+ mice were mated with C57BL/6J mice, and then their Mstn{Delta}E3/+ offspring were mated with one another to generate Mstn{Delta}E3/{Delta}E3 mice and Mstn+/+ controls.


Figure 1
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. Strategy for removing exon 3 of myostatin gene. During homologous recombination, the DNA construct with exon 3 flanked by loxP (floxed) replaced the wild-type gene. Neomycin resistance gene (neoR) allowed selection of ES cells in which the construct was incorporated into the genome. The thymidine kinase gene (TK) was removed with homologous recombination but not random insertion of the construct into the genome, so that treatment of ES cells with gancyclovir selected against clones with random insertion of the gene. Homologous recombination was detected by Southern blotting of DNA digested with HindIII (H), using probe near the downstream cutting site (noted as bar under diagram of wild-type gene). Mice with a floxed allele were mated with EIIa-Cre mice to induce the different Cre-mediated recombination events shown as A–D. Myostatin-deficient (Mstn{Delta}E3/{Delta}E3) mice used in present study lost both exon 3 and neoR gene through either a single recombination (A) or 2 consecutive recombinations (D). X, XbaI.

 

View this table:
[in this window]
[in a new window]
 
Table 1. PCR primers

 
Twelve Mstn{Delta}E3/{Delta}E3 mice and 12 Mstn+/+ controls were examined in the present study. Six mice of each genotype were examined at 5–6 wk of age and the others at 6 mo of age. There were equal numbers of male and female mice in each group. All mice were given ad libitum access to food and water. They were maintained in MicroVENT cages (Allentown Caging, Allentown, NJ) in a specified pathogen-free room on a 12:12-h light-dark cycle (lights on at 0600).

All mice were maintained in a specific pathogen-free barrier facility and were anesthetized by Avertin (2,2,2-tribromoethanol) injection during any potentially painful procedure. Mice were monitored carefully after anesthesia until full recovery. Mice were euthanatized by CO2 inhalation or Avertin sedation, followed by cervical dislocation. All procedures followed the American Veterinary Medicine Association guide per institutional guidelines. All animal procedures and experiments were performed according to protocols approved by an Institutional Animal Use and Care Committee (UCAR) and the U.S. Office of Laboratory Animal Welfare (Univ. of Rochester Medical Center assurance A3292-01) in an Association for Assessment and Accreditation of Laboratory Animal Care-accredited vivarium facility.

Incorporation of L-[ring-2H5]phenylalanine (2H5-Phe) into myofibrillar proteins. The Phe flooding method (2) was used to determine the rate of myofibrillar protein synthesis. Previously, radiolabeled Phe has been used to examine muscle protein synthesis in rodents, but we used a stable-isotope tracer to avoid the problems and costs associated with handling radioactive carcasses and tissues. Moreover, because the mass spectrometer directly determines the ratio of tracer to tracee, the use of a stable isotope tracer improves precision. 2H5-Phe was obtained from Cambridge Isotope Laboratories (Andover, MA). The 150 mM 2H5-Phe-75 mM NaCl solution was injected intraperitoneally at a dose of 2 ml/100 g body wt. Thirty minutes after tracer injection, mice were killed by CO2 inhalation and cervical dislocation, and then gastrocnemius and quadriceps muscles were removed, weighed, and frozen in liquid nitrogen. All tracer injections were performed between 0900 and 1030.

When this amount of radiolabeled Phe is given intraperitoneally to young rats, there is a rapid rise (≤3 min) to peak specific activity of free Phe in muscle, which is maintained until ≥15 min after tracer injection (5). This dose of radiolabeled Phe also has been administered intraperitoneally to study muscle protein synthesis in mice (7), but the time course of the specific activity of free Phe in muscle was not examined. We therefore determined the time course of free 2H5-Phe enrichment in gastrocnemius muscles at several time points from 0.5 to 30 min after intraperitoneal tracer injection. As illustrated in Fig. 2, 2H5-Phe enrichment rose very rapidly, reaching peak values of ~80–85% within ~5 min. Peak enrichment was sustained until 15–20 min after tracer administration, and declined only slightly between 20 and 30 min after the injection. The free 2H5-Phe enrichment at 30 min approximated the mean enrichment from 0 to 30 min (area under curve divided by time). Thus the enrichment of free 2H5-Phe at 30 min after tracer injection is an appropriate index of the ratio of labeled to unlabeled Phe incorporated into myofibrillar proteins.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. Time course of free [2H5]phenylalanine(D5-Phe) enrichment in muscle tissue fluid after ip injection of D5-Phe in 5-wk-old (±2 wk) normal mice (2 ml/100 g body wt of 150 mM D5-Phe/75 mM NaCl). Error bars are SE of 3–8 mice. Lack of error bar indicates data from single mouse.

 
Gastrocnemius muscles were homogenized in 1 ml of H2O. The homogenate was centrifuged (1,500 g for 10 min), and the supernatant was removed for assessment of free 2H5-Phe enrichment. The pellet was processed for extraction of myofibrillar proteins and acid hydrolysis of these proteins as described previously for studies of human muscle (21). The free amino acid fractions (acidified with 0.5 ml of glacial acetic acid), and the protein hydrolysates were applied to columns of cation exchange resin (100–200 mesh AG 50W-X8; Bio-Rad, Hercules, CA) that retained the amino acids. The columns were washed with 4 volumes of H2O, and then amino acids were eluted with 4 volumes of 4 M NH4OH. Eluates were dried in a vacuum evaporator, then tert-butyldimethylsilyl (TBDMS) derivatives of amino acids (14) were made by addition of equal volumes of acetonitrile and N-methyl-N-t-butyldimethylsilyl-trifluoroacetamide (MTBSTFA)-1% t-butyldimethylchlorosilane (BDMCS) (Regis) and heating at 70°C for 1 h. Derivatives were separated by gas chromatography (Agilent 6890), and TBDMS-Phe was detected by mass spectrometry (Agilent 5973 Mass Selective Detector) with electron impact ionization. Ions with masses of 234, 237, and 239 amu were monitored. The 234 signal represents a fragment of TBDMS-Phe with no heavy atoms, the 239 signal represents a fragment of TBDMS-2H5-Phe with no other heavy atoms, and the 237 signal represents a fragment of the TBDMS-Phe in which there are, by chance, two to three heavy atoms (which could include 13C, 2H, 15N, 29Si, or 30Si). The 239 signal of the protein hydrolysates was ~1,000-fold less than the 234 signal; therefore, the column was overloaded (i.e., the 234 signal saturated the detector) to generate strong 239 signals. Thus for the protein hydrolysates we evaluated the 239/237 ratios. When we used amounts that did not overload the column, the 237/234 ratio was 0.84%, so the 2H5-Phe enrichment was calculated as the 239/237 ratio x 0.84% – 0.014% (0.014% is the "enrichment" observed in muscle without 2H5-Phe administration, due to naturally occurring heavy atoms). The fraction of newly synthesized proteins was calculated as (2H5-Phe enrichment in protein hydrolysate) ÷ (2H5-Phe enrichment of free amino acid pool).

Neither the total protein concentration per milligram of tissue nor the amount of actin and myosin per milligram of total protein was affected by myostatin deficiency (see RESULTS). Thus the fractional rate of synthesis was multiplied by 12% of the wet weight of the muscle (21) to compute the absolute rate of myofibrillar synthesis per whole muscle in both normal and myostatin-deficient mice.

Determination of protein, DNA, RNA, and mRNA concentrations in muscle. A piece of the quadriceps muscle (~50 mg) was digested overnight at 55°C with proteinase K (0.3 mg/ml in 200 µl of buffer with 10 mM Tris·HCl, pH 9, 50 mM KCl, 0.1% Triton X-100), and then the DNA concentration of the digest was determined with a colorimetric procedure (3). Another piece of ~50 mg was cut into smaller fragments (~10 mg) that were placed in 6 M urea with 1% SDS to dissolve proteins (55°C for 3 h). Protein concentrations were determined with a colorimetric assay (Bio-Rad Protein Assay Kit). Representative protein samples were examined with PAGE to ensure that the concentrations of the major myofibrillar proteins myosin heavy chain and actin were normal in myostatin-deficient muscle. Another piece of 50–100 mg was homogenized in Tri Reagent for extraction of total RNA, as suggested by the manufacturer (Molecular Research Center, Cincinnati, OH). RNA concentrations in the final extracts (1 µl/mg tissue) were determined with a GeneQuant UV absorbance analyzer (Amersham Biosciences).

Total mRNA (polyadenylated RNA) and 28S rRNA levels were determined by a modification of a slot-blot method (18). Oligonucleotide probes were labeled with fluorescent dyes rather than 32P. The 23-mer oligo(dT) probe was labeled with IRDye 700, and the 28S rRNA probe (aacgatgagagtagtggtatttc) was labeled with IRDye 800 (Li-Cor Biosciences, Lincoln, NE). Each slot was loaded with 100 ng of total RNA, and the membrane was placed in hybridization solution with 5 nM oligo(dT) probe and 3 nM 28S rRNA probe. Hybridization and washes were done at 37°C rather than room temperature. The membrane was scanned for fluorescence of the IRDyes by use of an Odyssey Imaging System (Li-Cor).

Expression of ubiquitin C and cathepsin B mRNAs was determined by RT-PCR with competitive internal standards. The principle and general method have been described elsewhere (19). All RNA samples were reverse transcribed on the same day with the same RT reaction mixture. Under these conditions, expression levels of specific mRNAs are less variable when normalized by the amount of total RNA in the RT reaction than when normalized by any particular "housekeeping" gene. Primers are listed in Table 1. The primers for ubiquitin C mRNA target both the reference sequence (~2.6 kb, GenBank no. NM_019639) and a shorter variant (~1.2 kb, GenBank no. AK10964). In both variants, the mRNA has tandem repeats of the coding sequence. Thus the primers were chosen to amplify a segment within each repeat unit. Northern blots of polyubiquitin in murine muscle revealed expression of both the longer and the shorter versions, both of which were expressed at reduced levels in c-ski transgenic mice (1). The cathepsin B primers were chosen to span an intron so that genomic DNA could not interfere with the assay. In the ubiquitin C assay, there was no signal when RT-negative control samples were amplified in the presence of the internal standard, indicating that there was insufficient genomic DNA present in the RNA samples to influence the results.

Data analysis. Statistical significance for effects of myostatin deficiency and age (and interactions between them) was determined by analysis of variance (ANOVA). The ANOVA model also accounted for the effects of sex, but there were no sex differences in the effects of myostatin deficiency, and P levels for well-known sex differences (larger body weight and muscle mass in males) are not shown. Comparisons between Mstn{Delta}E3/{Delta}E3 mice and Mstn+/+ controls within each age cohort were made with t-tests. Means ± SE are presented.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Body and muscle mass. Although some of the Mstn{Delta}E3/{Delta}E3 mice were very small at weaning (3 wk of age), at 5–6 wk of age the mean body weight of Mstn{Delta}E3/{Delta}E3 mice was normal (18.9 ± 0.8 vs. 18.8 ± 0.5 g for Mstn+/+ mice), and their wet muscle weights were greater than normal (P < 0.03; Fig. 3). At 6 mo of age, the Mstn{Delta}E3/{Delta}E3 mice were heavier than normal (35.7 ± 0.8 vs. 29.8 ± 1.6 g for Mstn+/+ mice, P < 0.01), and they had the expected double muscling (P < 0.001; Fig. 3). There was no effect of age or myostatin deficiency on the amount of urea/SDS-soluble protein per milligram of muscle tissue (average of ~0.13 mg in all genotype/age groups, P > 0.10) or on the amount of actin and myosin heavy chain per milligram of total protein (Fig. 4).


Figure 3
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3. Mean muscle mass in Mstn{Delta}E3/{Delta}E3 (hatched bars) and control (Mstn+/+; open bars) mice at 5–6 wk and 6 mo of age. Error bar is 1 SE. Effects of age and genotype were significant (P < 0.001) by ANOVA for both muscles.

 

Figure 4
View larger version (99K):
[in this window]
[in a new window]
 
Fig. 4. Representative Coomassie-stained polyacryamide gel. The gel was loaded with equal amounts of total urea/SDS-soluble proteins from muscles of Mstn{Delta}E3/{Delta}E3 and Mstn+/+ mice. Quantitative densitometry of these and other samples (n = 3 Mstn+/+ and 4 Mstn{Delta}E3/{Delta}E3) indicated no significant difference (P > 0.35) for either myosin heavy chain (MyHC) or actin bands. The same pattern was observed in samples from young and mature mice.

 
Myofibrillar protein synthesis. At 6 mo of age, the average fractional rate of synthesis was less than it was at 5–6 wk both in Mstn+/+ and Mstn{Delta}E3/{Delta}E3 mice (P < 0.001; Fig. 5). There was a significant age x genotype interaction according to ANOVA (P = 0.02), which was explained by the fact that the fractional rate of synthesis in young Mstn{Delta}E3/{Delta}E3 mice was 14% faster than normal (P = 0.06 by t-test), whereas in mature mice there was no effect of myostatin deficiency on fractional synthetic rate.


Figure 5
View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. Mean fractional (top) and total myofibrillar protein synthesis per gastrocnemius muscle (bottom) in Mstn{Delta}E3/{Delta}E3 (hatched bars) and Mstn+/+ mice (open bars). Error bar is 1 SE. Significant effects by ANOVA: fractional rate, age x genotype interaction, P = 0.02; synthesis per muscle, genotype, P < 0.001, age, P = 0.001.

 
The rate of myofibrillar protein synthesis per whole muscle was markedly elevated in myostatin-deficient mice relative to normal mice, both at 5–6 wk and at 6 mo of age (P < 0.001; Fig. 5). Protein synthesis per muscle was greater in younger mice (P = 0.001), even though their muscles were much smaller than those of mature mice.

RNA and DNA concentrations. RNA and DNA concentrations per milligram of tissue declined between 5 wk and 6 mo of age in both control and Mstn{Delta}E3/{Delta}E3 mice (P < 0.001; Table 2). RNA concentrations were not affected by myostatin deficiency (Table 2). The DNA concentration per milligram of tissue was lower in myostatin-deficient mice (P < 0.01), so that Mstn{Delta}E3/{Delta}E3 mice had an average RNA/DNA ratio that was 30% greater than normal (P = 0.01). Slot-blot analysis indicated that the amounts of 28S rRNA and total poly(A) RNA per nanogram of total RNA were similar in Mstn{Delta}E3/{Delta}E3 and Mstn+/+ mice (Table 2). Ubiquitin C mRNA levels were highest in the mature Mstn{Delta}E3/{Delta}E mice (P = 0.03 for age x genotype interaction; Fig. 6). There was no effect of myostatin deficiency on cathepsin B mRNA expression (Fig. 6).


View this table:
[in this window]
[in a new window]
 
Table 2. Concentrations of DNA and RNA in skeletal muscle

 

Figure 6
View larger version (35K):
[in this window]
[in a new window]
 
Fig. 6. Mean ubiquitin C (UbC; top) and cathepsin B (Cath B; bottom) mRNA expression in Mstn{Delta}E3/{Delta}E3 (hatched bars) and Mstn+/+ (open bars) mice. Error bar is 1 SE. Values, in arbitrary units, are based on the ratio of mRNA amplicon to internal standard (Std) amplicon (representative results shown at right). Significant effects by ANOVA for UbC: age, P < 0.001; age x genotype interaction, P = 0.03.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have replicated the finding (8) that constitutive myostatin deficiency leads to marked muscle hypertrophy in mice. The Mstn{Delta}E3/{Delta}E3 mice generated in the present study lack the entire third exon and several hundred bases of flanking DNA, whereas the Mstn–/– mice generated by McPherron et al. (8) lack only the protein-coding region of exon 3, which was replaced by the neoR gene. There is no neoR gene in the Mstn{Delta}E3/{Delta}E3 mice. As expected, these minor differences in the configurations of the mutant myostatin genes appear to be functionally irrelevant.

The fractional rate of myofibrillar synthesis was modestly increased by myostatin deficiency in young mice and was normal in mature mice. However, the rate of myofibrillar synthesis per muscle was markedly greater in both young and mature myostatin-deficient mice. The synthesis rate per whole muscle is more important than the fractional rate of synthesis in terms of the metabolic costs of protein synthesis (energy and amino acids) and in terms of determining the size of the muscle. The increase in protein synthesis per whole muscle does not seem to be explained simply by hypercellularity, since the increase in DNA content per muscle is ~50% (present study and Ref. 8), whereas the increase in protein synthesis per muscle is ~85%. Thus synthesis per myonucleus is increased in myostatin-deficient mice.

The muscle hypertrophy associated with overexpression of c-ski in mice is associated with prolonged muscle protein half-life and reduced expression of mRNAs encoding ubiquitin and cathepsin B (1), suggesting reduced activity in muscle of both proteasomal and lysosomal pathways of protein degradation. Because c-ski interferes with Smad signaling, which is activated by myostatin (6), we determined whether myostatin deficiency affects expression of these mRNAs. No decrease in expression of ubiquitin and cathepsin B mRNAs was observed in myostatin-deficient mice. Thus an effect of c-ski overexpression other than interference with Smad signaling may be responsible for the reduced expression of these mRNAs.

Although we did not directly determine protein half-life, there is indirect evidence that it is not significantly affected by myostatin deficiency. First, myostatin does not affect the protein half-life of cultured myotubes (16). Second, if we assume that protein synthesis and breakdown are in equilibrium at 6 mo, protein half-life can be calculated with the formula T1/2 = P/(1.44·S), where P is protein mass (mg/muscle) and S is protein synthesis (mg·day–1·muscle–1) (17). According to this formula, T1/2 was 20.6 ± 0.7 days in mature Mstn+/+ mice and 21.7 ± 1.4 days in mature Mstn{Delta}E3/{Delta}E3 mice (P = 0.52). Finally, a model based on the observed rates of protein synthesis and muscle weights indicated that the excessive muscle growth between 5 and 26 wk of age in myostatin-deficient mice does not require a change in protein half-life (Fig. 7). The model employed the following assumptions: there is an exponential decline in the fractional rates of both protein synthesis and protein breakdown between 5 and 26 wk; at 26 wk of age, both Mstn{Delta}E3/{Delta}E3 and Mstn+/+ mice have fractional rates of protein synthesis that are close to the fractional rate of protein breakdown (i.e., negligible muscle growth after 26 wk); fractional rates of protein breakdown are identical in Mstn{Delta}E3/{Delta}E3 and Mstn+/+ mice; and muscle growth is directly proportional to the net balance of myofibrillar proteins. With this model, an initial fractional rate of myofibrillar protein breakdown of 6.6% per day is consistent with the observed muscle growth in normal mice. With the same rate of protein breakdown in myostatin-deficient mice, the observed difference in the initial rate of protein synthesis can completely explain the excessive muscle growth. Of course, other models that involve prolonged protein half-life could also predict the muscle growth rates. The main point of the model is that prolonged protein half-life is not necessary to explain the data.


Figure 7
View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7. Model predicting gastrocnemius muscle mass from myofibrillar protein synthesis rates, with assumption that genotype has no effect on rate of protein breakdown. Initial and final protein synthesis (top) was directly measured. Exponential decline between these time points predicted observed muscle mass changes better than linear decline. Actual muscle mass shown as circles or triangles in bottom, average of 3 mice for each circle/triangle at initial and final times and individual mice at 90 days of age (mice examined at 90 days did not have tracer injections for determination of protein metabolism; no female Mstn{Delta}E3/{Delta}E3 mice available at 90 days). All lines represent average of male and female mice. Fractional rate of protein synthesis was not different in male and female mice.

 
The double muscling of myostatin-deficient mice is the result of both muscle fiber hyperplasia and fiber hypertrophy (8). The reduced concentration of DNA in myostatin-deficient muscle suggests that the muscle fiber hypertrophy is not simply a case of more myoblasts fusing to form each fiber during development or of additional myoblasts fusing with existing fibers to drive RNA production and protein synthesis to higher levels. Normal concentrations of RNA and mRNA are maintained in myostatin-deficient muscle even though the amount of DNA per milligram of tissue is reduced. Either there is an increase in the average transcriptional activity of the nuclei or there is an increase in the average half-life of RNA molecules. The mechanisms whereby myostatin deficiency could influence these processes are unclear.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Health grants (AG-19853, RR-16286, and DE-12634) and by institutional funds.


    ACKNOWLEDGMENTS
 
We thank Bharati Shah, Sangeeta Mehta, Carolyn A. Cassar, Catherine L. Donegan, and Robert L. Howell for expert technical assistance, and Drs. S.-J. Lee, L. Gan, and A. Bradley for donating materials.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. Welle, Dept. of Medicine, Univ. of Rochester Medical Center, Rochester, NY 14642 (e-mail: stephen_welle{at}urmc.rochester.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Costelli P, Carbo N, Busquets S, Lopez-Soriano FJ, Baccino FM, and Argiles JM. Reduced protein degradation rates and low expression of proteolytic systems support skeletal muscle hypertrophy in transgenic mice overexpressing the c-ski oncogene. Cancer Lett 200: 153–160, 2003.[Medline]
  2. Garlick PJ, McNurlan MA, and Preedy VR. A rapid and convenient technique for measuring the rate of protein synthesis in tissues by injection of [3H]phenylalanine. Biochem J 192: 719–723, 1980.[Web of Science][Medline]
  3. Giles KW and Myers A. An improved diphenylamine method for the estimation of deoxyribonucleic acid. 206: 93, 1965.
  4. Holzenberger M, Lenzner C, Leneuve P, Zaoui R, Hamard G, Vaulont S, and Bouc YL. Cre-mediated germline mosaicism: a method allowing rapid generation of several alleles of a target gene. Nucleic Acids Res 28: E92, 2000.[CrossRef][Medline]
  5. Jepson MM, Pell JM, Bates PC, and Millward DJ. The effects of endotoxaemia on protein metabolism in skeletal muscle and liver of fed and fasted rats. Biochem J 235: 329–336, 1986.[Web of Science][Medline]
  6. Lee SJ. Regulation of muscle mass by myostatin. Annu Rev Cell Dev Biol 20: 61–86, 2004.[CrossRef][Web of Science][Medline]
  7. MacLennan PA and Edwards RH. Protein turnover is elevated in muscle of mdx mice in vivo. Biochem J 268: 795–797, 1990.[Web of Science][Medline]
  8. McPherron AC, Lawler AM, and Lee SJ. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387: 83–90, 1997.[CrossRef][Medline]
  9. McPherron AC and Lee SJ. Suppression of body fat accumulation in myostatin-deficient mice. J Clin Invest 109: 595–601, 2002.[CrossRef][Web of Science][Medline]
  10. McPherron AC and Lee SJ. Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci USA 94: 12457–12461, 1997.[Abstract/Free Full Text]
  11. Nagy A, Gertsenstein M, Vintersten K, and Behringer R. Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 2003.
  12. Pinkert CA. Transgenic Animal Technology: A Laboratory Handbook. San Diego, CA: Academic, 2002.
  13. Schuelke M, Wagner KR, Stolz LE, Hubner C, Riebel T, Komen W, Braun T, Tobin JF, and Lee SJ. Myostatin mutation associated with gross muscle hypertrophy in a child. N Engl J Med 350: 2682–2688, 2004.[Free Full Text]
  14. Schwenk WF, Berg PJ, Beaufrere B, Miles JM, and Haymond MW. Use of t-butyldimethylsilylation in the gas chromatographic/mass spectrometric analysis of physiologic compounds found in plasma using electron-impact ionization. Anal Biochem 141: 101–109, 1984.[CrossRef][Web of Science][Medline]
  15. Sutrave P, Kelly AM, and Hughes SH. ski can cause selective growth of skeletal muscle in transgenic mice. Genes Dev 4: 1462–1472, 1990.[Abstract/Free Full Text]
  16. Taylor WE, Bhasin S, Artaza J, Byhower F, Azam M, Willard DH Jr, Kull FC Jr, and Gonzalez-Cadavid N. Myostatin inhibits cell proliferation and protein synthesis in C2C12 muscle cells. Am J Physiol Endocrinol Metab 280: E221–E228, 2001.[Abstract/Free Full Text]
  17. Welle S. Human Protein Metabolism. New York: Springer-Verlag, 1999.
  18. Welle S, Bhatt K, and Thornton C. Polyadenylated RNA, actin mRNA, and myosin heavy chain mRNA in young and old human skeletal muscle. Am J Physiol Endocrinol Metab 270: E224–E229, 1996.[Abstract/Free Full Text]
  19. Welle S, Bhatt K, and Thornton CA. High-abundance mRNAs in human muscle: comparison between young and old. J Appl Physiol 89: 297–304, 2000.[Abstract/Free Full Text]
  20. Welle S and Nair KS. Relationship of resting metabolic rate to body composition and protein turnover. Am J Physiol Endocrinol Metab 258: E990–E998, 1990.[Abstract/Free Full Text]
  21. Welle S, Thornton C, Jozefowicz R, and Statt M. Myofibrillar protein synthesis in young and old men. Am J Physiol Endocrinol Metab 264: E693–E698, 1993.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
M. R. Morissette, S. A. Cook, C. Buranasombati, M. A. Rosenberg, and A. Rosenzweig
Myostatin inhibits IGF-I-induced myotube hypertrophy through Akt
Am J Physiol Cell Physiol, November 1, 2009; 297(5): 1124 - 1132.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Welle, K. Burgess, C. A. Thornton, and R. Tawil
Relation between extent of myostatin depletion and muscle growth in mature mice
Am J Physiol Endocrinol Metab, October 1, 2009; 297(4): E935 - E940.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. Welle, A. Cardillo, M. Zanche, and R. Tawil
Skeletal muscle gene expression after myostatin knockout in mature mice
Physiol Genomics, August 7, 2009; 38(3): 342 - 350.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Gilson, O. Schakman, S. Kalista, P. Lause, K. Tsuchida, and J.-P. Thissen
Follistatin induces muscle hypertrophy through satellite cell proliferation and inhibition of both myostatin and activin
Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E157 - E164.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. L. Welle
Myostatin and muscle fiber size. Focus on "Smad2 and 3 transcription factors control muscle mass in adulthood" and "Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and myotube size"
Am J Physiol Cell Physiol, June 1, 2009; 296(6): C1245 - C1247.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Amthor, A. Otto, A. Vulin, A. Rochat, J. Dumonceaux, L. Garcia, E. Mouisel, C. Hourde, R. Macharia, M. Friedrichs, et al.
Muscle hypertrophy driven by myostatin blockade does not require stem/precursor-cell activity
PNAS, May 5, 2009; 106(18): 7479 - 7484.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. P. Harber, J. D. Crane, J. M. Dickinson, B. Jemiolo, U. Raue, T. A. Trappe, and S. W. Trappe
Protein synthesis and the expression of growth-related genes are altered by running in human vastus lateralis and soleus muscles
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R708 - R714.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Welle, K. Burgess, and S. Mehta
Stimulation of skeletal muscle myofibrillar protein synthesis, p70 S6 kinase phosphorylation, and ribosomal protein S6 phosphorylation by inhibition of myostatin in mature mice
Am J Physiol Endocrinol Metab, March 1, 2009; 296(3): E567 - E572.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
O Schakman, H Gilson, and J P Thissen
Mechanisms of glucocorticoid-induced myopathy
J. Endocrinol., April 1, 2008; 197(1): 1 - 10.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. M. W. Petersen, F. Magkos, P. Atherton, A. Selby, K. Smith, M. J. Rennie, B. K. Pedersen, and B. Mittendorfer
Smoking impairs muscle protein synthesis and increases the expression of myostatin and MAFbx in muscle
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E843 - E848.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Welle, K. Bhatt, C. A. Pinkert, R. Tawil, and C. A. Thornton
Muscle growth after postdevelopmental myostatin gene knockout
Am J Physiol Endocrinol Metab, April 1, 2007; 292(4): E985 - E991.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/3/E409    most recent
00433.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welle, S.
Right arrow Articles by Pinkert, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welle, S.
Right arrow Articles by Pinkert, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.