AJP - Endo Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 290: E282-E288, 2006. First published September 20, 2005; doi:10.1152/ajpendo.00328.2005
0193-1849/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/E282    most recent
00328.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kossintseva, I.
Right arrow Articles by Mitchell, B. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kossintseva, I.
Right arrow Articles by Mitchell, B. F.

Proinflammatory cytokines inhibit human placental 11{beta}-hydroxysteroid dehydrogenase type 2 activity through Ca2+ and cAMP pathways

Iren Kossintseva,1 Susan Wong,1 Ed Johnstone,2 Larry Guilbert,2 David M. Olson,1 and B. F. Mitchell1

Departments of 1Obstetrics and Gynecology and 2Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada

Submitted 21 July 2005 ; accepted in final form 15 September 2005


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Excessive fetal exposure to glucocorticoids has been implicated in the etiology of adult metabolic and cardiovascular disease. Placental 11{beta}-hydroxysteroid dehydrogenase type 2 (11{beta}-HSD2) may protect the fetus from excessive glucocorticoid exposure. Maternal stress may be accompanied by elevated levels of cortisol and increased proinflammatory cytokines [interleukin (IL)-1{beta}, IL-6, and tumor necrosis factor-{alpha} (TNF-{alpha})]. We hypothesize that proinflammatory cytokines inhibit human placental 11{beta}-HSD activity. We incubated explant cultures of term human placental villi in the presence or absence of 10 ng/ml IL-1{beta}, IL-6, or TNF-{alpha}, with or without agonists or antagonists of intracellular Ca2+ and adenylyl cyclase. Activity for 11{beta}-HSD2 was estimated using a radioisotope assay, and mRNA was measured using quantitative RT-PCR. All cytokines significantly (P ≤ 0.05) reduced 11{beta}-HSD2 activity (>75% suppression); maximal inhibition occurred within 2 h and was maintained for at least 24 h. The IL-1{beta}-induced inhibitory activity was attenuated using a Ca2+ channel blocker (nifedipine), an intracellular Ca2+ antagonist [8-(N,N-diethylamino)octyl-3,4,5-trimethoxybenzoate], or the adenylyl cyclase stimulant forskolin. Conversely, 11{beta}-HSD2 activity was diminished in the presence of the Ca2+ ionophore A-23187 or the adenylyl cyclase inhibitor SQ-22536. mRNA levels for 11{beta}-HSD2 were not changed by any of the treatments. Proinflammatory cytokines inhibit human placental 11{beta}-HSD2 activity through a mechanism that involves increased intracellular Ca2+ and inhibition of adenylyl cyclase. This could result in excessive fetal exposure to maternal cortisol. This mechanism might mediate part of the increased risk of metabolic and cardiovascular disease in adult offspring.

interleukin-1{beta}; interleukin-6; tumor necrosis factor-{alpha}; cortisol; metabolic and vascular disease

INTERCONVERSION OF THE ACTIVE GLUCOCORTICOID cortisol and its inactive metabolite cortisone is catalyzed by 11{beta}-hydroxysteroid dehydrogenase (11{beta}-HSD). There are two isoforms of this enzyme as follows(1, 2): 11{beta}-HSD1, which has low affinity for cortisol, is widely distributed, operates bidirectionally, and requires NADP(H) as a cofactor, and 11{beta}-HSD2, which is a high-affinity, unidirectional oxidase and is NAD+ dependent. Human placental 11{beta}-HSD activity is almost entirely the result of the type 2 isozyme (49). Cortisol concentrations in pregnant women are approximately fourfold higher than fetal concentrations throughout gestation. This gradient is maintained largely by oxidation of cortisol by placental 11{beta}-HSD2. Recent studies have suggested that excessive glucocorticoid activity in the fetus may lead to several adverse consequences, including dysregulation of the fetal hypothalamic-pituitary-adrenal axis (33, 42), impairment of fetal growth (37), and a higher incidence of metabolic and cardiovascular disease in the adult (9, 46).

Maternal complications during pregnancy, such as infections, intrauterine growth restriction, and preeclampsia, often are accompanied by elevated levels of proinflammatory cytokines, including interleukin (IL)-1{beta}, IL-6, and tumor necrosis factor-{alpha} (TNF-{alpha}) (6, 21, 48). These complications often result in low-birth-weight babies, either from restricted fetal growth or early birth. Low birth weight also is associated with a higher incidence of metabolic and cardiovascular disease in the adult (5). Human placental 11{beta}-HSD mRNA is significantly reduced in pregnancies that give rise to growth-restricted babies (23, 34). The link between the increased incidence of adult disease and an adverse fetal environment has been suggested to be excessive fetal exposure to maternal cortisol (12, 28).

A recent report demonstrates that proinflammatory cytokines may inhibit the activity of 11{beta}-HSD2 in human chondrocytes (11). Furthermore, both mRNA and the enzyme activity level for 11{beta}-HSD2 can be increased by stimulation of the adenylyl cyclase (AC) pathway (16, 41). Conversely, increased intracellular Ca2+ inhibits human placental 11{beta}-HSD2 activity (19). We hypothesized that increases in proinflammatory cytokines would decrease activity of human placental 11{beta}-HSD2 through mechanisms involving these pathways. This would lead to increased fetal exposure to the elevated maternal cortisol concentrations that occur in maternal conditions associated with low birth weight. The increased fetal glucocorticoid exposure may provide short-term benefit by increasing differentiation and maturation of organ systems such as the lung and liver (9). However, it may also play a role in the mechanism resulting in the observed increased incidence of adult disease. Interference with this mechanism could potentially modulate the long-term adverse consequences of this process. Our objectives in this study were to determine the effect of proinflammatory cytokines on human placental 11{beta}-HSD2 expression and activity and to investigate the roles of intracellular Ca2+ and AC in these effects.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Explant incubations and treatments. With approval of the Human Research Ethics Board of the University of Alberta, placentas were collected after spontaneous vaginal delivery or elective cesarean section at term from 20 women with uncomplicated pregnancies. Placental villous explants were performed as described previously (35). The placental tissue was kept in cold, sterile PBS until the explant cultures were established within 2 h from delivery. Small explants of villous material (~1 mm3, weighing ~2 mg) were dissected from randomly selected healthy appearing sites, and four explants were incubated in each well at 37°C containing 1 ml CMRL-1066 medium (Sigma-Aldrich, St. Louis, MO) supplemented with 5% FBS, 1 µg/ml insulin, 100 µg/ml streptomycin sulfate, and 1,000 IU/ml penicillin G. As an index of villous explant condition, human chorionic gonadotrophin (hCG) concentrations were measured in the medium daily using an enzyme immunoassay kit (DRG International, Mountainside, NJ) according to the manufacturer's instructions. To confirm viability of the explant tissue, lactate dehydrogenase (LDH) activity in the medium was assessed daily (Sigma Diagnostics, St. Louis, MO) according to the manufacturer's instructions. Based on previous extensive validation of this technique (35) and our own preliminary experiments (Fig. 1A), a 5-day incubation was conducted before treatment with cytokines or other pharmacological test agents. At this time, hCG levels were stable at peak levels, and there was no evidence of cell death as indicated by media levels of LDH (Fig. 1B).



View larger version (12K):
[in this window]
[in a new window]
  		Fig. 1. Viability of the human placental explant culture system. A: explants produced increasing quantities of human chorionic gonadotropin (hCG) over the 5-day pretreatment period. Treatment with IL-1{beta} (C; 10 ng/ml) had no effect on hCG secretion. B: treatment over 24 h, beginning after day 5 pretreatment incubation, did not cause significant effect on the concentrations of lactate dehydrogenase (LDH) in the medium. The dotted line indicates the concentration at which significant cell toxicity is present. TMB-8, 8-(N,N-diethylamino)octyl-3,4,5-trimethoxybenzoate.

 
After 5 days in culture, the explants were treated with proinflammatory cytokines IL-1{beta}, IL-6, or TNF-{alpha} (Biosource International, Camarillo, CA) at a concentration of 10 ng/ml, based on previous literature (10), for up to 24 h. Appropriate time controls without treatment were performed in each experiment. The role of Ca2+ was assessed (n = 3 experiments) using the Ca2+ channel blocker nifedipine (100 µM; see Ref. 9), the intracellular Ca2+ antagonist 8-(N,N-diethylamino)octyl-3,4,5-trimethoxybenzoate [TMB-8 (100 µM); see Ref. 39], or the Ca2+ ionophore A-23187 (10 µM). To assess the involvement of AC, we used (n = 3 experiments) the AC stimulant forskolin (5 µM) or the AC inhibitor SQ-22563 (10 µM; see Ref. 14). At the end of each experiment, explants were frozen in liquid N2 and stored at –80°C until assay. All Ca2+ and AC modulators were obtained from Sigma-Aldrich.

11{beta}-HSD enzyme assay. At the time of enzyme assay, the frozen tissues were homogenized in 3 ml Tris-EDTA (50 mM) buffer using a Polytron (Brinkmann Instruments, Mississauga, ON, Canada), three bursts of 20 s. After centrifugation at 1,000 rpm for 15 min, the supernatant was obtained, and protein concentration was measured using the Bradford technique. Each assay tube contained ~100,000 dpm [1,2,6,7-3H(N)]cortisol (2.59–3.7 TBq/mmol; PerkinElmer Life Sciences, Boston, MA) in addition to cold cortisol (Sigma-Aldrich) and 10 mM NAD+ in a total reaction volume of 500 µl. At the end of the reaction, 40 µg of carrier cortisol and cortisone were added in 4 ml of ethyl acetate, and the tubes were placed on ice. Steroids were extracted two times using 4 ml of ethyl acetate, and, after centrifugation at 1,000 rpm for 10 min, the aqueous layer was frozen using dry ice. The organic phase was removed and evaporated at room temperature. The residue was reconstituted in 100 µl of ethyl acetate, applied to TLC plates (Whatman, Clifton, NJ), and separated using the solvent system chloroform-ethanol 89:11. Bands were visualized using I2 vapor and scraped into scintillation fluid, and the radioactivity was measured using a Beckman model LS5000TD liquid scintillation counter (Beckman Coulter, Fullerton, CA).

Preliminary experiments were performed to determine the optimal time, protein concentration, and substrate concentration to be used in the assay. On the basis of these experiments, the following standard assay conditions were derived: ~100 µg of homogenate protein were incubated with 3 µM substrate cortisol for 30 min. The experimental results were calculated by expressing the conversion rates of cortisol to cortisone in the presence of a cytokine as a percentage of that in the corresponding control in the absence of cytokine.

RT-PCR. RNA was extracted using the GenElute Mammalian Total RNA Miniprep kit (Sigma-Aldrich). Samples were treated with amplification-grade DNase I (Sigma-Aldrich). The purity of the extracted RNA was assessed by spectrophotometry, and the concentration of RNA was calculated. The sample was diluted to 50 ng mRNA/µl.

Reverse transcription was performed using the Taqman Reverse Transcription Reagents kit (Applied Biosystems, Foster City, CA). A mixture of random hexamers (50 µM) and 7 µl of RNA-free water was incubated with 100 ng of RNA at 65°C for 5 min to denature the secondary structures of mRNA and for annealing of the hexamer primers. After this incubation, the following reagents were added: 2 µl 10x RT buffer, 4.4 µl 25 mM MgCl2, 4 µl deoxy-NTP mixture (2.5 mM of each), 0.4 µl RNase inhibitor (20 U/ml), 0.5 µl Multi Scribe RT (50 U/µl), and 0.7 µl H2O. The total mixture (20 µl) was incubated at 25°C for 10 min for equilibration, then at 48°C for 60 min to allow cDNA synthesis, and then at 95°C for 5 min to inactivate the RT enzyme. The resultant mixture was stored at –20°C until ready for PCR. As a negative control, the reaction was also performed in randomly chosen samples in the absence of the Multi Scribe RT.

Real-time PCR was performed in triplicate, using a total reaction volume of 25 µl/well. The primer pairs (36) were as follows: for 11{beta}-HSD2, forward TCAAGACAGAGTCAGTGAGAGAAACG and reverse GGAACTGCCCATGCAAGTG, which produced a 129-nt amplicon; and for cyclophylin, forward CACCGTGTTCTTCGACATCAC and reverse CCAGTGCTCAGAGCTCGAAAG, which produced a 114-nt amplicon. Each protocol was optimized individually. All reagents for the PCR reactions were from the SYBR Green PCR Core Reagents Kit (Applied Biosystems). The master mix included the following: 2.5 µl 10x SYBR Green buffer, 3.0 µl of 25 mM MgCl2, 2.0 µl dNTP mix (dATP, dCTP, dGTP: 2.5 mM each; dUTP: 5.0 mM), 0.13 µl Ampli Taq Gold (5 U/µl), 0.25 µl Amp Erase UNG (1 U/µl), 0.5 µl forward primer, 0.5 µl reverse primer, 1 µl cDNA template, and 15.12 µl autoclaved H2O. For the blank control, autoclaved H2O replaced the cDNA template. The PCR reaction was initiated for 2 min at 50°C and then 10 min at 95°C. The fluorescence was measured at the end of each cycle and plotted against the threshold cycle (CT) number to determine the CT. After amplification, the purity of the amplified cDNA was checked by assessing a melt curve of the amplified products.

For quantification, we use the "{Delta}-{Delta}" method to determine the relative expression between groups (43). CT was determined for the gene of interest (GOI) and a housekeeping gene (HKG; cyclophylin). The data were normalized by subtracting the CT of the GOI from the CT of the HKG to determine the {Delta}CT. The relative expression level of the GOI in an experimental sample was compared with that of a control or calibrator sample by subtracting their {Delta}CT values and using the following formula: relative degree of change = 2–x, where x is the difference between the {Delta}CT of the experimental sample and the calibrator samples.

Statistical analyses. The analyses of the 11{beta}-HSD activity and mRNA over time and the effects of treatment were performed using one-way ANOVA followed by post hoc Tukey-Kramer Multiple Comparisons test. The data are presented in Figs. 1–5 as means ± SE. Statistical significance was defined as P ≤ 0.05.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 5. Relative expression of mRNA for 11{beta}-HSD2 after 2- or 24-h treatments with IL-1{beta} or the factors noted to reduce the enzyme activity. None of these treatments caused a significant change in the concentrations of mRNA for 11{beta}-HSD2 (n = 3).

 

   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
After 5 days in culture, the hCG concentrations were at peak levels (Fig. 1A), and there was no increase in LDH in the medium to suggest cell death (Fig. 1B). Similarly, the cytokine treatment had no influence on the health of the explants, as assessed by the ability to synthesize and secrete hCG and the presence of LDH in the media. Human placenta contains abundant 11{beta}-HSD2 activity. In our validation experiments, we observed activity for conversion of cortisol to cortisone by untreated explants in the range 10–25 pmol·mg protein–1·min–1.

During the day of treatment (day 6 in culture), the 11{beta}-HSD2 activity did not change significantly over the 24 h in the absence of treatment (Fig. 2). Treatment with IL-1{beta}, TNF-{alpha}, or IL-6 caused a significant reduction in 11{beta}-HSD2 activity. The effects were near maximal after 2 h of incubation and persisted for at least 24 h. In some experiments with each of the three cytokines, incubations were performed for intervals <2 h, and 11{beta}-HSD2 activity was suppressed by >50% by 0.5 h (data not shown). At 2 h, 11{beta}-HSD2 activity was reduced to 25.2 ± 5.5, 24.8 ± 7.0 and 22.7 ± 4.1% of control activity by IL-1{beta}, TNF-{alpha} and IL-6, respectively. By 24 h, the activity was reduced to 11.7 ± 3.1, 0.8 ± 0.4, and 5.5 ± 2.9% of control values respectively.



View larger version (13K):
[in this window]
[in a new window]
  		Fig. 2. Enzyme activity for 11{beta}-hydroxysteroid dehydrogenase type 2 (HSD2) expressed as a percentage of time 0 levels. There was no significant effect of 24 h in culture without treatment. However, each of the cytokines (10 ng/ml) caused significant inhibition of 11{beta}-HSD activity by 2 h, and this was further inhibited by 24 h. *P < 0.05.

 
We assessed the role of Ca2+ as a mediator of the suppressive effects of IL-1{beta} on placental 11{beta}-HSD2 activity at 2 and 24 h using several pharmacological tools (Figs. 3A and 4A). The patterns were the same at 2 and 24 h. Inhibition of extracellular Ca2+ entry in the cells using nifedipine prevented the inhibitory effects of IL-1{beta}. A similar result was obtained by prevention of release of Ca2+ from intracellular stores using TMB-8. Neither nifedipine nor TMB-8 had any effect alone. Conversely, increasing intracellular Ca2+ with the Ca2+ ionophore A-23187 caused suppression of 11{beta}-HSD activity to an extent similar to IL-1{beta} treatment.



View larger version (14K):
[in this window]
[in a new window]
  		Fig. 3. Effects of agonists and antagonists of Ca2+ and cAMP on the inhibitory action of IL-1{beta} on 11{beta}-HSD2 activity after 2-h incubation. A: Ca2+ antagonists nifedipine (nifed) and TMB-8 had no significant effect on basal 11{beta}-HSD2 activity, but either antagonist significantly prevented the IL-1{beta}-induced inhibitory effects. The Ca2+ ionophore A-23187 significantly inhibited 11{beta}-HSD2 activity, and there was no additive effect when combined with IL-1{beta}. B: adenylyl cyclase stimulant forskolin had no effect on basal 11{beta}-HSD2 activity but prevented the IL-1{beta}-induced inhibition. Conversely, the adenylyl cyclase inhibitor SQ-22536 significantly inhibited the enzyme activity without apparent additive effects to IL-1{beta}. *Significant difference (P ≤ 0.05) from the untreated control incubations.

 


View larger version (13K):
[in this window]
[in a new window]
  		Fig. 4. Effects of agonists and antagonists of Ca2+ and cAMP on the inhibitory action of IL-1{beta} on 11{beta}-HSD2 activity after 24-h incubation. The effects were qualitatively similar to those demonstrated after 2 h incubation (see legend for Fig. 3).

 
The potential role of AC in mediation of the suppressive effect of IL-1{beta} was assessed using both an agonist and an antagonist (Figs. 3B and 4B). The AC stimulant forskolin was without effect by itself but markedly abrogated the inhibitory effect of IL-1{beta} at both 2 and 24 h. Conversely, the AC inhibitor SQ-22536 had a suppressive effect on 11{beta}-HSD2 activity similar to IL-1{beta} at both time points. There was no apparent synergistic effect of SQ-22536 plus IL-1{beta}.

To determine whether the decreased enzyme activity might be because of inhibition of transcription, we used RT-PCR to assess mRNA levels for 11{beta}-HSD2 in human placental explants treated with the factors noted to cause significant inhibition in enzyme activity (Fig. 5). None of these factors was associated with decreased expression of mRNA for 11{beta}-HSD2.


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In the milieu of maternal stress accompanied by excessive maternal cortisol and proinflammatory cytokine concentrations, it appears intuitive that the placenta would increase 11{beta}-HSD2 activity to protect the fetus from excessive cortisol exposure. However, the current results indicate a very potent inhibitory effect of proinflammatory cytokines on 11{beta}-HSD2 activity. Our basal enzyme activity rates were similar to those measured by Rogerson et al. (44) and slightly lower than the estimates of Murphy and Clifton (36). The inhibitory activity was similar for all three cytokines tested. The inhibition was near maximal by 2 h of exposure and, in some instances, almost completely inhibited by 24 h. These findings are similar to a previous study showing marked suppression of 11{beta}-HSD2 activity by IL-1{beta} and TNF-{alpha} in the human osteosarcoma cell line MG-63 (11). However, these latter results were noted at 48 h and were not measured earlier. Cytokine treatment had no effect on 11{beta}-HSD2 expression in JEG-3 cells (22). In contrast, 11{beta}-HSD1 expression is increased by treatment with IL-1{beta} or TNF-{alpha} in glomerular mesangial cells (13) and JEG-3 cells (22).

The clinical implications of these effects are not clear but could be very important. In pregnancies complicated by histological chorioamnionitis, placental 11{beta}-HSD2 mRNA and activity were reduced significantly (22). Our data could provide a mechanism through which this reduced activity occurs. In normal pregnancy, placental 11{beta}-HSD mRNA (45) and activity (47) increase through pregnancy. However, at the end of human (36) and baboon (31) gestation, there is a significant reduction in 11{beta}-HSD2 activity, which may play a role in fetal organ maturation and the timing of parturition (9). Hence, abnormal regulation of 11{beta}-HSD2 activity could have adverse consequences regarding the timing of birth or fetal maturation. Furthermore, low placental 11{beta}-HSD2 activity has been associated with low birth weight in some studies (34, 49) but not in others (44). Intrauterine growth restriction is often accompanied by elevated maternal serum concentrations of proinflammatory cytokines (6, 21, 48). Thus it is possible that the elevated cytokines that accompany the placental pathology leading to fetal growth restriction also inhibit placental 11{beta}-HSD2 activity and increase fetal exposure to maternal cortisol. This may represent a mechanism leading to the observed increased incidence of adult metabolic and cardiovascular disease in these circumstances.

The 11{beta}-HSD2 isoform was cloned from the kidney (1) and placenta (7). It differs from 11{beta}-HSD1 in that it requires NAD+ as cofactor, catalyzes only the oxidative reaction, and has a lower Km (10–100 nM). The tissue distribution of the enzyme is similar to that for the mineralocorticoid receptor (MR), and it is thought that the enzyme, by oxidizing cortisol, protects against excessive activation of MR by cortisol. Indeed, abnormal expression of this gene causes the syndrome of apparent mineralocorticoid excess (51). In the human placenta, the type 2 isoform accounts for essentially all of the 11{beta}-HSD activity in the human placenta (49). Unlike other sites, the enzyme in this tissue appears not to serve a protective function for the MR. It has been suggested that the principal function of placental 11{beta}-HSD2 is to protect the developing fetus against excessive exposure to glucocorticoid. Failure of this function could result in permanent dysregulation of the hypothalamic-pituitary-adrenal axis of the developing fetus (33, 42) and predispose to an increased incidence of cardiovascular and metabolic disease in the adult (46). It is possible that, in the face of maternal pregnancy complications, the short-term benefits of excessive fetal cortisol (perhaps accelerated maturation and earlier birth) outweigh the potential long-term adverse consequences of excessive fetal cortisol exposure.

Because of the rapid action of the inhibitory effects, we first investigated nongenomic signaling pathways. The data demonstrate clearly that intracellular Ca2+ is an important mediator of the rapid inhibitory effects of IL-1{beta} on 11{beta}-HSD activity. The inhibitory effects were reproduced using a Ca2+ ionophore. The IL-1{beta}-induced inhibition was attenuated by blocking the influx of extracellular Ca2+ using nifedipine or by blocking inositol trisphosphate-induced Ca2+ release from intracellular stores using TMB-8 (39). These results confirm and extend the findings of Hardy et al. (19) who noted a 50% decrease in 11{beta}-HSD2 activity with a PGF2{alpha}-induced increase in Ca2+. As in the present study, the inhibitory effect was blocked in the presence of the intracellular chelator BAPTA. These findings suggest the involvement of a G{alpha}q-coupled receptor stimulation of phospholipase C.

Signal transduction mechanisms underlying the effects of IL-1{beta} are numerous and diverse and appear to be very dependent on the cell type studied as well as the cell culture conditions (4). Most studies have focused on the long-term genomic effects of IL-1{beta} on regulation of genes involved with cell death or replication. Relatively little is known regarding acute, rapid signal transduction pathways linked to proinflammatory cytokines and their receptors. However, in synovial fibroblasts, IL-1{beta} causes rapid membrane depolarization that can be blocked by Ca2+ channel inhibitors or protein kinase C antagonists (26). As in our study, the effects of IL-1{beta} could be reproduced using a Ca2+ ionophore, although it was administered in addition to a phorbol ester to stimulate protein kinase C. IL-1{beta} also causes an acute increase in intracellular Ca2+ in human fibroblasts (3) and chondrocytes (30). The latter study demonstrated that the source of Ca2+ was from both intracellular and extracellular stores. The rapid pyrogenic response to injected IL-1{beta} also appears to be mediated through a pathway involving increased intracellular Ca2+ arising mainly from the intracellular stores (40). TNF-{alpha} may signal through the TNF receptor isoform TNFR1 to stimulate rapid transient waves of Ca2+, mostly arising from intracellular stores (32). This pathway appears to be mediated by a mechanism that involves ceramide intermediates that are converted to sphingosine 1-phosphate, which can activate a G{alpha}q-linked membrane receptor. For IL-6, studies again have focused on genomic mechanisms, but there is evidence that this cytokine can induce a transient increase in phosphoinositide turnover with increased intracellular Ca2+ concentration in rat mesangial cells (15). In pheochromocytoma cells, IL-6 caused direct activation of phospholipase C-{gamma} (27). Conversely, IL-6 caused no increase in intracellular Ca2+ in the salivary cell line SMG-C6 (29). Overall, these data support the concept that the inhibitory effects of proinflammatory cytokines on 11{beta}-HSD2 may be mediated in part through regulation of intracellular Ca2+.

The responses to agonists and antagonists of AC also provided interesting results. The AC stimulant forskolin almost completely abrogated the inhibitory response of the cytokines on 11{beta}-HSD2 activity. Conversely, the AC inhibitor SQ-22536 had effects similar to those of the cytokines. Our data differ slightly from those of Gibb and Sun (16) in that we measured no effect of forskolin alone, whereas they noted an increase in both mRNA and enzyme activity for 11{beta}-HSD2 in cultured human trophoblast cells. The discrepancy may be because of differences in the concentration of forskolin (their use of 100 µM, whereas we used only 5 µM). However, both studies suggest that the inhibitory effects of the cytokines could be mediated by reducing cAMP levels. This pattern of effects is similar to that seen in rat hepatocytes where IL-1{beta} treatment greatly increases expression of inducible nitric oxide synthase (iNOS), an effect that is significantly diminished by forskolin and enhanced by SQ-22536 (18). In rat cardiac fibroblasts, IL-1{beta} attenuates cAMP accumulation by a mechanism that is mediated by increased iNOS activity, resulting in increased phosphodiesterase (PDE) activity, thus increasing cAMP degradation (17). In human myometrial cells, prolonged IL-1{beta} treatment causes an increase in PDE activity that appears to be dependent on an increase in PGE2 (38). Intracellular signaling pathways for TNF-{alpha} also may include cAMP. In porcine renal epithelial cells, TNF-{alpha} treatment caused decreased 11{beta}-HSD2 activity, and this was reversed by cotreatment with forskolin (20). Similarly to IL-1{beta}, TNF-{alpha} also may increase PDE activity, resulting in lower cAMP levels (24). There has been little, if any, research into the acute effects of IL-6 on cAMP accumulation.

The mechanisms through which Ca2+ and cAMP affect 11{beta}-HSD2 activity remain to be determined, although it appears from our data that both operate through translational or posttranslational mechanisms. Increased Ca2+ appears to have a direct inhibitory action on the catalytic site of human placental 11{beta}-HSD2 without interfering with the substrate-binding or cofactor-binding sites (19). It will be interesting to determine if increased Ca2+ or lowered cAMP directly affects the process of translation and whether there are interactions between Ca2+ and cAMP. Similarly, it will be interesting to determine if cAMP-stimulated protein kinase A affects 11{beta}-HSD2 activity.

The present data demonstrating significant inhibition of 11{beta}-HSD2 activity confirm the recent findings of Chisaka et al. (10). In their study, there was a modest decline in 11{beta}-HSD2 activity at 6 h, but, in contrasts to our data, this was accompanied by a similar decline in mRNA. At 24 h, there was no difference from controls for either activity or mRNA. The reason for the differences between these two studies may be related to the technique of tissue preparation. In their study, placental tissue was digested with trypsin and cytotrophoblast cells, separated using density gradient centrifugation, and cultured for 3 days before treatment. In our study, an explant of syncytialized villi was cultured for 5 days before treatment.

In general, levels of mRNA for 11{beta}-HSD2 tend to correlate well with enzyme activity. The mRNA levels increase during pregnancy and then decline slightly before parturition (31, 36). There is some conflict in the literature regarding mRNA levels for placental 11{beta}-HSD2 in intrauterine growth restriction. Some studies show decreased levels (34), and others show no change (36, 44). The regulation of 11{beta}-HSD2 gene expression appears to be complex. It can be increased by estrogen and decreased by progesterone (8, 42). Treatment with glucocorticoids increased mRNA for 11{beta}-HSD2 in human trophoblast cells (50) and in baboon placenta (31) but decreased 11{beta}-HSD2 expression in ovine placenta (25). Interestingly, 24-h treatment with IL-1{beta} of JEG-3 cells derived from human choriocarcinoma caused an increase in 11{beta}-HSD2 mRNA and protein (41). In the present studies, because there was no change in mRNA for 11{beta}-HSD2 after treatment with the factors that inhibited the enzyme activity, we conclude that the effects of the proinflammatory cytokines as well as Ca2+ and the inhibition of AC occurred at the posttranscriptional level.

In summary, these data clearly demonstrate inhibitory effects of proinflammatory cytokines on human term placental 11{beta}-HSD2 activity levels without concomitant changes in mRNA. We noted a consistent and highly significant rapid reduction in enzyme activity. This inhibition of enzyme activity appeared to be mediated by increased intracellular Ca2+ concentrations and by reduced AC activity acting through a posttranscriptional mechanism. These findings could have important clinical implications in that this may lead to excessive fetal cortisol exposure, which has been associated with an increased incidence of adult metabolic, cardiovascular, and neurological disease. Thus the data may provide a causal link between these adult diseases and inflammatory conditions in pregnancy, including but not limited to growth restriction. Relatively little is known about the acute, nongenomic effects of the proinflammatory cytokines. Increased understanding of the pathways involved may be useful in preventing some of the long-term consequences of an adverse fetal environment.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by an operating grant support from the Canadian Institutes for Health Research, including the Group Grant in Perinatal Health and Disease, and the Alberta Heritage Foundation for Medical Research.


   ACKNOWLEDGMENTS
 
We are grateful to the tissue collection staff and the nursing staff of the Labour and Delivery Unit at the Royal Alexandra Hospital who provided the placental tissues. We acknowledge the assistance of the Society for Gynecologic Investigation (SGI) President's Presenter Award, sponsored by Wyeth, for I. Kossintseva to present these data at the 52nd Annual Meeting of the SGI in Los Angeles in March 2005.


   FOOTNOTES
 

Address for reprint requests and other correspondence: B. F. Mitchell, Perinatal Research Centre, 220 HMRC, Univ. of Alberta, Edmonton, Canada T6G 2S2 (e-mail: brymitch{at}ualberta.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Agarwal AK, Rogerson FM, Mune T, and White PC. Gene structure and chromosomal localization of the human HSD11K gene encoding the kidney (type 2) isozyme of 11 beta-hydroxysteroid dehydrogenase. Genomics 29: 195–199, 1995.[CrossRef][Web of Science][Medline]
  2. Albiston AL, Obeyesekere VR, Smith RE, and Krozowski ZS. Cloning and tissue distribution of the human 11 beta-hydroxysteroid dehydrogenase type 2 enzyme. Mol Cell Endocrinol 105: R11–R17, 1994.[CrossRef][Web of Science][Medline]
  3. Arora PD, Ma J, Min W, Cruz T, and McCulloch CA. Interleukin-1-induced calcium flux in human fibroblasts is mediated through focal adhesions. J Biol Chem 270: 6042–6049, 1995.[Abstract/Free Full Text]
  4. Bankers-Fulbright JL, Kalli KR, and McKean DJ. Interleukin-1 signal transduction. Life Sci 59: 61–83, 1996.[CrossRef][Web of Science][Medline]
  5. Barker DJ. The Wellcome Foundation Lecture, 1994. The fetal origins of adult disease. Proc R Soc Lond B Biol Sci 262: 37–43, 1995.[Medline]
  6. Bartha JL, Romero-Carmona R, and Comino-Delgado R. Inflammatory cytokines in intrauterine growth retardation. Acta Obstet Gynecol Scand 82: 1099–1102, 2003.[CrossRef][Web of Science][Medline]
  7. Brown RW, Chapman KE, Kotelevtsev Y, Yau JL, Lindsay RS, Brett L, Leckie C, Murad P, Lyons V, Mullins JJ, Edwards CR, and Seckl JR. Cloning and production of antisera to human placental 11 beta-hydroxysteroid dehydrogenase type 2. Biochem J 313: 1007–1017, 1996.[Web of Science][Medline]
  8. Burton PJ and Waddell BJ. Dual function of 11beta-hydroxysteroid dehydrogenase in placenta: modulating placental glucocorticoid passage and local steroid action. Biol Reprod 60: 234–240, 1999.[Abstract/Free Full Text]
  9. Challis JR, Sloboda D, Matthews SG, Holloway A, Alfaidy N, Patel FA, Whittle W, Fraser M, Moss TJ, and Newnham J. The fetal placental hypothalamic-pituitary-adrenal (HPA) axis, parturition and post natal health. Mol Cell Endocrinol 185: 135–144, 2001.[CrossRef][Web of Science][Medline]
  10. Chisaka H, Johnstone JF, Premyslova M, Manduch Z, and Challis JR. Effect of pro-inflammatory cytokines on expression and activity of 11beta-hydroxysteroid dehydrogenase type 2 in cultured human term placental trophoblast and human choriocarcinoma JEG-3 cells. J Soc Gynecol Investig 12: 303–309, 2005.[Web of Science][Medline]
  11. Cooper MS, Bujalska I, Rabbitt E, Walker EA, Bland R, Sheppard MC, Hewison M, and Stewart PM. Modulation of 11beta-hydroxysteroid dehydrogenase isozymes by proinflammatory cytokines in osteoblasts: an autocrine switch from glucocorticoid inactivation to activation. J Bone Miner Res 16: 1037–1044, 2001.[CrossRef][Web of Science][Medline]
  12. Edwards CR, Benediktsson R, Lindsay RS, and Seckl JR. Dysfunction of placental glucocorticoid barrier: link between fetal environment and adult hypertension? Lancet 341: 355–357, 1993.[CrossRef][Web of Science][Medline]
  13. Escher G, Galli I, Vishwanath BS, Frey BM, and Frey FJ. Tumor necrosis factor alpha and interleukin 1beta enhance the cortisone/cortisol shuttle. J Exp Med 186: 189–198, 1997.[Abstract/Free Full Text]
  14. Fabbri E, Brighenti L, and Ottolenghi C. Inhibition of adenylate cyclase of catfish and rat hepatocyte membranes by 9-(tetrahydro-2-furyl)adenine (SQ 22536). J Enzym Inhib 5: 87–98, 1991.[Medline]
  15. Fukunaga M, Fujiwara Y, Fujibayashi M, Ochi S, Yokoyama K, Ando A, Hirano T, Ueda N, and Kamada T. Signal transduction mechanism of interleukin 6 in cultured rat mesangial cells. FEBS Lett 285: 265–267, 1991.[CrossRef][Web of Science][Medline]
  16. Gibb W and Sun M. Cellular specificity of interleukin-1beta-stimulated expression of type-2 prostaglandin H synthase in human amnion cell cultures. Biol Reprod 59: 1139–1142, 1998.[Abstract/Free Full Text]
  17. Gustafsson AB and Brunton LL. Attenuation of cAMP accumulation in adult rat cardiac fibroblasts by IL-1{beta} and NO: role of cGMP-stimulated PDE2. Am J Physiol Cell Physiol 283: C463–C471, 2002.[Abstract/Free Full Text]
  18. Harbrecht BG, Taylor BS, Xu Z, Ramalakshmi S, Ganster RW, and Geller DA. cAMP inhibits inducible nitric oxide synthase expression and NF-kappaB-binding activity in cultured rat hepatocytes. J Surg Res 99: 258–264, 2001.[CrossRef][Medline]
  19. Hardy DB, Dixon SJ, Narayanan N, and Yang K. Calcium inhibits human placental 11beta-hydroxysteroid dehydrogenase type 2 activity. Biochem Biophys Res Commun 283: 756–761, 2001.[CrossRef][Web of Science][Medline]
  20. Heiniger CD, Rochat MK, Frey FJ, and Frey BM. TNF-alpha enhances intracellular glucocorticoid availability. FEBS Lett 507: 351–356, 2001.[CrossRef][Web of Science][Medline]
  21. Johnson MR, Anim-Nyame N, Johnson P, Sooranna SR, and Steer PJ. Does endothelial cell activation occur with intrauterine growth restriction? Br J Gen Pract 109: 836–839, 2002.
  22. Johnstone JF, Bocking AD, Unlugedik E, and Challis JR. The effects of chorioamnionitis and betamethasone on 11beta hydroxysteroid dehydrogenase types 1 and 2 and the glucocorticoid receptor in preterm human placenta. J Soc Gynecol Investig 12: 238–245, 2005.[Web of Science][Medline]
  23. Kajantie E, Dunkel L, Turpeinen U, Stenman UH, Wood PJ, Nuutila M, and Andersson S. Placental 11 beta-hydroxysteroid dehydrogenase-2 and fetal cortisol/cortisone shuttle in small preterm infants. J Clin Endocrinol Metab 88: 493–500, 2003.[Abstract/Free Full Text]
  24. Kast RE. Tumor necrosis factor has positive and negative self regulatory feed back cycles centered around cAMP. Int J Immunopharmacol 22: 1001–1006, 2000.[CrossRef][Medline]
  25. Kerzner LS, Stonestreet BS, Wu KY, Sadowska G, and Malee MP. Antenatal dexamethasone: effect on ovine placental 11beta-hydroxysteroid dehydrogenase type 2 expression and fetal growth. Pediatr Res 52: 706–712, 2002.[CrossRef][Web of Science][Medline]
  26. Kolomytkin OV, Marino AA, Sadasivan KK, Wolf RE, and Albright JA. Intracellular signaling mechanisms of interleukin-1{beta} in synovial fibroblasts. Am J Physiol Cell Physiol 276: C9–C15, 1999.[Abstract/Free Full Text]
  27. Lee YH, Bae SS, Seo JK, Choi I, Ryu SH, and Suh PG. Interleukin-6-induced tyrosine phosphorylation of phospholipase C-gamma1 in PC12 cells. Mol Cell 10: 469–474, 2000.
  28. Lindsay RS, Lindsay RM, Edwards CR, and Seckl JR. Inhibition of 11-beta-hydroxysteroid dehydrogenase in pregnant rats and the programming of blood pressure in the offspring. Hypertension 27: 1200–1204, 1996.[Abstract/Free Full Text]
  29. Liu XB, Sun X, Mork AC, Dodds MW, Martinez JR, and Zhang GH. Characterization of the calcium signaling system in the submandibular cell line SMG-C6. Proc Soc Exp Biol Med 225: 211–220, 2000.[Abstract/Free Full Text]
  30. Luo L, Cruz T, and McCulloch C. Interleukin 1-induced calcium signalling in chondrocytes requires focal adhesions. Biochem J 324: 653–658, 1997.[Medline]
  31. Ma XH, Wu WX, and Nathanielsz PW. Gestation-related and betamethasone-induced changes in 11beta-hydroxysteroid dehydrogenase types 1 and 2 in the baboon placenta. Am J Obstet Gynecol 188: 13–21, 2003.[CrossRef][Web of Science][Medline]
  32. MacEwan DJ. TNF receptor subtype signalling: differences and cellular consequences. Cell Signal 14: 477–492, 2002.[CrossRef][Web of Science][Medline]
  33. Matthews SG. Antenatal glucocorticoids and programming of the developing CNS. Pediatr Res 47: 291–300, 2000.[Web of Science][Medline]
  34. McTernan CL, Draper N, Nicholson H, Chalder SM, Driver P, Hewison M, Kilby MD, and Stewart PM. Reduced placental 11beta-hydroxysteroid dehydrogenase type 2 mRNA levels in human pregnancies complicated by intrauterine growth restriction: an analysis of possible mechanisms. J Clin Endocrinol Metab 86: 4979–4983, 2001.[Abstract/Free Full Text]
  35. Merchant SJ, Crocker IP, Baker PN, Tansinda D, Davidge ST, and Guilbert LJ. Matrix metalloproteinase release from placental explants of pregnancies complicated by intrauterine growth restriction. J Soc Gynecol Investig 11: 97–103, 2004.[CrossRef][Web of Science][Medline]
  36. Murphy VE and Clifton VL. Alterations in human placental 11beta-hydroxysteroid dehydrogenase type 1 and 2 with gestational age and labour. Placenta 24: 739–744, 2003.[CrossRef][Web of Science][Medline]
  37. Newnham JP and Moss TJ. Antenatal glucocorticoids and growth: single versus multiple doses in animal and human studies. Semin Neonatol 6: 285–292, 2001.[CrossRef][Medline]
  38. Oger S, Mehats C, Dallot E, Ferre F, and Leroy MJ. Interleukin-1beta induces phosphodiesterase 4B2 expression in human myometrial cells through a prostaglandin E2- and cyclic adenosine 3', 5' -monophosphate-dependent pathway. J Clin Endocrinol Metab 87: 5524–5531, 2002.[Abstract/Free Full Text]
  39. Palade P, Dettbarn C, Alderson B, and Volpe P. Pharmacologic differentiation between inositol-1,4,5-trisphosphate-induced Ca2+ release and Ca2+- or caffeine-induced Ca2+ release from intracellular membrane systems. Mol Pharmacol 36: 673–680, 1989.[Abstract]
  40. Palmi M and Meini A. Role of the nitric oxide/cyclic GMP/Ca2+ signaling pathway in the pyrogenic effect of interleukin-1beta. Mol Neurobiol 25: 133–147, 2002.[Medline]
  41. Pasquarette MM, Stewart PM, Ricketts ML, Imaishi K, and Mason JI. Regulation of 11 beta-hydroxysteroid dehydrogenase type 2 activity and mRNA in human choriocarcinoma cells. J Mol Endocrinol 16: 269–275, 1996.[Abstract/Free Full Text]
  42. Pepe GJ and Albrecht ED. Regulation of functional differentiation of the placental villous syncytiotrophoblast by estrogen during primate pregnancy. Steroids 64: 624–627, 1999.[CrossRef][Medline]
  43. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR (Abstract). Nucleic Acids Res 29: e45, 2001.[Abstract/Free Full Text]
  44. Rogerson FM, Kayes KM, and White PC. Variation in placental type 2 11beta-hydroxysteroid dehydrogenase activity is not related to birth weight or placental weight. Mol Cell Endocrinol 128: 103–109, 1997.[CrossRef][Web of Science][Medline]
  45. Schoof E, Girstl M, Frobenius W, Kirschbaum M, Repp R, Knerr I, Rascher W, and Dotsch J. Course of placental 11beta-hydroxysteroid dehydrogenase type 2 and 15-hydroxyprostaglandin dehydrogenase mRNA expression during human gestation. Eur J Endocrinol 145: 187–192, 2001.[Abstract]
  46. Seckl JR. Prenatal glucocorticoids and long-term programming. Eur J Endocrinol 151, Suppl 3: U49–U62, 2004.
  47. Shams M, Kilby MD, Somerset DA, Howie AJ, Gupta A, Wood PJ, Afnan M, and Stewart PM. 11Beta-hydroxysteroid dehydrogenase type 2 in human pregnancy and reduced expression in intrauterine growth restriction. Hum Reprod 13: 799–804, 1998.[Abstract/Free Full Text]
  48. Stallmach T, Hebisch G, Joller-Jemelka HI, Orban P, Schwaller J, and Engelmann M. Cytokine production and visualized effects in the feto-maternal unit. Quantitative and topographic data on cytokines during intrauterine disease. Lab Invest 73: 384–392, 1995.[Web of Science][Medline]
  49. Stewart PM, Rogerson FM, and Mason JI. Type 2 11 beta-hydroxysteroid dehydrogenase messenger ribonucleic acid and activity in human placenta and fetal membranes: its relationship to birth weight and putative role in fetal adrenal steroidogenesis. J Clin Endocrinol Metab 80: 885–890, 1995.[Abstract]
  50. van Beek JP, Guan H, Julan L, and Yang K. Glucocorticoids stimulate the expression of 11beta-hydroxysteroid dehydrogenase type 2 in cultured human placental trophoblast cells. J Clin Endocrinol Metab 89: 5614–5621, 2004.[Abstract/Free Full Text]
  51. Wilson RC, Harbison MD, Krozowski ZS, Funder JW, Shackleton CH, Hanauske-Abel HM, Wei JQ, Hertecant J, Moran A, Neiberger RE, and et al. Several homozygous mutations in the gene for 11 beta-hydroxysteroid dehydrogenase type 2 in patients with apparent mineralocorticoid excess. J Clin Endocrinol Metab 80: 3145–3150, 1995.[Abstract]



This article has been cited by other articles:


Home page
 Hum Reprod UpdateHome page
A. E. Michael and A. T. Papageorghiou
Potential significance of physiological and pharmacological glucocorticoids in early pregnancy
Hum. Reprod. Update, September 1, 2008; 14(5): 497 - 517.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/E282    most recent
00328.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kossintseva, I.
Right arrow Articles by Mitchell, B. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kossintseva, I.
Right arrow Articles by Mitchell, B. F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.