|
|
||||||||
Departments of 1Medicine and 2Pathology and Laboratory Medicine in the Center for Aging and Developmental Biology, University of Rochester, Rochester, New York
Submitted 9 September 2005 ; accepted in final form 3 October 2005
| ABSTRACT |
|---|
|
|
|---|
E3/
E3) or normal myostatin expression (Mstn+/+) by measuring tracer incorporation after a systemic flooding dose of L-[ring-2H5]phenylalanine. At 56 wk of age, Mstn
E3/
E3 mice had increased muscle mass (40%), fractional rates of myofibrillar synthesis (14%), and protein synthesis per whole muscle (60%) relative to Mstn+/+ mice. With maturation, fractional rates of synthesis declined >50% in parallel with decreased DNA and RNA [total, 28S rRNA, and poly(A) RNA] concentrations in muscle. At 6 mo of age, Mstn
E3/
E3 mice had even greater increases in muscle mass (90%) and myofibrillar synthesis per muscle (85%) relative to Mstn+/+ mice, but the fractional rate of synthesis was normal. Estimated myofibrillar protein half-life was not affected by myostatin deficiency. Muscle DNA concentrations were reduced in both young and mature Mstn
E3/
E3 mice, whereas RNA concentrations were normal, so the ratio of RNA to DNA was
30% greater than normal in Mstn
E3/
E3 mice. Thus the increased protein synthesis and RNA content per muscle in myostatin-deficient mice cannot be explained entirely by an increased number of myonuclei. muscle growth; ribonucleic acid; deoxyribonucleic acid; ubiquitin; cathepsin B
FAMILY MEMBER that is a key regulator of muscle mass. In mice, constitutive knockout of the segment of the myostatin gene that encodes the active part of the myostatin peptide results in double muscling caused by both muscle fiber enlargement and an increased number of muscle fibers (8). Naturally occurring mutations of the myostatin gene cause increased muscle mass in cattle (10) and humans (13). For muscle protein mass to increase during normal growth, the rate of protein synthesis must exceed the rate of protein breakdown. Net protein balance must be even more positive with myostatin deficiency. After muscles have stopped growing, there is an equilibrium between muscle protein synthesis and protein breakdown. At equilibrium, the protein mass of a muscle fiber or a whole muscle depends on both the rate of protein synthesis and the protein half-life. Protein turnover is important even after growth has ceased, because it is required for replacement of protein molecules that have been damaged by reactive radicals in the cells. Protein synthesis requires considerable energy (20), and the energy required to maintain even a normal rate of protein synthesis in the enormous muscles of myostatin-deficient mice could be a major component of their elevated metabolic rate (9).
The only reported study of the effect of myostatin on protein metabolism was done in vitro with C2C12 myoblasts and myotubes derived from these cells (16). Addition of myostatin to the culture medium, at 6 µg/ml, inhibited the rate of protein synthesis by >50% without affecting the rate of protein breakdown. These data do not prove that myostatin has an important role in regulating muscle protein synthesis in vivo, because muscle fibers might respond to myostatin differently than C2C12 myotubes and because the concentration of active myostatin in muscle in vivo could be less than the concentration required to inhibit protein synthesis. We therefore examined the rates of myofibrillar protein synthesis in vivo in normal mice and in mice with constitutive myostatin deficiency. We examined myofibrillar rather than total tissue protein synthesis because myofibrils occupy the majority of the volume of muscle fibers. Limiting the analysis to myofibrillar proteins excluded the possibility that results would be influenced by turnover of proteins produced by mononuclear cells, such as satellite cells and vascular endothelial cells, which comprise a very small fraction of the muscle volume.
Myostatin signaling involves activation, via phosphorylation, of the transcription regulators Smad2 and Smad3 (6). Smad signaling is inhibited by the nuclear protein c-ski (6). Overexpression of c-ski causes muscle hypertrophy (1, 15), and it is possible that interference with myostatin signaling explains this hypertrophy. The rate of incorporation of [14C]phenylalanine (per mg protein) into skeletal muscle proteins is normal in mice overexpressing c-ski, whereas a greater retention of [3H]phenylalanine in muscle proteins 48 h after [3H]phenylalanine injection in c-ski mice suggests a reduced rate of protein degradation (1). An inhibitory effect of c-ski overexpression on proteolysis is further supported by the observation that muscles of these mice have only one-half the normal concentration of mRNAs encoding ubiquitin and cathepsin B. If these effects of c-ski overexpression are explained by inhibition of the myostatin signaling pathway, then myostatin-deficient mice should also have reduced expression of these mRNAs. We therefore examined levels of mRNAs encoding ubiquitin and cathepsin B.
| METHODS |
|---|
|
|
|---|
E3/+). Mstn
E3/+ mice were mated with C57BL/6J mice, and then their Mstn
E3/+ offspring were mated with one another to generate Mstn
E3/
E3 mice and Mstn+/+ controls.
|
|
E3/
E3 mice and 12 Mstn+/+ controls were examined in the present study. Six mice of each genotype were examined at 56 wk of age and the others at 6 mo of age. There were equal numbers of male and female mice in each group. All mice were given ad libitum access to food and water. They were maintained in MicroVENT cages (Allentown Caging, Allentown, NJ) in a specified pathogen-free room on a 12:12-h light-dark cycle (lights on at 0600). All mice were maintained in a specific pathogen-free barrier facility and were anesthetized by Avertin (2,2,2-tribromoethanol) injection during any potentially painful procedure. Mice were monitored carefully after anesthesia until full recovery. Mice were euthanatized by CO2 inhalation or Avertin sedation, followed by cervical dislocation. All procedures followed the American Veterinary Medicine Association guide per institutional guidelines. All animal procedures and experiments were performed according to protocols approved by an Institutional Animal Use and Care Committee (UCAR) and the U.S. Office of Laboratory Animal Welfare (Univ. of Rochester Medical Center assurance A3292-01) in an Association for Assessment and Accreditation of Laboratory Animal Care-accredited vivarium facility.
Incorporation of L-[ring-2H5]phenylalanine (2H5-Phe) into myofibrillar proteins. The Phe flooding method (2) was used to determine the rate of myofibrillar protein synthesis. Previously, radiolabeled Phe has been used to examine muscle protein synthesis in rodents, but we used a stable-isotope tracer to avoid the problems and costs associated with handling radioactive carcasses and tissues. Moreover, because the mass spectrometer directly determines the ratio of tracer to tracee, the use of a stable isotope tracer improves precision. 2H5-Phe was obtained from Cambridge Isotope Laboratories (Andover, MA). The 150 mM 2H5-Phe-75 mM NaCl solution was injected intraperitoneally at a dose of 2 ml/100 g body wt. Thirty minutes after tracer injection, mice were killed by CO2 inhalation and cervical dislocation, and then gastrocnemius and quadriceps muscles were removed, weighed, and frozen in liquid nitrogen. All tracer injections were performed between 0900 and 1030.
When this amount of radiolabeled Phe is given intraperitoneally to young rats, there is a rapid rise (
3 min) to peak specific activity of free Phe in muscle, which is maintained until
15 min after tracer injection (5). This dose of radiolabeled Phe also has been administered intraperitoneally to study muscle protein synthesis in mice (7), but the time course of the specific activity of free Phe in muscle was not examined. We therefore determined the time course of free 2H5-Phe enrichment in gastrocnemius muscles at several time points from 0.5 to 30 min after intraperitoneal tracer injection. As illustrated in Fig. 2, 2H5-Phe enrichment rose very rapidly, reaching peak values of
8085% within
5 min. Peak enrichment was sustained until 1520 min after tracer administration, and declined only slightly between 20 and 30 min after the injection. The free 2H5-Phe enrichment at 30 min approximated the mean enrichment from 0 to 30 min (area under curve divided by time). Thus the enrichment of free 2H5-Phe at 30 min after tracer injection is an appropriate index of the ratio of labeled to unlabeled Phe incorporated into myofibrillar proteins.
|
1,000-fold less than the 234 signal; therefore, the column was overloaded (i.e., the 234 signal saturated the detector) to generate strong 239 signals. Thus for the protein hydrolysates we evaluated the 239/237 ratios. When we used amounts that did not overload the column, the 237/234 ratio was 0.84%, so the 2H5-Phe enrichment was calculated as the 239/237 ratio x 0.84% 0.014% (0.014% is the "enrichment" observed in muscle without 2H5-Phe administration, due to naturally occurring heavy atoms). The fraction of newly synthesized proteins was calculated as (2H5-Phe enrichment in protein hydrolysate) ÷ (2H5-Phe enrichment of free amino acid pool). Neither the total protein concentration per milligram of tissue nor the amount of actin and myosin per milligram of total protein was affected by myostatin deficiency (see RESULTS). Thus the fractional rate of synthesis was multiplied by 12% of the wet weight of the muscle (21) to compute the absolute rate of myofibrillar synthesis per whole muscle in both normal and myostatin-deficient mice.
Determination of protein, DNA, RNA, and mRNA concentrations in muscle.
A piece of the quadriceps muscle (
50 mg) was digested overnight at 55°C with proteinase K (0.3 mg/ml in 200 µl of buffer with 10 mM Tris·HCl, pH 9, 50 mM KCl, 0.1% Triton X-100), and then the DNA concentration of the digest was determined with a colorimetric procedure (3). Another piece of
50 mg was cut into smaller fragments (
10 mg) that were placed in 6 M urea with 1% SDS to dissolve proteins (55°C for 3 h). Protein concentrations were determined with a colorimetric assay (Bio-Rad Protein Assay Kit). Representative protein samples were examined with PAGE to ensure that the concentrations of the major myofibrillar proteins myosin heavy chain and actin were normal in myostatin-deficient muscle. Another piece of 50100 mg was homogenized in Tri Reagent for extraction of total RNA, as suggested by the manufacturer (Molecular Research Center, Cincinnati, OH). RNA concentrations in the final extracts (1 µl/mg tissue) were determined with a GeneQuant UV absorbance analyzer (Amersham Biosciences).
Total mRNA (polyadenylated RNA) and 28S rRNA levels were determined by a modification of a slot-blot method (18). Oligonucleotide probes were labeled with fluorescent dyes rather than 32P. The 23-mer oligo(dT) probe was labeled with IRDye 700, and the 28S rRNA probe (aacgatgagagtagtggtatttc) was labeled with IRDye 800 (Li-Cor Biosciences, Lincoln, NE). Each slot was loaded with 100 ng of total RNA, and the membrane was placed in hybridization solution with 5 nM oligo(dT) probe and 3 nM 28S rRNA probe. Hybridization and washes were done at 37°C rather than room temperature. The membrane was scanned for fluorescence of the IRDyes by use of an Odyssey Imaging System (Li-Cor).
Expression of ubiquitin C and cathepsin B mRNAs was determined by RT-PCR with competitive internal standards. The principle and general method have been described elsewhere (19). All RNA samples were reverse transcribed on the same day with the same RT reaction mixture. Under these conditions, expression levels of specific mRNAs are less variable when normalized by the amount of total RNA in the RT reaction than when normalized by any particular "housekeeping" gene. Primers are listed in Table 1. The primers for ubiquitin C mRNA target both the reference sequence (
2.6 kb, GenBank no. NM_019639) and a shorter variant (
1.2 kb, GenBank no. AK10964). In both variants, the mRNA has tandem repeats of the coding sequence. Thus the primers were chosen to amplify a segment within each repeat unit. Northern blots of polyubiquitin in murine muscle revealed expression of both the longer and the shorter versions, both of which were expressed at reduced levels in c-ski transgenic mice (1). The cathepsin B primers were chosen to span an intron so that genomic DNA could not interfere with the assay. In the ubiquitin C assay, there was no signal when RT-negative control samples were amplified in the presence of the internal standard, indicating that there was insufficient genomic DNA present in the RNA samples to influence the results.
Data analysis.
Statistical significance for effects of myostatin deficiency and age (and interactions between them) was determined by analysis of variance (ANOVA). The ANOVA model also accounted for the effects of sex, but there were no sex differences in the effects of myostatin deficiency, and P levels for well-known sex differences (larger body weight and muscle mass in males) are not shown. Comparisons between Mstn
E3/
E3 mice and Mstn+/+ controls within each age cohort were made with t-tests. Means ± SE are presented.
| RESULTS |
|---|
|
|
|---|
E3/
E3 mice were very small at weaning (3 wk of age), at 56 wk of age the mean body weight of Mstn
E3/
E3 mice was normal (18.9 ± 0.8 vs. 18.8 ± 0.5 g for Mstn+/+ mice), and their wet muscle weights were greater than normal (P < 0.03; Fig. 3). At 6 mo of age, the Mstn
E3/
E3 mice were heavier than normal (35.7 ± 0.8 vs. 29.8 ± 1.6 g for Mstn+/+ mice, P < 0.01), and they had the expected double muscling (P < 0.001; Fig. 3). There was no effect of age or myostatin deficiency on the amount of urea/SDS-soluble protein per milligram of muscle tissue (average of
0.13 mg in all genotype/age groups, P > 0.10) or on the amount of actin and myosin heavy chain per milligram of total protein (Fig. 4).
|
|
E3/
E3 mice (P < 0.001; Fig. 5). There was a significant age x genotype interaction according to ANOVA (P = 0.02), which was explained by the fact that the fractional rate of synthesis in young Mstn
E3/
E3 mice was 14% faster than normal (P = 0.06 by t-test), whereas in mature mice there was no effect of myostatin deficiency on fractional synthetic rate.
|
RNA and DNA concentrations.
RNA and DNA concentrations per milligram of tissue declined between 5 wk and 6 mo of age in both control and Mstn
E3/
E3 mice (P < 0.001; Table 2). RNA concentrations were not affected by myostatin deficiency (Table 2). The DNA concentration per milligram of tissue was lower in myostatin-deficient mice (P < 0.01), so that Mstn
E3/
E3 mice had an average RNA/DNA ratio that was 30% greater than normal (P = 0.01). Slot-blot analysis indicated that the amounts of 28S rRNA and total poly(A) RNA per nanogram of total RNA were similar in Mstn
E3/
E3 and Mstn+/+ mice (Table 2). Ubiquitin C mRNA levels were highest in the mature Mstn
E3/
E mice (P = 0.03 for age x genotype interaction; Fig. 6). There was no effect of myostatin deficiency on cathepsin B mRNA expression (Fig. 6).
|
|
| DISCUSSION |
|---|
|
|
|---|
E3/
E3 mice generated in the present study lack the entire third exon and several hundred bases of flanking DNA, whereas the Mstn/ mice generated by McPherron et al. (8) lack only the protein-coding region of exon 3, which was replaced by the neoR gene. There is no neoR gene in the Mstn
E3/
E3 mice. As expected, these minor differences in the configurations of the mutant myostatin genes appear to be functionally irrelevant.
The fractional rate of myofibrillar synthesis was modestly increased by myostatin deficiency in young mice and was normal in mature mice. However, the rate of myofibrillar synthesis per muscle was markedly greater in both young and mature myostatin-deficient mice. The synthesis rate per whole muscle is more important than the fractional rate of synthesis in terms of the metabolic costs of protein synthesis (energy and amino acids) and in terms of determining the size of the muscle. The increase in protein synthesis per whole muscle does not seem to be explained simply by hypercellularity, since the increase in DNA content per muscle is
50% (present study and Ref. 8), whereas the increase in protein synthesis per muscle is
85%. Thus synthesis per myonucleus is increased in myostatin-deficient mice.
The muscle hypertrophy associated with overexpression of c-ski in mice is associated with prolonged muscle protein half-life and reduced expression of mRNAs encoding ubiquitin and cathepsin B (1), suggesting reduced activity in muscle of both proteasomal and lysosomal pathways of protein degradation. Because c-ski interferes with Smad signaling, which is activated by myostatin (6), we determined whether myostatin deficiency affects expression of these mRNAs. No decrease in expression of ubiquitin and cathepsin B mRNAs was observed in myostatin-deficient mice. Thus an effect of c-ski overexpression other than interference with Smad signaling may be responsible for the reduced expression of these mRNAs.
Although we did not directly determine protein half-life, there is indirect evidence that it is not significantly affected by myostatin deficiency. First, myostatin does not affect the protein half-life of cultured myotubes (16). Second, if we assume that protein synthesis and breakdown are in equilibrium at 6 mo, protein half-life can be calculated with the formula T1/2 = P/(1.44·S), where P is protein mass (mg/muscle) and S is protein synthesis (mg·day1·muscle1) (17). According to this formula, T1/2 was 20.6 ± 0.7 days in mature Mstn+/+ mice and 21.7 ± 1.4 days in mature Mstn
E3/
E3 mice (P = 0.52). Finally, a model based on the observed rates of protein synthesis and muscle weights indicated that the excessive muscle growth between 5 and 26 wk of age in myostatin-deficient mice does not require a change in protein half-life (Fig. 7). The model employed the following assumptions: there is an exponential decline in the fractional rates of both protein synthesis and protein breakdown between 5 and 26 wk; at 26 wk of age, both Mstn
E3/
E3 and Mstn+/+ mice have fractional rates of protein synthesis that are close to the fractional rate of protein breakdown (i.e., negligible muscle growth after 26 wk); fractional rates of protein breakdown are identical in Mstn
E3/
E3 and Mstn+/+ mice; and muscle growth is directly proportional to the net balance of myofibrillar proteins. With this model, an initial fractional rate of myofibrillar protein breakdown of 6.6% per day is consistent with the observed muscle growth in normal mice. With the same rate of protein breakdown in myostatin-deficient mice, the observed difference in the initial rate of protein synthesis can completely explain the excessive muscle growth. Of course, other models that involve prolonged protein half-life could also predict the muscle growth rates. The main point of the model is that prolonged protein half-life is not necessary to explain the data.
|
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
superfamily member. Nature 387: 8390, 1997.[CrossRef][Medline]This article has been cited by other articles:
![]() |
M. R. Morissette, S. A. Cook, C. Buranasombati, M. A. Rosenberg, and A. Rosenzweig Myostatin inhibits IGF-I-induced myotube hypertrophy through Akt Am J Physiol Cell Physiol, November 1, 2009; 297(5): 1124 - 1132. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Welle, K. Burgess, C. A. Thornton, and R. Tawil Relation between extent of myostatin depletion and muscle growth in mature mice Am J Physiol Endocrinol Metab, October 1, 2009; 297(4): E935 - E940. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Welle, A. Cardillo, M. Zanche, and R. Tawil Skeletal muscle gene expression after myostatin knockout in mature mice Physiol Genomics, August 7, 2009; 38(3): 342 - 350. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Gilson, O. Schakman, S. Kalista, P. Lause, K. Tsuchida, and J.-P. Thissen Follistatin induces muscle hypertrophy through satellite cell proliferation and inhibition of both myostatin and activin Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E157 - E164. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Welle Myostatin and muscle fiber size. Focus on "Smad2 and 3 transcription factors control muscle mass in adulthood" and "Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and myotube size" Am J Physiol Cell Physiol, June 1, 2009; 296(6): C1245 - C1247. [Full Text] [PDF] |
||||
![]() |
H. Amthor, A. Otto, A. Vulin, A. Rochat, J. Dumonceaux, L. Garcia, E. Mouisel, C. Hourde, R. Macharia, M. Friedrichs, et al. Muscle hypertrophy driven by myostatin blockade does not require stem/precursor-cell activity PNAS, May 5, 2009; 106(18): 7479 - 7484. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Harber, J. D. Crane, J. M. Dickinson, B. Jemiolo, U. Raue, T. A. Trappe, and S. W. Trappe Protein synthesis and the expression of growth-related genes are altered by running in human vastus lateralis and soleus muscles Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R708 - R714. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Welle, K. Burgess, and S. Mehta Stimulation of skeletal muscle myofibrillar protein synthesis, p70 S6 kinase phosphorylation, and ribosomal protein S6 phosphorylation by inhibition of myostatin in mature mice Am J Physiol Endocrinol Metab, March 1, 2009; 296(3): E567 - E572. [Abstract] [Full Text] [PDF] |
||||
![]() |
O Schakman, H Gilson, and J P Thissen Mechanisms of glucocorticoid-induced myopathy J. Endocrinol., April 1, 2008; 197(1): 1 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. W. Petersen, F. Magkos, P. Atherton, A. Selby, K. Smith, M. J. Rennie, B. K. Pedersen, and B. Mittendorfer Smoking impairs muscle protein synthesis and increases the expression of myostatin and MAFbx in muscle Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E843 - E848. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Welle, K. Bhatt, C. A. Pinkert, R. Tawil, and C. A. Thornton Muscle growth after postdevelopmental myostatin gene knockout Am J Physiol Endocrinol Metab, April 1, 2007; 292(4): E985 - E991. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |