AJP - Endo Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 289: E1071-E1076, 2005. First published August 16, 2005; doi:10.1152/ajpendo.00606.2004
0193-1849/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/6/E1071    most recent
00606.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (32)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holmes, B. F.
Right arrow Articles by Dohm, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holmes, B. F.
Right arrow Articles by Dohm, G. L.

Regulation of muscle GLUT4 enhancer factor and myocyte enhancer factor 2 by AMP-activated protein kinase

Burton F. Holmes,1,2 David P. Sparling,2 Ann Louise Olson,3 William W. Winder,4 and G. Lynis Dohm2

1Department of Exercise and Sport Science, Human Performance Laboratory and 2Department of Physiology, Brody School of Medicine, East Carolina University, Greenville, North Carolina; 3Department of Biochemistry, The University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma; and 4Department of Physiology and Developmental Biology, Brigham Young University, Provo, Utah

Submitted 22 December 2004 ; accepted in final form 19 May 2005


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
As the primary glucose transporter in skeletal muscle, GLUT4 is an important factor in the regulation of blood glucose. We previously reported that stimulation of AMP-activated protein kinase (AMPK) with 5-aminoimidazole-4-carboxamide-1-{beta}-D-ribofuranoside (AICAR) increased GLUT4 expression in muscle. GLUT4 enhancer factor (GEF) and myocyte enhancer factor 2 (MEF2) have been shown to be important for normal GLUT4 expression because deletion or truncation of the consensus sequences on the promoter causes depressed GLUT4 mRNA expression. This led to the current study to investigate possible roles for GEF and MEF2 in mediating the activation of GLUT4 gene transcription in response to AMPK. Here we show that, although AMPK does not appear to phosphorylate MEF2A, AMPK directly phosphorylates the GEF protein in vitro. MEF2 and GEF are activated in response to AMPK as we observed translocation of both to the nucleus after AICAR treatment. Nuclear MEF2 protein content was increased after 2 h, and GEF protein was increased in the nucleus 1 and 2 h post-AICAR treatment. Last, GEF and MEF2 increase in binding to the GLUT4 promoter within 2 h after AICAR treatment. Thus we conclude that GEF and MEF2 mediate the AMPK-induced increase in transcription of skeletal muscle GLUT4. AMPK can phosphorylate GEF and in response to AICAR, GEF, and MEF2 translocate to the nucleus and have increased binding to the GLUT4 promoter.

5-aminoimidazole-4-carboxamide-1-{beta}-D-ribofuranoside; glutathione S-transferase; glucose transporter 4


AS THE PRIMARY GLUCOSE TRANSPORTER in skeletal muscle, GLUT4 is an important factor in the regulation of blood glucose (3, 6, 17). Previous research from our laboratory has shown an increase in skeletal muscle GLUT4 mRNA expression and protein levels due to activation of AMP-activated protein kinase (AMPK) after 5-aminoimidazole-4-carboxamide-1-{beta}-D-ribofuranoside (AICAR) treatment (23). Understanding the interactions between GLUT4 and AMPK is important in the effort to treat glucose insensitivity present in the obese and those suffering from diabetes. Olson and collaborators (10, 15, 19, 23) have shown that GLUT4 enhancer factor (GEF) and myocyte enhancer factor 2 (MEF2) are important transcription factors required for normal GLUT4 expression, which led to our current study to determine the possible role GEF and MEF2 play in regulating GLUT4 mRNA expression in response to AMPK activation.

MEF2 is a transcription factor with many functions, including embyrogenic development in the brain, heart, and skeletal muscle (13). It is also regulated by various factors, such as Ca2+ levels in the muscle and dephosphorylation by calcineurin (21). MEF2 contains a known nuclear localization sequence encompassing amino acids 472–507 in the primary sequence (22), indicating that MEF2 can be activated to translocate to the nucleus. More recent work indicates that MEF2 colocalizes to the nucleus with histone deacetylase 4 (1).

The MEF2 isoforms active in skeletal muscle are A, C, and D (11, 19), and, in fully developed skeletal muscle, MEF2 is necessary to increase GLUT4 mRNA expression (18, 19). In mobility shift assays, Thai et al. (19) have shown that, in vitro, translated MEF2A and MEF2C have the ability to carry out specific binding to the GLUT4 MEF2 binding sequence. Using constructs with the GLUT4 promoter and luciferase reporter, gene-specific regions were identified as necessary for GLUT4 expression. One of these regions, from –522 to –420 bp of the human GLUT4 promoter, contains an E-box and an MEF2 binding site (2). Mutations of the MEF2 binding site resulted in a nearly complete loss of reporter gene expression (2). Likewise, a mutation of the MEF2 binding site in the GLUT4 promoter region in C2C12 cells results in a loss of function and decreased GLUT4 mRNA expression (8). The results of these studies indicate that, while necessary, MEF2 is not sufficient for normal GLUT4 expression (19).

In a follow up to their previous work, Oshel et al. (15) identified a 30-bp regulatory element they named Domain I, located upstream of the MEF2 binding site at –742 to –712 bp upstream from the initiation site of the human GLUT4 promoter. They cloned the protein that binds to Domain I and named it GEF (15). GEF consists of an 1,100-bp gene that encodes a 50-kDa peptide. GEF binds specifically to Domain I and could be competed by an unlabeled wild-type oligonucleotide. The cDNA sequence also contains a nuclear localization sequence indicating that it can be localized to the nucleus. Deletion or mutation of the Domain I binding site results in a decrease in gene expression or inhibits complex formation, respectively (15). This indicates that the Domain I regulatory element and the GEF protein are necessary for normal GLUT4 mRNA expression. Therefore, both MEF2 and GEF protein binding are necessary for normal GLUT4 mRNA expression (15).

Our current studies focus on the role these transcription factors play in regulation of GLUT4 transcription. We hypothesize that AMPK regulates GLUT4 mRNA expression, either directly or through cofactors, by acting on MEF2 and GEF to cause them to move to the nucleus and bind to the GLUT4 promoter. Herein, we describe some of the direct effects of AMPK activation on MEF2 and GEF activity. Specifically, we measured phosphorylation of GEF and MEF2A, translocation to the nucleus, and DNA binding activity of MEF2 and GEF to the GLUT4 promoter.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study consisted of two experiments. In the first experiment, the phosphorylation of recombinant MEF2A and GEF by purified AMPK was investigated. In the second experiment, rats were injected with AICAR, and animals were killed 1, 2, 5, and 12 h later. Muscle was harvested, nuclei were isolated, and the protein content of MEF2 and GEF, as well as their binding to DNA sequences of the human GLUT4 promoter, were determined.

Animal care and housing. All procedures were approved by the Institutional Animal Care and Use Committee of East Carolina University. Animals were injected with AICAR (0.5 mg/g body wt; Toronto Research Chemicals, North York, ON, Canada), and the gastrocnemius plantaris muscle group was removed at 1, 2, 5, and 12 h postinjection. Control groups were injected with saline (0.9% sterile saline, 0.1 ml/100 g body wt).

Phosphorylation assays. The phosphorylation procedure was a modification of the protocol described by Winder and Hardie (20). Briefly, recombinant GEF and MEF2A were incubated with purified AMPK and radioactive ATP (20), and phosphorylation status was measured. Acetyl-CoA carboxylase (ACC) isolated from rat liver was used as a positive control for AMPK activity and phosphorylation. Samples were then loaded on a 4–20% Tris·HCl ready gel (Bio-Rad, Hercules, CA) and separated by electrophoresis for 60 min at 200 V. Phosphorylation status was then determined by placing the gel on the PhosphorImager (Molecular Dynamics/Amersham, Piscataway, NJ) and reading the gels using ImageQuant (Molecular Dynamics/Amersham) software.

Real-time quantitative PCR. Real-time quantitative (RTQ)-PCR was used to analyze whole muscle samples from the AICAR-treated time course animals, according to the protocol described previously (12). Expression levels of GLUT4 mRNA were compared from whole muscle between control and AICAR-treated rats. RNA samples were normalized for comparison by determining 18S rRNA levels by RTQ-PCR.

Fusion protein purification. Glutathione S-transferase (GST)-tagged GEF fusion protein and His6-tagged MEF2 fusion protein expressed in Escherichia coli (7) were purified using modified techniques described by Amersham Bioscience and Qiagen (Valencia, CA), respectively. The GST alone was also isolated from E. coli for the phosphorylation studies.

Nuclei isolation. Whole gastrocnemius muscle was removed from AICAR-treated and control animals. Muscle was pressed through a perforated plate tissue press (EDCO Scientific, Chapel Hill, NC), and 300–400 mg of muscle were weighed out for immediate nuclear isolation by the method developed by Pilegaard et al. (16). Samples were stored at –80°C until analysis.

Western immunoblot. Muscle samples and nuclei isolated from rats killed 1, 2, 5, and 12 h after AICAR injection were analyzed for AMPK, GEF, and MEF2 protein content. Muscle samples that were previously frozen in liquid nitrogen were ground to powder under liquid nitrogen and homogenized with glass on glass in buffer. After homogenization, 10% Triton X-100 (Sigma, St. Louis, MO) was added to each sample (final concentration 1% Triton X-100), and they were homogenized again in the same glass tubes. Protein concentration was determined for each sample by the BCA protein assay (Pierce, Rockford, IL). Protein from the homogenate samples and nuclei were separated by SDS-PAGE using 12% and 4–15% Criterion resolving gels (Tris·HCl ready gels; Bio-Rad). Proteins were transferred from the gel to a polyvinylidene difluoride membrane at 100 V for 120 min. The membranes were blocked with 5% milk Tris-buffered saline-Tween 20 (TBS-T) for 30 min. Membranes were incubated overnight with primary antibody in 5% milk in TBS-T. Primary antibody for MEF2 and ACC was purchased from Santa Cruz and Upstate, respectively. Primary antibody for the GST-GEF fusion protein was isolated and purified from rabbit serum by protein-G affinity chromatography (15). After four 5-min washes in TBS-T, membranes were exposed to horseradish peroxidase-conjugated donkey anti-rabbit IgG (Amersham Biosciences) at 1:10,000 dilution in 5% milk TBS-T for 1 h at room temperature. After being washed two times with TBS-T and two times with TBS, the membranes were incubated with SuperSignal West Pico Chemiluminescent Substrate (Pierce) and then visualized on Super RX, Fuji Medical X-Ray Film (Fuji Photo Film, Tokyo, Japan). Relative amounts of each protein were then quantified by using an Epson Perfection 3200 scanner (Epson, Long Beach, CA) and Gel-Pro Analyzer 4.0 (Media Cybernetics, Silver Spring, MD). Total intensity of bands of each membrane was averaged, and the relative intensity of each blot was calculated as a percentage of the average of all blots.

Electrophoretic mobility shift assays. Electrophoretic mobility shift assays (EMSA) were performed as described previously (15). Briefly, oligonucleotides containing the Domain I, GEF binding site (CTTGTCCCTCGGACCGGCTCCAGGAACCAA), and the complimentary strand were custom synthesized (Sigma) and end labeled with T4 polynucleotide kinase. Dried gels were placed on a PhosphorImager (Molecular Dynamics/Amersham) overnight, and quantification was made using Gel-Pro Analyzer 4.0 (Media Cybernetics).

DNA-binding assay. Nuclear extracts from the AICAR-treated rat gastrocnemius were used to determine changes in MEF2 binding to the DNA binding site using the TransAM DNA-binding assay for MEF2 (Active Motif, Carlsbad, CA). After nuclear isolation, as described above, the samples were treated as outlined in the Active Motif protocol.

Statistical analysis. Mean differences from each experiment were analyzed by ANOVA, applying Tukey’s post hoc test when significance was found. Statistical significance was set at P ≤ 0.05.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The first objective of this study was to determine if AMPK can directly phosphorylate MEF2A and GEF. As a positive control, we used ACC phosphorylation by AMPK (Fig. 1). MEF2A was not directly phosphorylated by in vitro treatment with AMPK or AMPK + AMP (Fig. 1A). However, using the same in vitro phosphorylation assays, we have found that AMPK directly phosphorylates GEF in the presence of AMPK, AMP, and [{gamma}-32P]ATP (Fig. 1). GST, the fusion protein used for GEF isolation, was also examined for in vitro phosphorylation and was not phosphorylated (unpublished data). Western blots show that the phosphorylation is not the result of increased protein in the lane (not shown).



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 1. Phosphorylation of GLUT4 enhancer factor (GEF) by AMP-activated protein kinase (AMPK). Liver acetyl-CoA carboxylase (ACC) and recombinant GEF and myocyte enhancer factor (MEF)2A were incubated under the following 3 conditions: control, AMPK, and AMPK + AMP. These gels are representative of 3 experiments.

 
We previously reported that AICAR treatment increased muscle GLUT4 protein and mRNA (23). In this study, we confirm that, 5 and 12 h after AICAR treatment, GLUT4 mRNA is elevated above control (Fig. 2). As an indication of AMPK activity, we measured phospho-ACC levels in whole muscle homogenate and found phospho-ACC increases twofold at 1 h post-AICAR treatment (Fig. 3A). Because AMPK can be translocated to the nucleus, nuclear phospho-AMPK (pAMPK) protein was measured by Western blot analysis and found to be significantly increased with AICAR treatment compared with saline-treated controls. Nuclear phospho-AMPK was increased at 5 h post-AICAR treatment compared with saline-treated controls (Fig. 3B).



View larger version (7K):
[in this window]
[in a new window]
 
Fig. 2. Time course for upregulation of GLUT4 mRNA in rat skeletal muscle with 5-aminoimidazole-4-carboxamide-1-{beta}-D-ribofuranoside (AICAR) treatment. Rats were AICAR injected and killed at various times. The gastrocnemius-plantaris muscle group was homogenized, and GLUT4 values were measured by real-time quantitative PCR (RTQ-PCR) for GLUT4 mRNA and graphed relative to control; n = 5 animals for all groups. *P = 0.026 and {dagger}P = 0.015 vs. control.

 


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3. A: total phospho-ACC (pACC) protein levels. Rats were AICAR injected and killed at various times. The gastrocnemius-plantaris muscle group was homogenized, and pACC was determined by Western blot; n = 6 for all groups. C, control. *P = 0.04. B: phospho-AMPK (pAMPK) translocation to the nucleus. Rats were AICAR injected and killed at various times. The gastrocnemius-plantaris muscle group was homogenized, and pAMPK was determined by Western blot; n = 6 for all groups. *P = 0.01.

 
Nuclear GEF protein levels were measured by Western blot as an indication of nuclear translocation. Nuclear GEF was significantly increased 1 h (P = 0.024) and 2 h (P = 0.032) post-AICAR treatment compared with saline-treated controls (Fig. 4; n = 6 for all groups). There is no change in whole muscle GEF protein levels (not shown). To investigate the possible activation of MEF2 by AMPK, we measured changes in protein content in the nucleus as an indication of translocation to the nucleus. Translocation of MEF2 to the nucleus was determined by Western blot analysis (Fig. 5A) to be significantly increased at 2 h post-AICAR treatment compared with saline-treated controls (P = 0.036). These data are representative of two identical experiments showing the same results. The MEF2 antibody purchased from Santa Cruz was raised against a peptide mapping at the carboxy terminus of MEF2A of human origin. It reacts with MEF2A and, to a lesser extent, MEF2C and -D. The predominant isoform in skeletal muscle is MEF2A, but MEF2C and -D are present as well (11). Therefore, these results indicate that the MEF2 isoforms in skeletal muscle are being translocated to the nucleus with AMPK activation, but the results do not discriminate between isoforms. Whole cell MEF2 protein content in these samples was significantly increased at 2 h as well, although the relative increase was not as great as the relative increase in nuclei of the AICAR-treated animals (Fig. 5B).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4. GEF protein in nuclei and whole homogenate. Rats were AICAR or saline injected and killed at various times, and nuclei were isolated for Western blot analysis of GEF. *P = 0.024 and {dagger}P = 0.032.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. MEF2 protein in nuclei and whole homogenate. Animals were injected with 0.5 mg/g body wt AICAR, and gastrocnemius was taken at 1, 2, and 5 h postinjection. Controls were saline injected with an equal volume of 0.9% saline solution. A: MEF2 protein translocation to the nucleus in rat skeletal muscle treated with AICAR and measured at various time points. MEF2 in the nucleus is significantly increased over control values at 2 h posttreatment. *P = 0.036. B: MEF2 protein in whole muscle homogenates at times post-AICAR treatment; n = 6 for all groups. *P = 0.011.

 
Because transcriptional activation of GLUT4 by GEF and MEF2 involves binding to DNA and translocation to the nucleus, binding of these proteins to the consensus sequences of the human GLUT4 promoter was investigated. Changes in GEF binding to the Domain I consensus sequence of human GLUT4 promoter was measured by EMSA. A twofold increase in GEF binding was seen at 1 h (P = 0.007) and 2 h (P = 0.018) post-AICAR treatment but not at 5 h posttreatment (n = 6 for all groups; Fig. 6).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 6. GEF binding to DNA after AICAR treatment measured by EMSA in rat skeletal muscle. A: time course for GEF binding to DNA. A 2-fold increase was seen at 1 h (P = 0.007) and 2 h (P = 0.018) post-AICAR treatment. B: representative blot of control and 1 h, with increasing concentrations of cold competitor (n = 6 for all groups).

 
MEF2 binding at the MEF2 consensus sequence was measured using the TransAM DNA binding kit. MEF2 binding to DNA was increased twofold (P = 0.005) at 2 h post-AICAR treatment. There was no significant difference at 1 and 5 h posttreatment (Fig. 7; n = 6 for all groups).



View larger version (7K):
[in this window]
[in a new window]
 
Fig. 7. MEF2 protein binding to MEF2 DNA binding site after AICAR treatment. DNA binding was measured in nuclear extracts by the TransAM Assay (ACTIV MOTIF). At 2 h posttreatment, the increase in binding is highly significant compared with controls; n = 6 for all groups. *P = 0.005.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The purpose of the current study was to better understand the links between AMPK activation and regulation of GLUT4 expression through activation of the transcription factors GEF and MEF2. We previously reported that GLUT4 mRNA increases with exercise and AICAR treatment and that GLUT4 protein increases after 5 days of AICAR treatment or 7–10 days of exercise in humans (4, 5, 9, 10, 23). MEF2 and GEF were implicated in the regulation of GLUT4 mRNA expression because the truncation or deletion of the binding sequence for either of these transcription factors on the GLUT4 promoter region decreases GLUT4 mRNA expression (15, 19), and the exercise or AICAR responses are lost when the GEF or MEF2 promoter binding sites are altered (10, 23). Because AMPK has been implicated as being important in the regulation of GLUT4 mRNA expression, this study was designed to better understand the regulation of GEF and MEF2 by AMPK.

There are at least three ways that transcription factors can be regulated. First, the transcription factor can be phosphorylated, causing it to translocate to the nucleus, where it binds to the appropriate promoter to initiate transcription. The possibility of phosphorylation in the nucleus and increased DNA binding also exists. Second, increased expression of a transcription factor also increases the probability of nuclear translocation with subsequent regulation of the target gene. Third, binding of the transcription factor with coactivators to increase translocation to the nucleus and/or increase binding to the target promoter to enhance gene expression has been demonstrated. We have endeavored to investigate these three possibilities in the regulation of GEF and MEF2 by AMPK.

Are GEF and MEF2 substrates for AMPK? This was the first question that we investigated. The results show that GEF is phosphorylated in vitro by AMPK with the addition of AMP. Nuclear GEF protein levels increase in skeletal muscle with AICAR treatment, suggesting GEF may be phosphorylated and translocate to the nucleus. GEF has a known nuclear localization sequence (15), making translocation to the nucleus after phosphorylation a possible mechanism for GEF regulation. The nuclear GEF content increases at 1 and 2 h posttreatment, and GEF binding increases as well. These data support the previous findings that GEF is necessary for increased GLUT4 mRNA expression.

MEF2 was not directly phosphorylated in our in vitro system. This suggests it is not a direct substrate for AMPK, but we cannot rule out the possibility that MEF2 is indirectly phosphorylated by another kinase that is activated by AMPK. A second possibility exists that a coactivator is phosphorylated, increasing its binding to MEF2 with subsequent translocation to the nucleus.

The significant increase in total MEF2 protein is of interest. This indicates that AMPK activation could lead to increased MEF2 mRNA and protein content in skeletal muscle. The total muscle protein increases roughly twofold with AICAR treatment, and nuclear protein increased fivefold, indicating the increase in nuclear MEF2 is not simply because of increases in total protein. The twofold increase in MEF2 binding to the consensus sequence 2 h post-AICAR treatment fits with the timeline shown for translocation, and increased DNA binding to the promoter suggests MEF plays a role in GLUT4 mRNA expression.

As suggested, GEF and MEF2 may be activated in the cytosol and translocate to the nucleus, or AMPK, after activation, may translocate to the nucleus where it then activates GEF through phosphorylation. ACC is a cytosolic protein and a known target of AMPK. Phospho-ACC protein levels increased twofold at 1 h post-AICAR injection, indicating that AMPK is active in the cytosol within 1 h post-AICAR treatment. The data showing an increase in phospho-AMPK at 5 h post-AICAR treatment, combined with the GEF phosphorylation, translocation, and binding within 1 h, suggest that activation of GEF is in the cytosol. Further support comes from previous findings from our laboratory showing an increase in GLUT4 gene transcription 3 h after an acute exercise bout (14) in rats. The increase in nuclear phospho-AMPK at 5 h may be a secondary response to AICAR treatment. On the basis of the time course of activation of AMPK in the cytosol (Fig. 3) at 1 h and the delayed increase of AMPK in the nucleus at 5 h (Fig. 4), we propose that AMPK phosphorylates GEF in the cytosol. GEF is then translocated to the nucleus with a maximum at 1 h.

When we consider the graphs in Fig. 8, A and B, there is a striking pattern. The increase in MEF2 translocation and binding to the GLUT4 promoter is preceded by the GEF response to AICAR treatment. This suggests that GEF, after phosphorylation and activation, may be recruiting MEF2 to the nucleus. This conclusion is supported by recent findings from the laboratory of Knight et al. (7) that MEF2A and GEF can associate and together regulate GLUT4 transcription. GEF and MEF2 coimmunoprecipitate in vitro and in vivo, and both must bind to their binding sites on the GLUT4 promoter region for activation of GLUT4 mRNA expression. Binding of only GEF or MEF2A alone does not significantly increase activity, whereas binding of both increases promoter activity over fourfold (7). Here, we report that AMPK can directly phosphorylate GEF, which in turn may lead to translocation to the nucleus and increased coactivation of MEF2 in DNA binding at the GLUT4 promoter region.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8. Composite graphs showing changes in nuclear GEF and MEF2 (A) and changes in DNA binding at the GEF and MEF2 binding sites (B), respectively.

 
In summary, we have demonstrated that GEF is a substrate for AMPK. In addition, GEF and MEF2 protein increased in the nucleus at 2 h after AICAR treatment, suggesting an increase in translocation to the nucleus after AMPK activation. Both GEF and MEF2 have twofold increases in DNA binding by 2 h posttreatment. Together with previously established results on GLUT4 mRNA regulation by GEF and MEF2, this work further elucidates the pathway regulating GLUT4 mRNA expression and protein levels in skeletal muscle with AMPK activation.


    FOOTNOTES
 

Address for reprint requests and other correspondence: B. F. Holmes, Dept. of Biochemistry and Molecular Physics, Univ. of Arizona, Tucson, AZ 85721 (e-mail: bfh0530{at}arizona.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Borghi S, Molinari S, Razzini G, Parise F, Battini R, and Ferrari S. The nuclear localization domain of the MEF2 family of transcription factors shows member-specific features and mediates the nuclear import of histone deacetylase 4. J Cell Sci 114: 4477–4483, 2001.[Web of Science][Medline]
  2. Ezaki O. Regulatory elements in the insulin-responsive glucose transporter (GLUT4) gene. Biochem Biophys Res Commun 241: 1–6, 1997.[CrossRef][Web of Science][Medline]
  3. Gibbs EM, Stock JL, McCoid SC, Stukenbrok HA, Pessin JE, Stevenson RW, Milici AJ, and McNeish JD. Glycemic improvement in diabetic db/db mice by overexpression of the human insulin-regulatable glucose transporter (GLUT4). J Clin Invest 95: 1512–1518, 1995.[Web of Science][Medline]
  4. Holmes BF, Kurth-Kraczek EJ, and Winder WW. Chronic activation of 5'-AMP-activated protein kinase increases GLUT-4, hexokinase, and glycogen in muscle. J Appl Physiol 87: 1990–1995, 1999.[Abstract/Free Full Text]
  5. Houmard JA, Hickey MS, Tyndall GL, Gavigan KE, and Dohm GL. Seven days of exercise increase GLUT-4 protein content in human skeletal muscle. J Appl Physiol 79: 1936–1938, 1995.[Abstract/Free Full Text]
  6. Jessen N, Pold R, Buhl ES, Jensen LS, Schmitz O, and Lund S. Effects of AICAR and exercise on insulin-stimulated glucose uptake, insulin signaling and GLUT4 content in rat skeletal muscles. J Appl Physiol 237: 1373–1379, 2002.
  7. Knight JB, Eyster CA, Griesel BA, and Olson AL. Regulation of the human GLUT4 gene promoter: interaction between a transcriptional activator and myocyte enhancer factor 2A. Proc Natl Acad Sci USA 100: 14725–14730, 2003.[Abstract/Free Full Text]
  8. Liu ML, Olson AL, Edgington NP, Moye-Rowley WS, and Pessin JE. Myocyte enhancer factor 2 (MEF2) binding site is essential for C2C12 myotube-specific expression of the rat GLUT4/muscle-adipose facilitative glucose transporter gene. J Biol Chem 269: 28514–28521, 1994.[Abstract/Free Full Text]
  9. MacLean PS, Zheng D, and Dohm GL. Muscle glucose transporter (GLUT 4) gene expression during exercise. Exerc Sport Sci Rev 28: 148–152, 2000.[Medline]
  10. MacLean PS, Zheng D, Jones JP, Olson AL, and Dohm GL. Exercise-induced transcription of the muscle glucose transporter (GLUT 4) gene. Biochem Biophys Res Commun 292: 409–414, 2002.[CrossRef][Web of Science][Medline]
  11. Mora S and Pessin JE. The MEF2A isoform is required for striated muscle-specific expression of the insulin-responsive GLUT4 glucose transporter. J Biol Chem 275: 16323–16328, 2000.[Abstract/Free Full Text]
  12. Muoio DM, Way JM, Tanner CJ, Winegar DA, Kliewer SA, Houmard JA, Kraus WE, and Dohm GL. Peroxisome proliferator-activated receptor-alpha regulates fatty acid utilization in primary human skeletal muscle cells. Diabetes 51: 901–909, 2002.[Abstract/Free Full Text]
  13. Naya FJ, Wu C, Richardson JA, Overbeek P, and Olson EN. Transcriptional activity of MEF2 during mouse embryogenesis monitored with a MEF2-dependent transgene. Development 126: 2045–2052, 1999.[Abstract]
  14. Neufer PD and Dohm GL. Exercise induces a transient increase in transcription of the GLUT-4 gene in skeletal muscle. Am J Physiol Cell Physiol 265: C1597–C1603, 1993.[Abstract/Free Full Text]
  15. Oshel KM, Knight JB, Cao KT, Thai MV, and Olson AL. Identification of a 30-base pair regulatory element and novel DNA binding protein that regulates the human GLUT4 promoter in transgenic mice. J Biol Chem 275: 23666–23673, 2000.[Abstract/Free Full Text]
  16. Pilegaard H, Ordway GA, Saltin B, and Neufer PD. Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise. Am J Physiol Endocrinol Metab 279: E806–E814, 2000.[Abstract/Free Full Text]
  17. Richter EA, Wojtaszewski JF, Kristiansen S, Daugaard JR, Nielsen JN, Derave W, and Kiens B. Regulation of muscle glucose transport during exercise. Int J Sport Nutr Exerc Metab Suppl 11: S71–S77, 2001.
  18. Santalucia T, Moreno H, Palacin M, Yacoub MH, Brand NJ, and Zorzano A. A novel functional co-operation between MyoD, MEF2 and TRalpha1 is sufficient for the induction of GLUT4 gene transcription. J Mol Biol 314: 195–204, 2001.[CrossRef][Web of Science][Medline]
  19. Thai MV, Guruswamy S, Cao KT, Pessin JE, and Olson AL. Myocyte enhancer factor 2 (MEF2)-binding site is required for GLUT4 gene expression in transgenic mice. Regulation of MEF2 DNA binding activity in insulin-deficient diabetes. J Biol Chem 273: 14285–14292, 1998.[Abstract/Free Full Text]
  20. Winder WW and Hardie DG. Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise. Am J Physiol Endocrinol Metab 270: E299–E304, 1996.[Abstract/Free Full Text]
  21. Wu H, Rothermel B, Kanatous S, Rosenberg P, Naya FJ, Shelton JM, Hutcheson KA, DiMaio JM, Olson EN, Bassel-Duby R, and Williams RS. Activation of MEF2 by muscle activity is mediated through a calcineurin-dependent pathway. EMBO J 20: 6414–6423, 2001.[CrossRef][Web of Science][Medline]
  22. Yu YT. Distinct domains of myocyte enhancer binding factor-2A determining nuclear localization and cell type-specific transcriptional activity. J Biol Chem 271: 24675–24683, 1996.[Abstract/Free Full Text]
  23. Zheng D, MacLean PS, Pohnert SC, Knight JB, Olson AL, Winder WW, and Dohm GL. Regulation of muscle GLUT-4 transcription by AMP-activated protein kinase. J Appl Physiol 91: 1073–1083, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. F. Ndisang, N. Lane, and A. Jadhav
Upregulation of the heme oxygenase system ameliorates postprandial and fasting hyperglycemia in type 2 diabetes
Am J Physiol Endocrinol Metab, May 1, 2009; 296(5): E1029 - E1041.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. F. Ndisang and A. Jadhav
Heme oxygenase system enhances insulin sensitivity and glucose metabolism in streptozotocin-induced diabetes
Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E829 - E841.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Akki and A.-M. L. Seymour
Western diet impairs metabolic remodelling and contractile efficiency in cardiac hypertrophy
Cardiovasc Res, February 15, 2009; 81(3): 610 - 617.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
G. A. Lima, G. F. Anhe, G. Giannocco, M. T. Nunes, M. L. Correa-Giannella, and U. F. Machado
Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR{alpha} transcriptional factors
Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E132 - E138.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L. Feng, L. Gao, Q. Guan, X. Hou, Q. Wan, X. Wang, and J. Zhao
Long-term moderate ethanol consumption restores insulin sensitivity in high-fat-fed rats by increasing SLC2A4 (GLUT4) in the adipose tissue by AMP-activated protein kinase activation
J. Endocrinol., October 1, 2008; 199(1): 95 - 104.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Y. C. Long and J. R. Zierath
Influence of AMP-activated protein kinase and calcineurin on metabolic networks in skeletal muscle
Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E545 - E552.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. A. H. Smith, T. A. Kohn, A. K. Chetty, and E. O. Ojuka
CaMK activation during exercise is required for histone hyperacetylation and MEF2A binding at the MEF2 site on the Glut4 gene
Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E698 - E704.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. L. McGee, B. J.W. van Denderen, K. F. Howlett, J. Mollica, J. D. Schertzer, B. E. Kemp, and M. Hargreaves
AMP-Activated Protein Kinase Regulates GLUT4 Transcription by Phosphorylating Histone Deacetylase 5
Diabetes, April 1, 2008; 57(4): 860 - 867.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
D. M. Thomson, S. T. Herway, N. Fillmore, H. Kim, J. D. Brown, J. R. Barrow, and W. W. Winder
AMP-activated protein kinase phosphorylates transcription factors of the CREB family
J Appl Physiol, February 1, 2008; 104(2): 429 - 438.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. D. Mason, H. Rundqvist, I. Papandreou, R. Duh, W. J. McNulty, R. A. Howlett, I. M. Olfert, C. J. Sundberg, N. C. Denko, L. Poellinger, et al.
HIF-1{alpha} in endurance training: suppression of oxidative metabolism
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2059 - R2069.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. J. Krawiec, G. J. Nystrom, R. A. Frost, L. S. Jefferson, and C. H. Lang
AMP-activated protein kinase agonists increase mRNA content of the muscle-specific ubiquitin ligases MAFbx and MuRF1 in C2C12 cells
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1555 - E1567.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. A. H. Smith, M. Collins, L. A. Grobler, C. J. Magee, and E. O. Ojuka
Exercise and CaMK activation both increase the binding of MEF2A to the Glut4 promoter in skeletal muscle in vivo
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E413 - E420.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. M. Thomson, B. B. Porter, J. H. Tall, H-J. Kim, J. R. Barrow, and W. W. Winder
Skeletal muscle and heart LKB1 deficiency causes decreased voluntary running and reduced muscle mitochondrial marker enzyme expression in mice
Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E196 - E202.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
D. G. Hardie and K. Sakamoto
AMPK: A Key Sensor of Fuel and Energy Status in Skeletal Muscle
Physiology, February 1, 2006; 21(1): 48 - 60.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/6/E1071    most recent
00606.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (32)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holmes, B. F.
Right arrow Articles by Dohm, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holmes, B. F.
Right arrow Articles by Dohm, G. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.