|
|
||||||||
1Department of Exercise and Sport Science, Human Performance Laboratory and 2Department of Physiology, Brody School of Medicine, East Carolina University, Greenville, North Carolina; 3Department of Biochemistry, The University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma; and 4Department of Physiology and Developmental Biology, Brigham Young University, Provo, Utah
Submitted 22 December 2004 ; accepted in final form 19 May 2005
| ABSTRACT |
|---|
|
|
|---|
-D-ribofuranoside (AICAR) increased GLUT4 expression in muscle. GLUT4 enhancer factor (GEF) and myocyte enhancer factor 2 (MEF2) have been shown to be important for normal GLUT4 expression because deletion or truncation of the consensus sequences on the promoter causes depressed GLUT4 mRNA expression. This led to the current study to investigate possible roles for GEF and MEF2 in mediating the activation of GLUT4 gene transcription in response to AMPK. Here we show that, although AMPK does not appear to phosphorylate MEF2A, AMPK directly phosphorylates the GEF protein in vitro. MEF2 and GEF are activated in response to AMPK as we observed translocation of both to the nucleus after AICAR treatment. Nuclear MEF2 protein content was increased after 2 h, and GEF protein was increased in the nucleus 1 and 2 h post-AICAR treatment. Last, GEF and MEF2 increase in binding to the GLUT4 promoter within 2 h after AICAR treatment. Thus we conclude that GEF and MEF2 mediate the AMPK-induced increase in transcription of skeletal muscle GLUT4. AMPK can phosphorylate GEF and in response to AICAR, GEF, and MEF2 translocate to the nucleus and have increased binding to the GLUT4 promoter.
5-aminoimidazole-4-carboxamide-1-
-D-ribofuranoside; glutathione S-transferase; glucose transporter 4
-D-ribofuranoside (AICAR) treatment (23). Understanding the interactions between GLUT4 and AMPK is important in the effort to treat glucose insensitivity present in the obese and those suffering from diabetes. Olson and collaborators (10, 15, 19, 23) have shown that GLUT4 enhancer factor (GEF) and myocyte enhancer factor 2 (MEF2) are important transcription factors required for normal GLUT4 expression, which led to our current study to determine the possible role GEF and MEF2 play in regulating GLUT4 mRNA expression in response to AMPK activation. MEF2 is a transcription factor with many functions, including embyrogenic development in the brain, heart, and skeletal muscle (13). It is also regulated by various factors, such as Ca2+ levels in the muscle and dephosphorylation by calcineurin (21). MEF2 contains a known nuclear localization sequence encompassing amino acids 472507 in the primary sequence (22), indicating that MEF2 can be activated to translocate to the nucleus. More recent work indicates that MEF2 colocalizes to the nucleus with histone deacetylase 4 (1).
The MEF2 isoforms active in skeletal muscle are A, C, and D (11, 19), and, in fully developed skeletal muscle, MEF2 is necessary to increase GLUT4 mRNA expression (18, 19). In mobility shift assays, Thai et al. (19) have shown that, in vitro, translated MEF2A and MEF2C have the ability to carry out specific binding to the GLUT4 MEF2 binding sequence. Using constructs with the GLUT4 promoter and luciferase reporter, gene-specific regions were identified as necessary for GLUT4 expression. One of these regions, from 522 to 420 bp of the human GLUT4 promoter, contains an E-box and an MEF2 binding site (2). Mutations of the MEF2 binding site resulted in a nearly complete loss of reporter gene expression (2). Likewise, a mutation of the MEF2 binding site in the GLUT4 promoter region in C2C12 cells results in a loss of function and decreased GLUT4 mRNA expression (8). The results of these studies indicate that, while necessary, MEF2 is not sufficient for normal GLUT4 expression (19).
In a follow up to their previous work, Oshel et al. (15) identified a 30-bp regulatory element they named Domain I, located upstream of the MEF2 binding site at 742 to 712 bp upstream from the initiation site of the human GLUT4 promoter. They cloned the protein that binds to Domain I and named it GEF (15). GEF consists of an 1,100-bp gene that encodes a 50-kDa peptide. GEF binds specifically to Domain I and could be competed by an unlabeled wild-type oligonucleotide. The cDNA sequence also contains a nuclear localization sequence indicating that it can be localized to the nucleus. Deletion or mutation of the Domain I binding site results in a decrease in gene expression or inhibits complex formation, respectively (15). This indicates that the Domain I regulatory element and the GEF protein are necessary for normal GLUT4 mRNA expression. Therefore, both MEF2 and GEF protein binding are necessary for normal GLUT4 mRNA expression (15).
Our current studies focus on the role these transcription factors play in regulation of GLUT4 transcription. We hypothesize that AMPK regulates GLUT4 mRNA expression, either directly or through cofactors, by acting on MEF2 and GEF to cause them to move to the nucleus and bind to the GLUT4 promoter. Herein, we describe some of the direct effects of AMPK activation on MEF2 and GEF activity. Specifically, we measured phosphorylation of GEF and MEF2A, translocation to the nucleus, and DNA binding activity of MEF2 and GEF to the GLUT4 promoter.
| METHODS |
|---|
|
|
|---|
Animal care and housing. All procedures were approved by the Institutional Animal Care and Use Committee of East Carolina University. Animals were injected with AICAR (0.5 mg/g body wt; Toronto Research Chemicals, North York, ON, Canada), and the gastrocnemius plantaris muscle group was removed at 1, 2, 5, and 12 h postinjection. Control groups were injected with saline (0.9% sterile saline, 0.1 ml/100 g body wt).
Phosphorylation assays. The phosphorylation procedure was a modification of the protocol described by Winder and Hardie (20). Briefly, recombinant GEF and MEF2A were incubated with purified AMPK and radioactive ATP (20), and phosphorylation status was measured. Acetyl-CoA carboxylase (ACC) isolated from rat liver was used as a positive control for AMPK activity and phosphorylation. Samples were then loaded on a 420% Tris·HCl ready gel (Bio-Rad, Hercules, CA) and separated by electrophoresis for 60 min at 200 V. Phosphorylation status was then determined by placing the gel on the PhosphorImager (Molecular Dynamics/Amersham, Piscataway, NJ) and reading the gels using ImageQuant (Molecular Dynamics/Amersham) software.
Real-time quantitative PCR. Real-time quantitative (RTQ)-PCR was used to analyze whole muscle samples from the AICAR-treated time course animals, according to the protocol described previously (12). Expression levels of GLUT4 mRNA were compared from whole muscle between control and AICAR-treated rats. RNA samples were normalized for comparison by determining 18S rRNA levels by RTQ-PCR.
Fusion protein purification. Glutathione S-transferase (GST)-tagged GEF fusion protein and His6-tagged MEF2 fusion protein expressed in Escherichia coli (7) were purified using modified techniques described by Amersham Bioscience and Qiagen (Valencia, CA), respectively. The GST alone was also isolated from E. coli for the phosphorylation studies.
Nuclei isolation. Whole gastrocnemius muscle was removed from AICAR-treated and control animals. Muscle was pressed through a perforated plate tissue press (EDCO Scientific, Chapel Hill, NC), and 300400 mg of muscle were weighed out for immediate nuclear isolation by the method developed by Pilegaard et al. (16). Samples were stored at 80°C until analysis.
Western immunoblot. Muscle samples and nuclei isolated from rats killed 1, 2, 5, and 12 h after AICAR injection were analyzed for AMPK, GEF, and MEF2 protein content. Muscle samples that were previously frozen in liquid nitrogen were ground to powder under liquid nitrogen and homogenized with glass on glass in buffer. After homogenization, 10% Triton X-100 (Sigma, St. Louis, MO) was added to each sample (final concentration 1% Triton X-100), and they were homogenized again in the same glass tubes. Protein concentration was determined for each sample by the BCA protein assay (Pierce, Rockford, IL). Protein from the homogenate samples and nuclei were separated by SDS-PAGE using 12% and 415% Criterion resolving gels (Tris·HCl ready gels; Bio-Rad). Proteins were transferred from the gel to a polyvinylidene difluoride membrane at 100 V for 120 min. The membranes were blocked with 5% milk Tris-buffered saline-Tween 20 (TBS-T) for 30 min. Membranes were incubated overnight with primary antibody in 5% milk in TBS-T. Primary antibody for MEF2 and ACC was purchased from Santa Cruz and Upstate, respectively. Primary antibody for the GST-GEF fusion protein was isolated and purified from rabbit serum by protein-G affinity chromatography (15). After four 5-min washes in TBS-T, membranes were exposed to horseradish peroxidase-conjugated donkey anti-rabbit IgG (Amersham Biosciences) at 1:10,000 dilution in 5% milk TBS-T for 1 h at room temperature. After being washed two times with TBS-T and two times with TBS, the membranes were incubated with SuperSignal West Pico Chemiluminescent Substrate (Pierce) and then visualized on Super RX, Fuji Medical X-Ray Film (Fuji Photo Film, Tokyo, Japan). Relative amounts of each protein were then quantified by using an Epson Perfection 3200 scanner (Epson, Long Beach, CA) and Gel-Pro Analyzer 4.0 (Media Cybernetics, Silver Spring, MD). Total intensity of bands of each membrane was averaged, and the relative intensity of each blot was calculated as a percentage of the average of all blots.
Electrophoretic mobility shift assays. Electrophoretic mobility shift assays (EMSA) were performed as described previously (15). Briefly, oligonucleotides containing the Domain I, GEF binding site (CTTGTCCCTCGGACCGGCTCCAGGAACCAA), and the complimentary strand were custom synthesized (Sigma) and end labeled with T4 polynucleotide kinase. Dried gels were placed on a PhosphorImager (Molecular Dynamics/Amersham) overnight, and quantification was made using Gel-Pro Analyzer 4.0 (Media Cybernetics).
DNA-binding assay. Nuclear extracts from the AICAR-treated rat gastrocnemius were used to determine changes in MEF2 binding to the DNA binding site using the TransAM DNA-binding assay for MEF2 (Active Motif, Carlsbad, CA). After nuclear isolation, as described above, the samples were treated as outlined in the Active Motif protocol.
Statistical analysis.
Mean differences from each experiment were analyzed by ANOVA, applying Tukeys post hoc test when significance was found. Statistical significance was set at P
0.05.
| RESULTS |
|---|
|
|
|---|
-32P]ATP (Fig. 1). GST, the fusion protein used for GEF isolation, was also examined for in vitro phosphorylation and was not phosphorylated (unpublished data). Western blots show that the phosphorylation is not the result of increased protein in the lane (not shown).
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
There are at least three ways that transcription factors can be regulated. First, the transcription factor can be phosphorylated, causing it to translocate to the nucleus, where it binds to the appropriate promoter to initiate transcription. The possibility of phosphorylation in the nucleus and increased DNA binding also exists. Second, increased expression of a transcription factor also increases the probability of nuclear translocation with subsequent regulation of the target gene. Third, binding of the transcription factor with coactivators to increase translocation to the nucleus and/or increase binding to the target promoter to enhance gene expression has been demonstrated. We have endeavored to investigate these three possibilities in the regulation of GEF and MEF2 by AMPK.
Are GEF and MEF2 substrates for AMPK? This was the first question that we investigated. The results show that GEF is phosphorylated in vitro by AMPK with the addition of AMP. Nuclear GEF protein levels increase in skeletal muscle with AICAR treatment, suggesting GEF may be phosphorylated and translocate to the nucleus. GEF has a known nuclear localization sequence (15), making translocation to the nucleus after phosphorylation a possible mechanism for GEF regulation. The nuclear GEF content increases at 1 and 2 h posttreatment, and GEF binding increases as well. These data support the previous findings that GEF is necessary for increased GLUT4 mRNA expression.
MEF2 was not directly phosphorylated in our in vitro system. This suggests it is not a direct substrate for AMPK, but we cannot rule out the possibility that MEF2 is indirectly phosphorylated by another kinase that is activated by AMPK. A second possibility exists that a coactivator is phosphorylated, increasing its binding to MEF2 with subsequent translocation to the nucleus.
The significant increase in total MEF2 protein is of interest. This indicates that AMPK activation could lead to increased MEF2 mRNA and protein content in skeletal muscle. The total muscle protein increases roughly twofold with AICAR treatment, and nuclear protein increased fivefold, indicating the increase in nuclear MEF2 is not simply because of increases in total protein. The twofold increase in MEF2 binding to the consensus sequence 2 h post-AICAR treatment fits with the timeline shown for translocation, and increased DNA binding to the promoter suggests MEF plays a role in GLUT4 mRNA expression.
As suggested, GEF and MEF2 may be activated in the cytosol and translocate to the nucleus, or AMPK, after activation, may translocate to the nucleus where it then activates GEF through phosphorylation. ACC is a cytosolic protein and a known target of AMPK. Phospho-ACC protein levels increased twofold at 1 h post-AICAR injection, indicating that AMPK is active in the cytosol within 1 h post-AICAR treatment. The data showing an increase in phospho-AMPK at 5 h post-AICAR treatment, combined with the GEF phosphorylation, translocation, and binding within 1 h, suggest that activation of GEF is in the cytosol. Further support comes from previous findings from our laboratory showing an increase in GLUT4 gene transcription 3 h after an acute exercise bout (14) in rats. The increase in nuclear phospho-AMPK at 5 h may be a secondary response to AICAR treatment. On the basis of the time course of activation of AMPK in the cytosol (Fig. 3) at 1 h and the delayed increase of AMPK in the nucleus at 5 h (Fig. 4), we propose that AMPK phosphorylates GEF in the cytosol. GEF is then translocated to the nucleus with a maximum at 1 h.
When we consider the graphs in Fig. 8, A and B, there is a striking pattern. The increase in MEF2 translocation and binding to the GLUT4 promoter is preceded by the GEF response to AICAR treatment. This suggests that GEF, after phosphorylation and activation, may be recruiting MEF2 to the nucleus. This conclusion is supported by recent findings from the laboratory of Knight et al. (7) that MEF2A and GEF can associate and together regulate GLUT4 transcription. GEF and MEF2 coimmunoprecipitate in vitro and in vivo, and both must bind to their binding sites on the GLUT4 promoter region for activation of GLUT4 mRNA expression. Binding of only GEF or MEF2A alone does not significantly increase activity, whereas binding of both increases promoter activity over fourfold (7). Here, we report that AMPK can directly phosphorylate GEF, which in turn may lead to translocation to the nucleus and increased coactivation of MEF2 in DNA binding at the GLUT4 promoter region.
|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. F. Ndisang, N. Lane, and A. Jadhav Upregulation of the heme oxygenase system ameliorates postprandial and fasting hyperglycemia in type 2 diabetes Am J Physiol Endocrinol Metab, May 1, 2009; 296(5): E1029 - E1041. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Ndisang and A. Jadhav Heme oxygenase system enhances insulin sensitivity and glucose metabolism in streptozotocin-induced diabetes Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E829 - E841. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Akki and A.-M. L. Seymour Western diet impairs metabolic remodelling and contractile efficiency in cardiac hypertrophy Cardiovasc Res, February 15, 2009; 81(3): 610 - 617. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Lima, G. F. Anhe, G. Giannocco, M. T. Nunes, M. L. Correa-Giannella, and U. F. Machado Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR{alpha} transcriptional factors Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E132 - E138. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Feng, L. Gao, Q. Guan, X. Hou, Q. Wan, X. Wang, and J. Zhao Long-term moderate ethanol consumption restores insulin sensitivity in high-fat-fed rats by increasing SLC2A4 (GLUT4) in the adipose tissue by AMP-activated protein kinase activation J. Endocrinol., October 1, 2008; 199(1): 95 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. C. Long and J. R. Zierath Influence of AMP-activated protein kinase and calcineurin on metabolic networks in skeletal muscle Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E545 - E552. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. H. Smith, T. A. Kohn, A. K. Chetty, and E. O. Ojuka CaMK activation during exercise is required for histone hyperacetylation and MEF2A binding at the MEF2 site on the Glut4 gene Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E698 - E704. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. McGee, B. J.W. van Denderen, K. F. Howlett, J. Mollica, J. D. Schertzer, B. E. Kemp, and M. Hargreaves AMP-Activated Protein Kinase Regulates GLUT4 Transcription by Phosphorylating Histone Deacetylase 5 Diabetes, April 1, 2008; 57(4): 860 - 867. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Thomson, S. T. Herway, N. Fillmore, H. Kim, J. D. Brown, J. R. Barrow, and W. W. Winder AMP-activated protein kinase phosphorylates transcription factors of the CREB family J Appl Physiol, February 1, 2008; 104(2): 429 - 438. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Mason, H. Rundqvist, I. Papandreou, R. Duh, W. J. McNulty, R. A. Howlett, I. M. Olfert, C. J. Sundberg, N. C. Denko, L. Poellinger, et al. HIF-1{alpha} in endurance training: suppression of oxidative metabolism Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2059 - R2069. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Krawiec, G. J. Nystrom, R. A. Frost, L. S. Jefferson, and C. H. Lang AMP-activated protein kinase agonists increase mRNA content of the muscle-specific ubiquitin ligases MAFbx and MuRF1 in C2C12 cells Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1555 - E1567. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. H. Smith, M. Collins, L. A. Grobler, C. J. Magee, and E. O. Ojuka Exercise and CaMK activation both increase the binding of MEF2A to the Glut4 promoter in skeletal muscle in vivo Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E413 - E420. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Thomson, B. B. Porter, J. H. Tall, H-J. Kim, J. R. Barrow, and W. W. Winder Skeletal muscle and heart LKB1 deficiency causes decreased voluntary running and reduced muscle mitochondrial marker enzyme expression in mice Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E196 - E202. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Hardie and K. Sakamoto AMPK: A Key Sensor of Fuel and Energy Status in Skeletal Muscle Physiology, February 1, 2006; 21(1): 48 - 60. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |