AJP - Endo Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 289: E658-E664, 2005. First published May 3, 2005; doi:10.1152/ajpendo.00058.2005
0193-1849/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/4/E658    most recent
00058.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mitchell, B. F.
Right arrow Articles by Mitchell, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitchell, B. F.
Right arrow Articles by Mitchell, J. M.

Intraperitoneal infusion of proinflammatory cytokines does not cause activation of the rat uterus during late gestation

Bryan F. Mitchell, Barbara Zielnik, Susan Wong, Carla D. Roberts, and Jana M. Mitchell

Perinatal Research Centre, Department of Obstetrics and Gynecology, University of Alberta, Edmonton, Canada

Submitted 10 February 2005 ; accepted in final form 22 April 2005


   ABSTRACT
TOP
 ABSTRACT
METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Increased concentrations of IL-1{beta} and TNF-{alpha} have been associated with parturition. However, the role of these cytokines is unknown. Before parturition, the uterus undergoes a process of activation, during which there are significant changes in expression of genes associated with increased uterine contractility, including the receptors for oxytocin (OT) and prostaglandin (PG)F2{alpha} (FP), PGH2 synthase isoform 2 (PGHS2), the gap junction protein connexin-43 (Cx-43), and the inducible isoform of nitric oxide synthase (iNOS). To determine whether IL-1{beta} or TNF-{alpha} was part of the causal mechanism for increased uterine contractions, we placed osmotic pumps infusing IL-1{beta} or TNF-{alpha} into the peritoneal cavity of late pregnant rats (gestation day 19) and measured the effects on uterine contractility and on the uterine concentrations of mRNA for the contraction-associated genes 24 h later. Maternal serum concentrations of IL-1{beta} and TNF-{alpha} were increased significantly. By day 21, the control animals had significant increases (P ≤ 0.05) in mRNA for OT, FP, PGHS2, and Cx-43, a decrease (P ≤ 0.05) in iNOS, and an increase (P ≤ 0.05) in uterine sensitivity and responsiveness to OT. Infusion of IL-1{beta} or TNF-{alpha} had no effect on uterine contractility or on expression of the activation-associated genes. We conclude that intraperitoneal infusion of IL-1{beta} or TNF-{alpha} resulting in significantly increased maternal serum cytokine levels does not cause uterine activation. The role of proinflammatory cytokines in the mechanism of parturition remains unclear.

interleukin-1{beta}; tumor necrosis factor-{alpha}; contraction-associated proteins; uterine contractility; parturition

PRETERM BIRTH IS ASSOCIATED with ~75% of infant death and long-term disability in children. There is very poor understanding of the physiological mechanisms that regulate normal birth or the pathophysiological processes that lead to preterm birth. Before labor onset, a sequence of events, termed uterine activation, transforms the uterus from a quiescent, relatively nonresponsive muscle to a sensitive muscular organ characterized by powerful synchronous contractions that are capable of expelling the fetus. During uterine activation, the uterine lining (decidua) and muscular layer (myometrium) acquire the ability to respond to contractile stimulants such as oxytocin (OT) and prostaglandins (PG), and the myometrial cells are interconnected by increasing numbers of gap junctions that facilitate rapid cell-cell transmission of depolarizing electrical stimuli (9). Reliable markers of uterine activation include the OT receptor (OTR), the PG-synthesizing enzyme PGH2 synthase (PGHS), the receptor for PGF2{alpha} (FP), and the major gap junction protein connexin-43 (Cx-43). Increased expression of these genes, termed activation-associated genes, causes increased uterine sensitivity and responsiveness to uterotonins.

There is a strong association between concentrations of the proinflammatory cytokines TNF-{alpha}, IL-1{beta}, and IL-6 and human parturition. In preterm labor associated with clinically evident infection, amniotic fluid concentrations of TNF-{alpha} (44), IL-1{beta} (42), and IL-6 (40, 41, 47) are markedly increased. This pattern also occurs in normal-term labor and in preterm labor in the absence of microorganisms, although the increases in cytokines are less marked (12, 19, 32, 42, 45). Human placenta, amnion, chorion, and decidua can synthesize all three cytokines (26). Despite these strong associative data linking the proinflammatory cytokines to parturition, it remains unclear whether there is a cause-effect relationship between the cytokines and parturition.

The current study was undertaken, using an animal model, to explore a causal association between IL-1{beta} or TNF-{alpha} and uterine activation. For in vivo experiments, we chose the Sprague-Dawley rat model because it is well characterized and the uterine changes at the end of pregnancy are similar to those of the human (14). Normal parturition occurs on the afternoon of day 21 or on the morning of day 22. Uterine activation occurs ~24 h before delivery. We hypothesized that insertion of osmotic minipumps infusing IL-1{beta} or TNF-{alpha} into the peritoneal cavity on gestation day 19 would advance uterine activation by 24 h, such that there would be measurable changes in expression of the activation-associated genes on day 20. Additionally, we hypothesized that the uterine tissues from the cytokine-treated animals would demonstrate increased contractility, as assessed using uterine myographic techniques to determine uterine sensitivity and responsiveness to OT in vitro.


   METHODS
TOP
 ABSTRACT
 METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals. The University of Alberta Health Sciences Animal Policy and Welfare Committee approved all animal protocols, and the experiments were conducted in accordance with the American Physiological Society's Guiding Principles in the Care and Use of Animals. Thirty-three virgin Sprague-Dawley rats weighing ~250 g were time mated in the facilities of the University of Alberta Health Sciences Laboratory Animal Services. The pregnant animals in this colony delivered on the afternoon of day 21 or the morning of day 22. The morning of discovery of the semen plug is considered day 0. The animals were divided into five groups, including two time control groups on days 20 (before activation, n = 6) and 21 of gestation (after activation, n = 8), plus three experimental groups that received intraperitoneal osmotic pumps filled with placebo (saline, n = 6), IL-1{beta} (10 µg, n = 8), or TNF-{alpha} (10 µg, n = 5). The intraperitoneal pumps were inserted under light inhalational anesthesia (isoflurane; Bimeda-MTC, Cambridge, ON, Canada) through a small subumbilical incision on day 19. The Alzet model 2001D osmotic pumps (designed to deliver their contents over 24 h) were obtained from Durect (Cupertino, CA). Rats in the treatment groups were killed by heart puncture and bleeding under inhalational anesthesia. The time control animals did not receive osmotic pumps and were killed in a similar fashion to the treated animals. Five of the day 21 control animals were killed at 0900 before any signs of labor. The remaining three were killed in active labor, after delivery of at least one pup. Recombinant cytokines were obtained from Biosource International/Medicorp (Montreal, QC, Canada). Blood samples were obtained from each animal at the time of euthanasia and immediately centrifuged, and the serum was stored at –80°C until analyses. Each pump was checked to ensure that it had emptied its contents. After removal of the pups, one horn of the uterus was frozen and stored at –80°C until subsequent biochemical assessment. From the other horn, full-thickness strips of uterine wall were collected for the myographic studies.

ELISAs for IL-1{beta} and TNF-{alpha}. The cytokine concentrations were measured using kits obtained from Biosource International (Camarillo, CA). Serum samples (100 µl) were measured in duplicate according to the protocol accompanying the kits. The ELISA for rat IL-1{beta} has a sensitivity of <3 pg/ml with intra-assay and interassay coefficients of variation of 8 and 10%, respectively. For rat TNF-{alpha}, the ultrasensitive assay has a sensitivity of <0.7 pg/ml, with intra-assay and interassay coefficients of variation of 4 and 6%, respectively.

Quantitative reverse transcription-polymerase chain reaction. RNA was extracted using the GenElute Mammalian Total RNA Miniprep kit (Sigma-Aldrich, St. Louis, MO). Samples were treated with amplification grade DNase I (Sigma-Aldrich). The purity of the extracted RNA was assessed by spectrophotometry and the quality assessed by electrophoresis on 1% agarose gel. The sample was diluted to 50 ng mRNA/µl. Reverse transcription was performed using the Taqman Reverse Transcription Reagents kit (Applied Biosystems, Foster City, CA). The resultant cDNA was stored at –20°C until it was ready for PCR. As a negative control, the reaction was also performed in randomly chosen samples in the absence of the reverse transcriptase.

Real-time PCR was performed in triplicate using the SYBR Green PCR Core Reagents kit (Applied Biosystems). The forward and reverse primer pairs, respectively, were as follows: OTR, CGATTGCTGGGCGGTCTT and CCGCCGCTGCCGTCTTGA; FP receptor, CTGGCCATAATGTGCGTCTC and TGTCGTTTCACAGGTCACTGG; PGHS2, CCTTGAACACGGACTTGCTCAC and TCTCTCTGCTCTGGTCAATGGA; Cx-43, TGACTTCAGCCTCCAAGG and AATGAAGAGCACCGACAGC; iNOS, TTGGTGAAAGCGGTGTT and AGCAAAGAGGACTGTGGC; and cyclophylin, CACCGTGTTCTTCGACATCAC and CCAGTGCTCAGAGCTCGAAAG. Each protocol was individually optimized. The blank control was one tube in which autoclaved H2O replaces the cDNA template. The fluorescence was measured at the end of each PCR cycle and plotted against the cycle number to determine the threshold cycle. After amplification, the purity of the amplified cDNA was checked by assessing a melt curve of the amplified products.

For quantification, we used the "{Delta}-{Delta}" method to determine the relative expression between groups (36). The threshold cycle (CT) was determined for the gene of interest (GOI) and a housekeeping gene (HKG), which was cyclophylin. The data were normalized by subtracting the CT of the GOI from the CT of the HKG to determine the {Delta}CT. The relative expression levels of the GOI in an experimental sample were compared with those of a control or calibrator sample by subtracting their {Delta}CT values and using the following formula: relative fold change = 2–x, where x is the difference between the {Delta}CT of the experimental sample and the calibrator samples.

Uterine activation was assessed only by measurement of mRNA for the activation-associated genes. Protein levels for these genes follow a pattern similar to that of the mRNA (1, 2, 5, 7, 14, 35).

Uterine myography. The muscle bath preparation was established on the basis of published methodology (31). Tissues from pregnant rats, gestation day 20 or 21, were obtained as described in METHODS. Uterine horns were removed immediately and incised longitudinally. No attempt was made to separate circular from longitudinal muscle or to remove attached endometrium. Uterine tissues were freed from all fetuses, membranes, and placental tissues. Longitudinal muscle strips ~8 mm in length and 3 mm in width were excised, as we attempted to avoid implantation sites.

Muscle strips were mounted vertically in separated jacketed organ baths, each containing 10 ml Krebs buffer of the following composition (mmol/l): 118 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 KH2PO4, 0.59 MgSO4, 25 NaHCO3, 11.7 D-glucose at pH 7.4, and constantly aerated with 95% O2-5% CO2 at 32°C. One end of each strip was anchored in the bath, and the other end was attached to a Bridge 8 force-displacement transducer that was connected to a Biopac Systems MP100 unit with AcqKnowledge software, version 3.7.2 (World Precision Instruments, Sarasota, FL). A resting tension of 1 g was applied to each strip. This resting tension has been shown to develop maximum active tension in pregnant Sprague-Dawley rat myometrium (14). The muscle strips were incubated for 60–90 min to establish a stable baseline. Concentration-response curves were established for OT (0.1 nM to 100 µM added at 5-min intervals), and the EC50 concentration (as a measure of sensitivity) was calculated using nonlinear regression for a sigmoid curve (Prism, version 4.0; GraphPad Software, San Diego, CA). The responsiveness of the strips was measured by the total area under the concentration response curve, determined by summation after subtraction of the baseline activity.

Statistics. Comparisons among the five groups of pregnant rats were performed using one-way analysis of variance (ANOVA) with a post hoc Tukey test only when the ANOVA revealed a significant (P < 0.05) effect of treatment on the parameter being assessed. In the tables and figures, all data are presented as means ± SE.


   RESULTS
TOP
 ABSTRACT
 METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Maternal serum cytokine concentrations. There were no behavioral changes or vaginal bleeding noted in any of the treated animals. Intraperitoneal placement of osmotic pumps infusing IL-1{beta} on day 19 of rat gestation resulted in a significant, fourfold increase in maternal serum concentrations of IL-1{beta} at 24 h after pump placement (Table 1). The small increases in IL-1{beta} concentrations in the animals with insertion of pumps containing placebo or TNF-{alpha} were not statistically significant. There was a >50-fold increase in maternal serum TNF-{alpha} concentrations in the animals that received TNF-{alpha} infusions. Pumps containing placebo or IL-1{beta} had no effect on maternal serum TNF-{alpha} concentrations. As with IL-1{beta}, there was no increase in TNF-{alpha} on the day of parturition. Except for the samples from the TNF-{alpha}-infused animals, concentrations of TNF-{alpha} were below the sensitivity of the assay in more than half of the samples. Only one of eight samples in the day 21 group had detectable levels of TNF-{alpha}.


View this table:
[in this window]
[in a new window]
  		Table 1. Maternal serum concentrations of IL-1{beta} and TNF-{alpha}

 
In eight animals, we were able to collect amniotic fluid samples and compare them to maternal serum samples. For both IL-1{beta} and TNF-{alpha}, concentrations in the two compartments were not significantly different.

Expression of activation-associated genes. Uterine concentrations of mRNA for OTR, FP, PGHS2, and Cx-43 increased significantly (P ≤ 0.05) in the control animals by day 21 of gestation (Fig. 1). The most marked increase occurred with OTR, which increased >15-fold in the animals not in labor and >25-fold in the three that had delivered at least one pup. The increases in the other markers were in the four-to-sixfold range. In contrast, the concentration of mRNA for iNOS decreased significantly on day 21 to less than half of control values (P ≤ 0.05). There were no differences in mRNA concentrations between the prelabor and postlabor samples on day 21, except for PGHS2, which was significantly higher after labor onset (1.6 ± 0.2 vs. 8.4 ± 1.9 relative mRNA concentration units, P < 0.001 by ANOVA).



View larger version (27K):
[in this window]
[in a new window]
  		Fig. 1. Uterine concentrations of mRNA for activation-associated genes. Relative concentrations of mRNA for oxytocin (OT) receptor (OTR), prostaglandin (PG)F2{alpha} receptor (FP), PGH2 synthase isoform 2 (PGHS2), connexin-43 (Cx-43), and inducible nitric oxide synthase (iNOS) are illustrated for the experimental groups described in the figure. The day 20 controls and placebo-treated animals were not different and, for purposes of illustration, have been combined as day 20. Similarly, the day 21 controls contain the animals not in labor as well as those in labor. For each mRNA, ANOVA revealed a statistically significant (P < 0.05) difference, with the day 21 group being significantly different from all others (*). There were no significant effects of treatment with IL-1{beta} or TNF-{alpha}. Note the geometric scale on the y-axis.

 
Contrary to our hypothesis, intraperitoneal infusions of IL-1{beta} or TNF-{alpha} for 24 h beginning on day 19 had no significant effect on the uterine concentrations of mRNA for any of the measured activation-associated genes compared with either the animals that received placebo infusions or the day 20 controls that did not have pumps inserted.

In many species, including the rat, the hormone progesterone is the major factor in maintaining uterine quiescence. Its actions are mediated through the B isoform of the progesterone receptor (PR-B). A putative mechanism of action for proinflammatory cytokines on the uterus during pregnancy is to decrease the expression of PR-B relative to the expression of the dominant negative isoform PR-A (15, 29). We have measured mRNA for PR-B and for the total of all PR isoforms (predominantly PR-A plus PR-B). We did not detect any change in the ratio of PR-B to the sum of all PR isoforms at either spontaneous term labor or after intraperitoneal infusion of IL-1{beta} or TNF-{alpha} (Fig. 2).



View larger version (34K):
[in this window]
[in a new window]
  		Fig. 2. Uterine concentrations of mRNA for progesterone receptor (PR) isoforms. A: there was no significant difference in mRNA for PR-B in uterine tissues from gestation day 20 control rats (open bars), rats treated with IL-1{beta} for 24 h (gray bars), rats treated with TNF-{alpha} for 24 h (hatched bars), or control rats on gestational day 21, the day of normal parturition (filled bars). B: ratio of mRNA for PR-B to total mRNA for all isoforms of PR did not change among these groups. For both panels, the day 20 controls and placebo-treated animals were not different and, for purposes of illustration, have been combined. Similarly, the day 21 controls contain the animals not in labor as well as those in labor.

 
Uterine myographic studies. The changes in uterine contractility were in keeping with the changes in expression of the activation-associated genes. As illustrated in Fig. 3, there was no significant increase in uterine sensitivity to OT, assessed by myographic measurement of EC50, between day 20 and day 21 control animals (3.05 ± 0.62 to 5.11 ± 1.33 nM). Infusion of IL-1{beta} or TNF-{alpha} had no effect on uterine sensitivity. In contrast, the responsiveness of the uterus to OT increased between day 20 and day 21 in the control animals, as demonstrated by the increase in the total area under the concentration-response curve (2,462 ± 282 to 5,759 ± 1,850 g·s·5 min–1, P < 0.05). Again, there was no effect of the intraperitoneal infusions of IL-1{beta} or TNF-{alpha}.



View larger version (21K):
[in this window]
[in a new window]
  		Fig. 3. Uterine sensitivity and responsiveness. A: there were no significant changes in EC50 values for OT among the groups. B: uterine responsiveness was significantly increased on day 21 (ANOVA, *P ≤ 0.05). There was no effect of treatment with placebo, IL-1{beta}, or TNF-{alpha}.

 

   DISCUSSION
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
These results indicate that moderate increases in systemic IL-1{beta} or TNF-{alpha} do not cause uterine activation. The data from the literature do not establish whether uterine activation simply occurred in association with increased cytokines or whether there was a cause-effect relationship. The data of this paper support the former conclusion.

The most consistent data demonstrating the relationship between increases in proinflammatory cytokines and uterine activation relate to PGHS2. The fetal membranes and maternal decidua synthesize IL-1{beta} and TNF-{alpha}, and these cytokines are capable of increasing concentrations and activity of PGHS2 in the uterine tissues of several species (26). There is also strong evidence that these effects are mediated by NF-{kappa}B and CCAAT/enhancer-binding protein-{beta} (C/EBP{beta}) (6, 37, 54). It is interesting to note that, in the present study, PGHS2 was the only gene that was expressed at higher concentrations on day 21 during labor compared with day 21 before labor. Furthermore, the mRNA for PGHS2 was the only mRNA measured that was not significantly changed from control values on day 20 to the control values on day 21 before labor onset. This temporal relation supports the conclusion that the increase in PGHS2 may have been predominantly an effect, rather than a cause, of labor.

The situation with OTR is less clear. As with PGHS2, the OTR gene promoter region has multiple response elements capable of binding NF-{kappa}B or C/EBP{beta} (24, 25). However, we (49) and others (22, 38) have noted a decrease in OTR in human uterine myocytes after treatment with IL-1{beta}. We noted that the negative effect of IL-1{beta} in transformed human myometrial cells was accompanied by an increase in C/EBP{beta} and that the inhibitory effect could be abolished by deletion of the promoter segment containing the C/EBP response elements (49). Conversely, Terzidou et al. (51) demonstrated through the use of human myometrial cells from late pregnancy in primary culture that IL-1{beta} caused a threefold increase in mRNA for OTR (51).

Our findings of increased expression of mRNA for FP receptor and Cx-43 levels during uterine activation are consistent with the data from others in mouse (11), rat (1, 35), and human myometrium (7, 18, 50). However, there is no direct evidence linking regulation of these genes with cytokine stimulation.

It is possible that iNOS activity that produces nitric oxide represents a mechanism to maintain uterine quiescence during most of gestation. The mRNA for iNOS was significantly increased in pregnancy at day 20 compared with tissues from nonpregnant animals (from 0.03 ± 0.01 to 0.95 ± 0.20 relative units, P < 0.01). At a time when mRNA for the contraction-associated proteins was increasing, mRNA for iNOS decreased significantly. This pattern has been noted previously for iNOS protein in human (5) and rat (2, 39). However, the current data are the first to temporally match the changes in iNOS with the other factors associated with uterine activation. This supports the concept that uterine activation is not just an upregulation of stimulatory factors but a coordinated process that also downregulates factors causing uterine quiescence. Again, these data do not support a role for proinflammatory cytokines in uterine activation. Several studies have demonstrated that IL-1{beta} and TNF-{alpha} stimulate iNOS expression in a variety of cell types (27). To our knowledge, there are no data demonstrating that these cytokines decrease iNOS expression.

Our experiments also failed to find any change in uterine mRNA for PR isoforms during late pregnancy. We have previously reported a decrease in the ratio of mRNA for PR-B to PR-total at the time of parturition (15). Those studies used ribonuclease protection assays to measure PR mRNA, and the difference in methods may underlie the different results. Of interest, in that study we used Western analyses to demonstrate a tendency toward increasing PR-B protein with no change in PR-A protein (30). Others have also reported significant changes in PR mRNA isoform expression at the time of labor onset in women and rhesus monkeys (20, 29). To our knowledge, no one has yet demonstrated significant changes in the relative expression of proteins for the PR isoforms.

There was no change in myographic assessment of uterine sensitivity to OT between gestation days 20 and 21 despite the marked increase in mRNA for OTR. This could indicate that increased transcription has occurred but translation has not. However, there was a significant increase in uterine responsiveness that correlates temporally with the significant changes in mRNA for the contraction-associated genes described earlier in results. Previous in vitro studies have shown a lack of direct effect of cytokines on myometrial contractility (33). Again, the failure of IL-1{beta} or TNF-{alpha} to reproduce any of these biochemical or functional changes suggests they are not part of the physiological pathway for uterine activation.

Two important considerations in interpreting these results relate to the animal model and the dose of cytokine used. Although there is no literature regarding effects of proinflammatory cytokines on parturition in the rat, the molecular events of uterine activation appear to be a good model for the human (14). We inserted the pumps into the lower abdomen adjacent to the uterus to take advantage of any local absorption into the uterus that might occur. We considered injection into the amniotic fluid, but that would have been technically difficult and likely inappropriate in a polytocous species such as the rat.

We chose to use 10 µg of IL-1{beta} or TNF-{alpha} intraperitoneally in these experiments because this has been shown to produce measurable biological responses, such as elevated temperature and increased serum ACTH and corticosterone levels, in Sprague-Dawley and Wistar rats (3, 52). The IL-1{beta} and TNF-{alpha} serum concentrations we attained are similar to those achieved in the guinea pig after instillation of Escherichia coli bacteria into the amniotic cavity to induce chorioamnionitis, causing fetal brain damage (34). In pregnant women, maternal serum levels of IL-1{beta} and TNF-{alpha} are mostly undetectable. In amniotic fluid, concentrations are low during pregnancy but are increased slightly at the time of parturition to reach concentrations that we achieved in maternal serum following treatment (32, 44). In the presence of intrauterine infection, amniotic fluid IL-1{beta} and TNF-{alpha} concentrations were markedly elevated to 5-to-10-fold the concentrations we achieved in maternal serum (28, 44).

Several previous studies have demonstrated that in vivo administration of a potent immune stimulus (such as LPS or bacterial products) in late pregnancy can provoke parturition. However, the underlying mechanism is unclear. In mice, intraperitoneal injection of LPS or intrauterine instillation of killed E. coli bacteria induced preterm parturition accompanied by maternal serum IL-1 concentrations similar to those we obtained (16, 23). Furthermore, mice lacking functional IL-1{beta} receptors responded the same as wild-type animals. Thus it remains unclear whether the immune stimulus works entirely in a paracrine/autocrine fashion or whether it acts indirectly, provoking a maternal systemic response. Furthermore, the role of proinflammatory cytokines in any of these mechanisms remains unclear.

Two previous reports have described the effects of recombinant cytokines on parturition. In a chronically catheterized pregnant rhesus monkey preparation, infusion of IL-1{beta} into the amniotic fluid caused only a transient increase in uterine contractile activity despite amniotic fluid concentrations of 10 ng/ml (4, 48). In 3 of 11 such preparations, delivery occurred within 72 h. There were no placebo or vehicle control injections in that study. In mice, subcutaneous injections of 10 µg of IL-1{beta} in late pregnancy induced parturition within 24 h, and this could be prevented by prior administration of an IL-1{beta} antagonist (46). Serum or amniotic fluid concentrations were not measured. When the weight of those animals is taken into consideration, this dose was ~10-fold higher than the dose used in the present studies. To our knowledge, the in vivo effects of TNF-{alpha} have not previously been studied in this regard. In summary, it appears that very large doses of exogenous cytokines or potent, nonspecific immune stimuli such as LPS or bacterial products are required to induce parturition.

Our studies intentionally used full-thickness uterine tissues, both for the mRNA measurements and for the myography studies. There is a well-described paracrine network involving the maternal decidua and myometrium that may contribute to regulation of uterine-activating factors in both the decidua and myometrium (10, 17). Both are transformed during uterine activation to influence myometrial contractility (8, 12, 13, 43). We wanted to ensure that this network remained intact through our studies.

Recent data demonstrating significant upregulation of many genes associated with the immune response strongly reinforce the notion that parturition is influenced by the immune system (21). This is in keeping with the large influx of bone marrow-derived cells into the decidua just before labor onset (53). In this circumstance, the site of cytokine production would be within the wall of the pregnant uterus. Although the present data do not support a role for proinflammatory cytokines in mediating the processes of uterine activation, it must be kept in mind that the cytokines were administered via the peritoneal cavity. The potential causative role of increased cytokine production within the uterine wall in increasing uterine contractility will be difficult to ascertain. In addition, further study is needed to determine whether the pathological increases in cytokines observed with intrauterine infection might play a causative role in those cases of preterm birth associated with such pathology. It is possible, perhaps probable, that alternate immune mechanisms other than IL-1{beta} and TNF-{alpha} production stimulated by intrauterine pathogens may underlie uterine activation. Understanding such mechanisms may greatly assist in understanding the regulation of parturition and lead to better methods to predict or prevent the occurrence of preterm birth.


   GRANTS
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
We appreciate the assistance and cooperation of the staff of the University of Alberta Health Sciences Lab Animal Services for the care of the animals.


   ACKNOWLEDGMENTS
 
We acknowledge support for these studies from the Canadian Institutes of Health Research (Institute for Human Development, Child and Youth Health) and the Alberta Heritage Fund for Medical Research. We also acknowledge a Studentship (to C. D. Roberts) from the Alpha Omega Alpha Foundation.


   FOOTNOTES
 

Address for reprint requests and other correspondence: B. F. Mitchell, Perinatal Research Centre, 227 HMRC, Univ. of Alberta, Edmonton, Alberta, Canada, T6G 2S2 (e-mail: brymitch{at}ualberta.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Al-Matubsi HY, Eis AL, Brodt-Eppley J, MacPhee DJ, Lye S, and Myatt L. Expression and localization of the contractile prostaglandin F receptor in pregnant rat myometrium in late gestation, labor, and postpartum. Biol Reprod 65: 1029–1037, 2001.[Abstract/Free Full Text]
  2. Ali M, Buhimschi I, Chwalisz K, and Garfield RE. Changes in expression of the nitric oxide synthase isoforms in rat uterus and cervix during pregnancy and parturition. Mol Hum Reprod 3: 995–1003, 1997.[Abstract/Free Full Text]
  3. Anforth HR, Bluthe RM, Bristow A, Hopkins S, Lenczowski MJ, Luheshi G, Lundkvist J, Michaud B, Mistry Y, Van Dam AM, Zhen C, Dantzer R, Poole S, Rothwell NJ, Tilders FJ, and Wollman EE. Biological activity and brain actions of recombinant rat interleukin-1alpha and interleukin-1beta. Eur Cytokine Netw 9: 279–288, 1998.[Web of Science][Medline]
  4. Baggia S, Gravett MG, Witkin SS, Haluska GJ, and Novy MJ. Interleukin-1 beta intra-amniotic infusion induces tumor necrosis factor-alpha, prostaglandin production, and preterm contractions in pregnant rhesus monkeys. J Soc Gynecol Investig 3: 121–126, 1996.[CrossRef][Web of Science][Medline]
  5. Bansal RK, Goldsmith PC, He Y, Zaloudek CJ, Ecker JL, and Riemer RK. A decline in myometrial nitric oxide synthase expression is associated with labor and delivery. J Clin Invest 99: 2502–2508, 1997.[Web of Science][Medline]
  6. Belt AR, Baldassare JJ, Molnar M, Romero R, and Hertelendy F. The nuclear transcription factor NF-kappaB mediates interleukin-1beta-induced expression of cyclooxygenase-2 in human myometrial cells. Am J Obstet Gynecol 181: 359–366, 1999.[CrossRef][Web of Science][Medline]
  7. Brodt-Eppley J and Myatt L. Prostaglandin receptors in lower segment myometrium during gestation and labor. Obstet Gynecol 93: 89–93, 1999.[CrossRef][Web of Science][Medline]
  8. Casey ML, Cox SM, Beutler B, Milewich L, and MacDonald PC. Cachectin/tumor necrosis factor-alpha formation in human decidua. Potential role of cytokines in infection-induced preterm labor. J Clin Invest 83: 430–436, 1989.[Web of Science][Medline]
  9. Challis JRG and Lye SJ. Parturition. In: The Physiology of Reproduction, edited by Knobil E and Neill JD. New York: Raven, 1994, p. 985–1031.
  10. Chen DL, Chan WY, and Manning M. Agonist and antagonist specificities of decidual prostaglandin-releasing oxytocin receptors and myometrial uterotonic oxytocin receptors in pregnant rats. J Reprod Fertil 102: 337–343, 1994.[Abstract/Free Full Text]
  11. Cook JL, Shallow MC, Zaragoza DB, Anderson KI, and Olson DM. Mouse placental prostaglandins are associated with uterine activation and the timing of birth. Biol Reprod 68: 579–587, 2003.[Abstract/Free Full Text]
  12. Dudley DJ, Collmer D, Mitchell MD, and Trautman MS. Inflammatory cytokine mRNA in human gestational tissues: implications for term and preterm labor. J Soc Gynecol Investig 3: 328–335, 1996.[CrossRef][Web of Science][Medline]
  13. Dudley DJ, Trautman MS, Araneo BA, Edwin SS, and Mitchell MD. Decidual cell biosynthesis of interleukin-6: regulation by inflammatory cytokines. J Clin Endocrinol Metab 74: 884–889, 1992.[Abstract]
  14. Fang X, Wong S, and Mitchell BF. Effects of RU486 on estrogen, progesterone, oxytocin, and their receptors in the rat uterus during late gestation. Endocrinology 138: 2763–2768, 1997.[Abstract/Free Full Text]
  15. Fang X, Wong S, and Mitchell BF. Messenger RNA for progesterone receptor isoforms in the late-gestation rat uterus. Am J Physiol Endocrinol Metab 283: E1167–E1172, 2002.[Abstract/Free Full Text]
  16. Fidel PL Jr, Romero R, Wolf N, Cutright J, Ramirez M, Araneda H, and Cotton DB. Systemic and local cytokine profiles in endotoxin-induced preterm parturition in mice. Am J Obstet Gynecol 170: 1467–1475, 1994.[Web of Science][Medline]
  17. Fuchs AR, Fuchs F, Husslein P, Soloff MS, and Fernstrom MJ. Oxytocin receptors and human parturition: a dual role for oxytocin in the initiation of labor. Science 215: 1396–1398, 1982.[Abstract/Free Full Text]
  18. Geimonen E, Boylston E, Royek A, and Andersen J. Elevated connexin-43 expression in term human myometrium correlates with elevated c-Jun expression and is independent of myometrial estrogen receptors. J Clin Endocrinol Metab 83: 1177–1185, 1998.[Abstract/Free Full Text]
  19. Greig PC, Murtha AP, Jimmerson CJ, Herbert WN, Roitman-Johnson B, and Allen J. Maternal serum interleukin-6 during pregnancy and during term and preterm labor. Obstet Gynecol 90: 465–469, 1997.[CrossRef][Web of Science][Medline]
  20. Haluska GJ, Wells TR, Hirst JJ, Brenner RM, Sadowsky DW, and Novy MJ. Progesterone receptor localization and isoforms in myometrium, decidua, and fetal membranes from rhesus macaques: evidence for functional progesterone withdrawal at parturition. J Soc Gynecol Investig 9: 125–136, 2002.[Web of Science][Medline]
  21. Havelock JC, Keller P, Muleba N, Mayhew BA, Casey BM, Rainey WE, and Word RA. Human myometrial gene expression before and during parturition. Biol Reprod 72: 707–719, 2005.[Abstract/Free Full Text]
  22. Helmer H, Tretzmuller U, Brunbauer M, Kaider A, Husslein P, and Knofler M. Production of oxytocin receptor and cytokines in primary uterine smooth muscle cells cultivated under inflammatory conditions. J Soc Gynecol Investig 9: 15–21, 2002.[CrossRef][Web of Science][Medline]
  23. Hirsch E, Muhle RA, Mussalli GM, and Blanchard R. Bacterially induced preterm labor in the mouse does not require maternal interleukin-1 signaling. Am J Obstet Gynecol 186: 523–530, 2002.[CrossRef][Web of Science][Medline]
  24. Hoare S, Copland JA, Wood TG, Jeng YJ, Izban MG, and Soloff MS. Identification of a GABP alpha/beta binding site involved in the induction of oxytocin receptor gene expression in human breast cells, potentiation by c-Fos/c-Jun. Endocrinology 140: 2268–2279, 1999.[Abstract/Free Full Text]
  25. Inoue T, Kimura T, Azuma C, Inazawa J, Takamura M, Kikuchi T, Kubota Y, Ogita K, and Saji F. Structural organization of the human oxytocin receptor gene. J Biol Chem 269: 32451–32456, 1994.[Abstract/Free Full Text]
  26. Keelan JA, Blumenstein M, Helliwell RJ, Sato TA, Marvin KW, and Mitchell MD. Cytokines, prostaglandins and parturition—a review. Placenta 24, Suppl A: S33–S46, 2003.
  27. Kleinert H, Schwarz PM, and Forstermann U. Regulation of the expression of inducible nitric oxide synthase. Biol Chem 384: 1343–1364, 2003.[CrossRef][Web of Science][Medline]
  28. Mazor M, Furman B, and Bashiri A. Cytokines in preterm parturition. Gynecol Endocrinol 12: 421–427, 1998.[Web of Science][Medline]
  29. Mesiano S, Chan EC, Fitter JT, Kwek K, Yeo G, and Smith R. Progesterone withdrawal and estrogen activation in human parturition are coordinated by progesterone receptor A expression in the myometrium. J Clin Endocrinol Metab 87: 2924–2930, 2002.[Abstract/Free Full Text]
  30. Mitchell BF and Wong S. Concentrations of isoforms of the progesterone receptor ion rat uterine tissues at normal term, tamoxifen-delayed or RU486-induced preterm parturition (Abstract). J Soc Gynecol Investig 8: 201A, no. 528, 2001.
  31. Molnar M, Romero R, and Hertelendy F. Interleukin-1 and tumor necrosis factor stimulate arachidonic acid release and phospholipid metabolism in human myometrial cells. Am J Obstet Gynecol 169: 825–829, 1993.[Web of Science][Medline]
  32. Opsjon SL, Wathen NC, Tingulstad S, Wiedswang G, Sundan A, Waage A, and Austgulen R. Tumor necrosis factor, interleukin-1, and interleukin-6 in normal human pregnancy. Am J Obstet Gynecol 169: 397–404, 1993.[Web of Science][Medline]
  33. Oshiro BT, Monga M, Eriksen NL, Graham JM, Weisbrodt NW, and Blanco JD. Endotoxin, interleukin-1 beta, interleukin-6, or tumor necrosis factor-alpha do not acutely stimulate isolated murine myometrial contractile activity. Am J Obstet Gynecol 169: 1424–1427, 1993.[Web of Science][Medline]
  34. Patrick LA, Gaudet LM, Farley AE, Rossiter JP, Tomalty LL, and Smith GN. Development of a guinea pig model of chorioamnionitis and fetal brain injury. Am J Obstet Gynecol 191: 1205–1211, 2004.[CrossRef][Web of Science][Medline]
  35. Petrocelli T and Lye SJ. Regulation of transcripts encoding the myometrial gap junction protein, connexin-43, by estrogen and progesterone. Endocrinology 133: 284–290, 1993.[Abstract/Free Full Text]
  36. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45, 2001.[Abstract/Free Full Text]
  37. Potter S, Mitchell MD, Hansen WR, and Marvin KW. NF-IL6 and CRE elements principally account for both basal and interleukin-1 beta-induced transcriptional activity of the proximal 528bp of the PGHS-2 promoter in amnion-derived AV3 cells: evidence for involvement of C/EBP beta. Mol Hum Reprod 6: 771–778, 2000.[Abstract/Free Full Text]
  38. Rauk PN and Chiao JP. Oxytocin signaling in human myometrium is impaired by prolonged exposure to interleukin-1. Biol Reprod 63: 846–850, 2000.[Abstract/Free Full Text]
  39. Riemer RK, Buscher C, Bansal RK, Black SM, He Y, and Natuzzi ES. Increased expression of nitric oxide synthase in the myometrium of the pregnant rat uterus. Am J Physiol Endocrinol Metab 272: E1008–E1015, 1997.[Abstract/Free Full Text]
  40. Romero R, Avila C, Santhanam U, and Sehgal PB. Amniotic fluid interleukin 6 in preterm labor. Association with infection. J Clin Invest 85: 1392–1400, 1990.[Web of Science][Medline]
  41. Romero R, Avila C, Santhanam U, and Sehgal PB. Amniotic interleukin 6 in preterm labor. Association with infection. J Clin Invest 85: 1392–1400, 1990.[Web of Science][Medline]
  42. Romero R, Brody DT, Oyarzun E, Mazor M, Wu YK, Hobbins JC, and Durum SK. Infection and labor. III. Interleukin-1: a signal for the onset of parturition. Am J Obstet Gynecol 160: 1117–1123, 1989.[Web of Science][Medline]
  43. Romero R, Mazor M, Manogue K, Oyarzun E, and Cerami A. Human decidua: a source of cachectin-tumor necrosis factor. Eur J Obstet Gynecol Reprod Biol 41: 123–127, 1991.[CrossRef][Web of Science][Medline]
  44. Romero R, Mazor M, Sepulveda W, Avila C, Copeland D, and Williams J. Tumor necrosis factor in preterm and term labor. Am J Obstet Gynecol 166: 1576–1587, 1992.[Web of Science][Medline]
  45. Romero R, Parvizi ST, Oyarzun E, Mazor M, Wu YK, Avila C, Athanassiadis AP, and Mitchell MD. Amniotic fluid interleukin-1 in spontaneous labor at term. J Reprod Med 35: 235–238, 1990.[Web of Science][Medline]
  46. Romero R and Tartakovsky B. The natural interleukin-1 receptor antagonist prevents interleukin-1-induced preterm delivery in mice. Am J Obstet Gynecol 167: 1041–1045., 1992.[Web of Science][Medline]
  47. Romero R, Yoon BH, Kenney JS, Gomez R, Allison AC, and Sehgal PB. Amniotic fluid interleukin-6 determinations are of diagnostic and prognostic value in preterm labor. Am J Reprod Immunol 30: 167–183, 1993.
  48. Sadowsky DW, Haluska GJ, Gravett MG, Witkin SS, and Novy MJ. Indomethacin blocks interleukin 1beta-induced myometrial contractions in pregnant rhesus monkeys. Am J Obstet Gynecol 183: 173–180, 2000.[Web of Science][Medline]
  49. Schmid B, Wong S, and Mitchell BF. Transcriptional regulation of oxytocin receptor by interleukin-1beta and interleukin-6. Endocrinology 142: 1380–1385, 2001.[Abstract/Free Full Text]
  50. Sparey C, Robson SC, Bailey J, Lyall F, and Europe-Finner GN. The differential expression of myometrial connexin-43, cyclooxygenase-1 and -2, and Gs alpha proteins in the upper and lower segments of the human uterus during pregnancy and labor. J Clin Endocrinol Metab 84: 1705–1710, 1999.[Abstract/Free Full Text]
  51. Terzidou V, Lee YS, Thornton S, and Bennett PR. Identification of the response region on the oxytocin receptor promoter which is important forthe synergistic transactivation of OTR by C/EBP{beta} and NF-kB transcription factors (Abstract). J Soc Gynecol Invest 10: 190A, no. 1, 2003.
  52. Van der Meer MJ, Sweep CG, Pesman GJ, Borm GF, and Hermus AR. Synergism between IL-1 beta and TNF-alpha on the activity of the pituitary-adrenal axis and on food intake of rats. Am J Physiol Endocrinol Metab 268: E551–E557, 1995.[Abstract/Free Full Text]
  53. Vince GS, Starkey PM, Jackson MC, Sargent IL, and Redman CW. Flow cytometric characterisation of cell populations in human pregnancy decidua and isolation of decidual macrophages. J Immunol Methods 132: 181–189, 1990.[CrossRef][Web of Science][Medline]
  54. Yamamoto K, Arakawa T, Ueda N, and Yamamoto S. Transcriptional roles of nuclear factor kappa B and nuclear factor-interleukin-6 in the tumor necrosis factor alpha-dependent induction of cyclooxygenase-2 in MC3T3-E1 cells. J Biol Chem 270: 31315–31320, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. F. Mitchell and M. J. Taggart
Are animal models relevant to key aspects of human parturition?
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2009; 297(3): R525 - R545.
[Abstract] [Full Text] [PDF]

Home page
 J. Physiol.Home page
P. Arthur, M. J. Taggart, B. Zielnik, S. Wong, and B. F. Mitchell
Relationship between gene expression and function of uterotonic systems in the rat during gestation, uterine activation and both term and preterm labour
J. Physiol., December 15, 2008; 586(24): 6063 - 6076.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/4/E658    most recent
00058.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mitchell, B. F.
Right arrow Articles by Mitchell, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitchell, B. F.
Right arrow Articles by Mitchell, J. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.