Am J Physiol Endocrinol Metab 289: E617-E626, 2005.
First published June 7, 2005; doi:10.1152/ajpendo.00010.2005
0193-1849/05 $8.00
Metabolic and cellular plasticity in white adipose tissue II: role of peroxisome proliferator-activated receptor-
Pipeng Li,
Zhengxian Zhu,
Yuyan Lu, and
James G. Granneman
Departments of Psychiatry and Pathology, Center for Integrative Metabolic and Endocrine Research, Wayne State University School of Medicine, Detroit Michigan
Submitted 11 January 2005
; accepted in final form 27 May 2005
 |
ABSTRACT
|
|---|
Chronic activation of adipocyte
-adrenergic receptors induces remodeling of white adipose tissue (WAT) that includes a transient inflammatory response followed by mitochondrial biogenesis, induction of fatty acid oxidation genes, and elevation of tissue oxidative metabolism. Gene profiling experiments of WAT during remodeling induced by the
3-adrenergic receptor agonist CL-316,243 (CL) suggested that peroxisome proliferator-activated receptor-
(Ppara), which is upregulated by CL, might be an important transcriptional regulator of that process. Histological, physiological, and molecular analysis of CL-induced remodeling in wild-type mice and mice lacking Ppara demonstrated that Ppara was important for inducing adipocyte mitochondrial biogenesis and upregulating genes involved in fatty acid oxidation. Furthermore, Ppara-deficient mice exhibited sustained WAT inflammation during CL treatment, indicating that upregulation of Ppara limits proinflammatory signaling during chronic lipolytic activation. Together, these data support the hypothesis that WAT remodeling is an adaptive response to excessive fatty acid mobilization whereby Ppara and its downstream targets elevate fatty acid catabolism and suppress proinflammatory signaling.
transdifferentiation
CHRONIC PHYSIOLOGICAL OR PHARMACOLOGICAL ACTIVATION of adipocyte
-adrenergic receptors remodels white adipose tissue (WAT; see Refs. 4, 10, 19, and 22). We have been investigating remodeling that occurs after chronic activation of adipocyte
3-adrenergic receptors (Adrb3) with the highly selective Adrb3-selective agonist CL-316,243 (CL). Detailed histological, metabolic, and gene profiling analysis indicates CL triggers a transient inflammatory response that is followed by mitochondrial biogenesis, induction of genes involved in free fatty acid (FFA) catabolism, and elevation of tissue oxidative metabolism (6, 7, 7a). These observations suggest that CL-induced cellular and metabolic plasticity in WAT is a homeostatic response to excessive mobilization of FFA whereby the induction of mitochondrial biogenesis and
-oxidation within white adipocytes limits release of FFA. We hypothesize that this elevated capacity for
-oxidation contributes to the insulin-sensitizing effects of Adrb3 agonists by limiting systemic release of FFA and reducing proinflammatory signaling in adipose tissue. The mechanisms involved in expanding mitochondrial oxidative capacity in white fat are not known; however, we hypothesize that peroxisome proliferator-activated receptor-
(Ppara) plays an important role.
Ppara is a transcription factor that is centrally involved in various aspects of mitochondrial function, including mitochondrial biogenesis and fatty acid oxidation (1, 5, 8). Ppara is heavily expressed in tissues rich in mitochondria and appears to coordinate a genetic program that adapts tissues to the oxidation of fatty acids (8, 15). Analysis of CL-induced changes in WAT gene expression identified a cluster of genes whose members were significantly (P < 1 x 107) enriched in genes involved in mitochondrial FFA transport, activation, and oxidation (7a). Interestingly, Ppara was a member of this cluster, suggesting that this transcription factor might play a role in coordinating the gene expression program that elevates catabolic capacity and suppresses proinflammatory responses in white fat.
The present experiments explored the role of Ppara in wild-type mice and mice lacking Ppara. The results indicate that CL treatment sharply induces expression of Ppara and several of its known target genes. In mice lacking Ppara, induction of genes involved in mitochondrial function was severely compromised, whereas proinflammatory signaling was greatly augmented. These data indicate that Ppara plays a key role in the metabolic adaptation of adipose tissue to sustained mobilization of lipid by expanding its catabolic capacity.
 |
METHODS
|
|---|
Animals and surgery.
Male 129S4/SvJae-tm1Gonz/J (Ppara KO) and wild-type (WT) 129/S1SvImJ mice (recommended control strain) were obtained from Jackson Labs and used at 34 mo of age. Mice were anesthetized with halothane and implanted with osmotic minipumps that delivered vehicle (control) or CL at a rate of 3 nmol/h for 1, 3, or 6 days. For 8 h of treatment, mice were injected intraperitoneally two times with 30 nmol CL at 4-h intervals. Animals were killed, and epididymal white adipose tissue (EWAT) was removed and processed for histological, biochemical, and molecular analyses.
A portion of tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and processed for histological analysis as indicated in the legends for Figs. 110. Adipocyte cell sizes were determined in paraffin sections by measuring the diameters of >100 adjacent cells of four to five individual mice using ImagePro Plus software. The distribution of cell diameters among treatment groups was statistically evaluated with the chi square test.

View larger version (93K):
[in this window]
[in a new window]
|
Fig. 1. Effect of CL-316,243 (CL) on the histological appearance of epididymal white adipose tissue (EWAT). Shown are hematoxylin and eosin-stained sections of EWAT of wild-type (WT) and peroxisome proliferator-activated receptor- (Ppara) knockout (KO) mice under control conditions and after 6 days of CL treatment. Bar = 100 µm.
|
|

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 10. Model for Adrb3-induced adipose tissue remodeling. In control WAT, CL mobilizes free fatty acids (FFA), which immediately provokes an inflammatory response. Chronic stimulation remodels WAT. Central to this remodeling is the upregulation of Ppara expression and activity, leading to elevated FFA oxidation in adipocytes and diminished efflux of FFA. Ppara KO mice fail to expand -oxidation in response to CL treatment, thus mobilized FFA continue to drive proinflammatory signaling and suppress fat-specific functions.
|
|
In situ electron transport activity was evaluated by examining the reduction of 2,3,5-triphenyltetrazolium chloride (TTC; see Refs. 21 and 25). Briefly, whole epididymal white fat pads or minces were rinsed in PBS, submerged in PBS containing 1% TTC for 15 min at 37°C, and then fixed in PBS containing 4% paraformaldehyde. Tissues were recovered and weighed, and the formazan product was extracted with isopropanol and quantified by spectrophotometry. Samples of TTC-stained EWAT were counterstained with streptavidin conjugated to Alexa 555 (Molecular Probes) as described (7), and tissue was imaged by brightfield and wide-field fluorescence microscopy without further processing.
Whole animal and tissue oxygen consumption was determined as described (7a). For analysis of mRNA, EWAT was placed in RNAlater (Ambion) and then held at 80°C until processed as detailed below.
Bromodeoxyuridine labeling in vivo.
In parallel experiments, WT and Ppara KO mice were infused with bromodeoxyuridine (BrdU, 20 µg/h) along with CL, as described above. EWAT, brown adipose tissue, and intestine (positive control) were harvested after 7 days of infusion. In a separate experiment, WT and Ppara KO mice were infused with CL for 3 or 7 days and were injected three times at 4-h intervals with 4 mg BrdU during the last 2 days of infusion. Mice were killed 2 h after the last injection. BrdU immunohistochemistry was performed as described (7a).
Global expression profiling analysis.
Global expression profiling analyses was performed as previously detailed (7a). Briefly, RNA was pooled from four to six mice at each experimental time point, labeled, and hybridized to the Affymetrix U74Av2 microarray. Microarray data have been deposited in the Gene Expression Omnibus under accession number GSE2131. Genes with expression levels that were greater than 2,000 and were significantly changed (P < 0.01; Wilcoxon signed-rank test) at one or more time points were subject to K-means clustering analysis (Expression NTI software). Six hundred forty genes met the criteria for gene clustering. The gene ontology (GO) of individual clusters was evaluated with Onto-Express software (16, 17). Gene and gene products are referred to using Unigene nomenclature. GO designations are accordance with the Gene Ontology Consortium (http://www.geneontology.org).
The expression pattern of selected genes was confirmed by quantitative RT-PCR (qRT-PCR) analysis, as previously described (6). Briefly, 1 µg total RNA from individual mice was reverse transcribed, and duplicate 10-ng samples were subjected to qPCR analysis using SYBR Green as the fluorophore. Cycle threshold values were normalized to that of peptidylprolyl isomerase A (Ppia) mRNA. The respective forward and reverse primers used were as follows: Ppia, gtggtctttgggaaggtgaa and TTACAGGACATTGCGAGCAG; Ppara, CGGGTAACCTCGAAGTCTGA and CTAACCTTGGGCCACACCT; pyruvate dehydrogenase kinase-4 (Pdk4), GGCCATCCATGTAGGAGAGA and GAGGGAGACCCACAGAAGAA; cytochrome c oxidase subunit 8b (Cox8b), TGCGAAGTTCACAGTGGTTC and TCAGGGATGTGCAACTTCA; long-chain acyl-CoA dehydrogenase (Acadl), TGCGAAGTTCACAGTGGTTC and TCAGGGATGTGCAACTTCA; nuclear receptor binding factor-1 (Nrbf1), TGAAGCCTTTTGTGTCTTCG and ATATGGGTGAGGCAGTCTGG; monocyte chemotactic protein-1 (Ccl2), ctggatcggaaccaaatgag and aaggcatcacagtccgagtc; macrophage inflammatory protein-1 (Ccl9), TCACAACCACGGACCTACAA and GGGTTGGCACAGACAAGTTT; Gro1 (Cxcl1), GCTGGGATTCACCTCAAGAA and tctccgttacttggggacac; proliferating cell nuclear antigen (Pcna), ccacattggagatgctgttg and CAGTGGAGTGGCTTTTGTGA; and antigen recognized by the monoclonal antibody Ki67 (mKi67), cagtgtggttttcacctcca and taggacagagggccacattt.
Statistical analysis.
Except as noted, data were evaluated by one- or two-way ANOVA. Post hoc comparisons were performed using the Bonferroni t-test.
 |
RESULTS
|
|---|
General histology.
The general histological appearance of EWAT of WT and Ppara KO mice under control conditions and after 6 days Adrb3 stimulation is shown in Fig. 1. The appearance of EWAT of WT and Ppara KO mice was highly similar in the absence of drug treatment. Virtually all fat cells contained a single central lipid droplet, whereas the numerous stromal cells were evenly scattered among the mature adipocytes. As expected, chronic activation of Adrb3 by CL remodeled EWAT of WT mice, leading to strong fragmentation of the central lipid droplet and repositioning of the eccentric nucleus. CL treatment prominently increased eosin staining between the fragmented lipid droplets, indicating elevated mitochondrial biogenesis. In contrast, CL treatment failed to increase basophilic staining of Ppara null adipocytes, which retained a unilocular appearance in paraffin sections. In addition, stromal/inflammatory cells formed patches among adipocytes that were indicative of a local inflammatory response.
CL treatment significantly reduced the mean fat cell diameter in WT (P < 0.01), but not in KO mice (Fig. 2). Inspection of the distribution of cell sizes in KO mice, however, indicated that drug treatment doubled the percentage of cells with diameters >70 µm and <40 µm. This distribution of cell size was significantly different from control Ppara KO mice and CL-treated WT mice (P < 0.001, chi square test) and suggests a heterogeneous response of KO mice to CL whereby some cells mobilized lipid while others sequestered it.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 2. Effect of CL on the distribution of fat cell diameters in WT (A) and Ppara KO (B) mice. CL treatment reduced fat cell size uniformly in WT mice. In KO mice, CL treatment shifted fat cell sized toward extreme values, doubling the percentage of large (>70 µm) and small (<40 µm) fat cells. CTL, control.
|
|
BrdU incorporation.
In untreated controls, virtually no BrdU was detected in adipose tissue nuclei (data not shown), whereas CL treatment sharply increased nuclear BrdU incorporation in both WT and Ppara KO mice. After 7 days of labeling, BrdU was incorporated into several cell types, including stromal cells, endothelial cells, and small multilocular adipocytes in both genotypes (Fig. 3A). Compared with WT mice, Ppara KO mice had fewer labeled small multilocular adipocytes and more labeled stromal cells. Overall, the mitotic index was significantly greater in Ppara KO mice (P < 0.0001), although the temporal pattern of BrdU incorporation was similar in both genotypes (Fig. 3B). CL significantly increased expression of Pcna and mKi67, genes that are induced during cellular proliferation (P < 0.0001 and 0.0002, respectively), and peak expression of these genes corresponded to that of BrdU incorporation (Fig. 3C). Drug-induced expression of Pcna was significantly enhanced in Ppara KO mice (P < 0.004), but the trend for mKi67 expression did not reach statistical significance (P = 0.055).

View larger version (78K):
[in this window]
[in a new window]
|
Fig. 3. Effect of CL on adipose tissue mitogenesis in WT and Ppara KO mice. A: bromodeoxyuridine (BrdU) immunohistochemistry of EWAT from WT (left) and Ppara KO (right) mice. Mice were coinfused with CL and BrdU over a 7-day period. CL stimulated BrdU incorporation (red product) in stromal cells and in multilocular adipocytes. Bar = 50 µm. B: BrdU incorporation in adipose tissue of WT and KO mice during CL treatment. Total mitotic index was determined after labeling cells over the 2nd and 3rd day and 6th and 7th days of CL treatment. Mitogenic index was greatest during the first labeling period and was significantly greater in Ppara KO mice (n = 4). C: quantitative RT-PCR analysis of the proliferating cell nuclear antigen (Pcna) and antigen recognized by the monoclonal antibody Ki-67 (mKi67) in EWAT of WT and Ppara KO mice (n = 46). PPIA, peptidylprolyl isomerase A.
|
|
Physiological measures.
Basal metabolic rate did not differ significantly between WT and Ppara KO mice, whereas drug infusion increased metabolic rate in both genotypes (Fig. 4). Two-way ANOVA indicated that CL significantly raised metabolic rate regardless of whether indexed to body weight or whole animal (P < 0.0012). There was a trend for CL-induced elevation of metabolism to be less in KO mice, but the gene and gene by x drug interaction was not statistically significant. As with oxygen consumption measured at the whole animal level, CL treatment significantly elevated EWAT metabolic rate similarly both in WT and Ppara KO mice (CL effect, P < 0.0001; genotype effect, not significant).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4. Effect of CL on metabolic rate in WT and Ppara KO mice. Top: mouse oxygen consumption rate determined in lightly anesthetized mice, expressed per unit mass and per mouse (n = 57). Bottom: respiration rate of EWAT minces determined in vitro using polarographic oximetry, expressed per tissue mass and per pad (n = 68). Post hoc contrasts: *P < 0.05, **P < 0.01, and ***P < 0.001.
|
|
TTC is a redox-sensitive dye that provides a histological and biochemical measure of mitochondrial electron transport activity (21, 25, 26). In many tissues, TTC is concentrated in mitochondria where it is reduced by mitochondrial NADH oxidases; however, tetrazolium dyes can be reduced by other metabolic processes, such as NADPH oxidase (9). As shown in Fig. 5, CL treatment greatly increased the ability of EWAT pads to reduce TTC in WT mice and less so in Ppara KO mice (Fig. 5A). Extraction and quantitation of the reduced formazan (Fig. 5B) demonstrated CL treatment significantly increased reductase activity (P < 0.0001), and this effect was significantly reduced in Ppara KO mice (P < 0.0005).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 5. Effect of CL in the reduction of 2,3,5-triphenyltetrazolium chloride (TTC) in EWAT of WT and Ppara KO mice. A: photograph of whole EWAT pads stained with TTC ex vivo. CL-6d, CL-316,243 treatment for 6 days. B: quantification of TTC reduction in EWAT minces. CL significantly increased TTC reduction (P < 0.001), and this effect was significantly impaired in Ppara KO mice (P < 0.0005; n = 3). AU, arbitrary units.
|
|
To assess the cellular sites of elevated metabolism, tissue of WT and KO mice were incubated with TTC and counterstained with fluorescently labeled streptavidin, which selectively labels mitochondria in WAT (7). CL treatment increased streptavidin fluorescence in WT mice, particularly in the space between fragmented lipid droplets (Fig. 6). Streptavidin staining was less apparent in Ppara KO mice, as was the magnitude of lipid droplet fragmentation. Brightfield images indicated that TTC-formazan precipitates corresponded closely to regions of enhanced adipocyte streptavidin staining in WT mice. In contrast, TTC-formazan precipitates were not associated with adipocytes in Ppara KO mice. Rather, formazan precipitates were restricted to small stromal cells that lacked streptavidin fluorescence. Higher magnification clearly demonstrated that cellular TTC-formazan was restricted to stromal/inflammatory cells that in some cases completely surround unilocular adipocytes (Fig. 6F). Thus, although CL treatment increased electron transport activity of adipose tissue in both genotypes, the cellular sites of the elevated metabolism differed.

View larger version (84K):
[in this window]
[in a new window]
|
Fig. 6. Microscopic analysis of mitochondrial staining and TTC reduction in whole-mount EWAT of WT and Ppara KO mice treated with CL for 6 days. A: fluorescence micrograph of streptavidin-Alexa 555 staining of mitochondria in EWAT of WT mice. B: brightfield micrograph of field depicted in A showing reduced TTC formazan product. C: WT mice had elevated streptavidin-Alexa 555 staining in adipocytes, and TTC reduction corresponded to cellular areas of streptavidin-Alexa 555 staining. D: fluorescence micrograph of streptavidin-Alexa 555 staining of mitochondria in EWAT of Ppara KO mice. E: brightfield micrograph of field depicted in C showing the cellular localization of the TTC-formazan product. D and F: higher-magnification brightfield images of WT and Ppara KO WAT, respectively. Ppara KO adipocytes had relatively little streptavidin-Alexa 555 staining, and TTC-formazan was localized exclusively to stromal/immune cells.
|
|
Expression profiling.
Global expression profiling was performed on EWAT RNA pooled from four to six WT and Ppara KO mice. Genes in which expression was significantly changed (P < 0.01, Wilcoxon signed-rank test) were subjected to K-means clustering analysis, and clusters were inspected for patterns indicating an influence of genotype on drug-induced changes in gene expression.
One cluster, shown in Fig. 7A, contained 74 genes that were acutely downregulated and then recovered to be overexpressed by 6 days of drug treatment in WT mice. On average, genes in this cluster were upregulated 2.19-fold in WT mice. The early suppression of gene expression was intact in Ppara KO mice; however, the subsequent overexpression was severely attenuated. CL upregulated genes within this cluster in Ppara KO mice by 23%, a level that did not differ from control WT mice (0.99-fold). Evaluation of this cluster by Onto-Express indicates that 39 of 68 annotated genes are known to be targeted to mitochondria (GO: 0005739; P < 1 x 1014), and included genes involved in electron transport (GO: 0006118; P = 1.4 x 106) and fatty acid metabolism (GO: 0006631; P < 2.3 x 1011). These include genes involved in the activation/transport (carnitine acetyltransferase, carnitine palmitoyltransferase-2) and oxidation (Acadl, medium- and short-chain acyl-CoA dehydrogenases, dodecenoyl-CoA
-isomerase) of fatty acids.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 7. Expression profiling of EWAT of WT and Ppara KO mice during CL-induced tissue remodeling. A: visual representation of microarray analysis of RNA pooled from 46 mice/group. Each line represents a single gene, with lighter shades of gray corresponding to greater expression. Shown is K-means cluster analysis of genes in which expression was significantly changed during CL treatment (top) and a single cluster of genes that were upregulated in WT after 3 and 6 days of CL, but not in Para KO mice. B: quantitative RT-PCR (qRT-PCR) analysis of selected genes using RNA from individual mice. Cytochrome c oxidase subunit 8b (Cox8b), nuclear receptor binding factor-1 (Nrbf1), and long-chain acyl-CoA dehydrogenase (Acadl) were members of the cluster shown in the bottom of A, whereas pyruvate dehydrogenase kinase-4 (Pdk4) was not (n = 35).
|
|
Quantitative reverse transcription/PCR analysis of mRNA from individual mice confirmed that CL treatment increased Ppara expression 10-fold (P < 0.0005) in WT mice (Fig. 7B). Furthermore, upregulation of cluster members Acadl, Cox8b, and Nrbf1 was significantly attenuated in Ppara KO mice (all P < 0.01). Pdk4 is a gene involved in shifting substrate use toward fatty acid oxidation that was previously shown to be upregulated by CL in WAT (6). Although Pdk4 has been shown to be regulated by Ppara in some tissues (29, 34), it did not cluster with fatty acid oxidation genes in the microarray analysis, and its upregulation by CL (P = 0.006) was not significantly impaired in Ppara KO mice in the qRT-PCR analysis.
Two additional gene clusters that indicated strong involvement of Ppara contained genes that were expressed at low levels under control conditions and were immediately and strongly upregulated (Fig. 8). Expression of these genes in WT mice was restored to control levels by 3 or 6 days; however, expression of these genes in Ppara KO mice remained strongly upregulated. Analysis of the members of these clusters by OntoExpress indicated that these clusters were significantly enriched in genes involved in the immune response (GO: 000695; P = 4.5 x 1013), chemotaxis (GO: 006935; P = 4.0 x 1011), cellular extravasation (GO: 0045123; P = 5 x 107), and lysosome (GO: 0005764; P = 1.8 x 1012). Analysis by qRT-PCR (Fig. 8B) confirmed the augmented and sustained induction of mRNAs encoding proinflammatory cytokines Ccl2 (P < 0.005), Ccl9 (P < 0.0001), and Gro1 (Cxcl1; P < 0.05) during CL treatment in Ppara KO mice, suggesting that these cytokines might be important mediators of the local inflammatory response.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 8. Expression profiling of EWAT of WT and Ppara KO mice during CL-induced tissue remodeling. A: visual representation of microarray analysis as in Fig. 4, depicting a set of genes that were upregulated in Ppara KO mice at a time when Ppara was induced in WT mice. B: qRT-PCR analysis of selected genes using RNA from individual mice (n = 46). Ccl2, monocyte chemotactic protein-1; Ccl9, macrophage inflammatory protein-1.
|
|
As shown above, WAT of Ppara KO mice exhibited persistent signs of inflammation that were correlated with elevated tissue oxygen consumption and TTC reduction in inflammatory cells. One means of elevating nonmitochondrial oxygen consumption is by the induction and activation of NADPH oxidase, particularly in inflammatory cells. As shown in Fig. 9, CL treatment induced expression of cytochrome b-245,
-polypeptide (Cyba), a key subunit of NADPH oxidase, and F4/80 (Emr1), a macrophage marker. Both genes were similarly upregulated in both genotypes during the first 3 days of CL treatment. However, induction of these genes was completely normalized by 6 days in WT mice, whereas expression remained strongly upregulated in Ppara KO mice (P < 0.001, both genes).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 9. Effect of CL on Cyba and F4/80 (Emr1) expression in WT and Ppara KO mice. Cyba and Emr1 mRNAs were determined by qRT-PCR in 34 individual mice and by microarray analysis of RNA pooled from 46 mice (insets). ANOVA indicated significant genotype, drug, and interaction effects (P < 0.001).
|
|
 |
DISCUSSION
|
|---|
Chronic physiological and pharmacological activation of
-adrenergic signaling in adipocytes remodels WAT. Analysis of remodeling induced by pharmacological activation of Adrb3 with CL indicates that remodeling entails two temporally distinct components (7a). First, CL treatment induces an immediate proinflammatory response that is associated with the suppression of adipocyte-specific gene expression. Second, CL stimulates mitochondrial biogenesis and upregulates genes involved in the transport, activation, and oxidation of fatty acids. The upregulation of catabolic activity in WAT is present only after 3 days of treatment and is temporally correlated with the suppression of inflammatory responses and the restoration of adipocyte phenotypic expression. FFAs are known to induce proinflammatory signaling, and together these observations suggest that the expanded oxidative capacity of remodeled WAT limits inflammation and restores adipocyte-specific functions. The mechanisms that elevate mitochondrial oxidative capacity in WAT are unclear; however, global profiling identified a gene cluster enriched in genes involved in mitochondrial respiration and
-oxidation that included the nuclear receptor Ppara. The known functions of Ppara and its expression pattern suggested that this nuclear receptor is likely to play an important role in remodeling and provided the impetus for assessing its involvement with Ppara KO mice.
Ppara is known to be an important regulator of mitochondrial biogenesis and
-oxidation in tissues like heart and liver (1, 8). Ppara levels were very low in WAT of untreated mice and were upregulated by sevenfold after 6 days of CL treatment. This upregulation closely correlated with stimulation of mitochondrial biogenesis, induction of genes involved in fatty acid oxidation, and development of the multilocular adipocyte morphology in wild-type mice. Analysis of microarray data identified a set of genes whose upregulation at 3 and 6 days of drug treatment was severely compromised in Ppara KO animals. Fifty-eight percent of the genes in this cluster were nuclear genes that are targeted to mitochondria and include genes essential to the transport/activation and oxidation of fatty acids. Some of these genes, like the acyl-CoA dehydrogenases, are known targets of Ppara (8), and the present data suggest that genes like Nrbf1 and Cox8b are likely to be Ppara target genes that play a role in fatty acid metabolism as well. In this regard, Nrbf1 has recently been shown to be a novel mitochondrial 2-enoyl-CoA reductase (30) that has the potential of participating in futile cycling during fatty acid oxidation (11). Interestingly, the yeast homolog of Nrbf1, Ybr026c, is essential for formation of mitochondria, suggesting that Nrbf1 might also contribute to Ppara-mediated mitochondrial biogenesis (30).
The temporal expression pattern of Ppara was inversely correlated with local inflammatory responses in WT mice, and lack of Ppara resulted in overexpression of proinflammatory genes. Ppara levels are normally low in WAT, and it is important to note that the initial induction of proinflammatory cytokine expression was highly similar in WT and KO mice. Inflammatory gene expression, however, strongly diverged between genotypes at times when Ppara was upregulated in WT mice. These observations strongly indicate that upregulation of Ppara is essential to limiting inflammation during continuous CL treatment.
Elevated tissue oxygen consumption in WT mice was correlated with the generation of mitochondria in adipocytes and the induction of genes involved in fatty acid oxidation. When used as a latent marker of electron transport activity, TTC reduction was associated with adipocytes that were laden with newly generated mitochondria. These observations strongly indicate that the multilocular white adipocytes are a major site of increased respiration in WT mice. In contrast, upregulation of mitochondria and induction of mitochondrial electron transport genes were severely impaired in Ppara KO mice, as was the reduction of TTC. Nonetheless, CL treatment increased consumption of oxygen in WAT of Ppara KO mice. These data indicate that CL stimulates the nonmitochondrial consumption of oxygen WAT of KO mice. Using TTC to identify the cellular sites of redox activity, we found that the formazan product that was formed in WAT of KO mice was highly localized to stromal/inflammatory cells and not to adipocytes. Stromal/inflammatory cells did not stain with Alexa 555-streptavidin, and it is highly unlikely that TTC reduction represents mitochondrial respiration in these cells. The biochemical basis for the elevated oxygen consumption in Ppara KO mice is not certain, but it could involve elevated microsomal NADPH oxidase activity, particularly in inflammatory cells. NADPH oxidase subunits Cyba and cytochrome b-245,
-polypeptide (Cybb) were similarly upregulated in WT and Ppara KO at the beginning of CL treatment. Cyba and Cybb expression was completely normalized in WT mice when Ppara was upregulated. In contrast, NADPH oxidase subunit expression continued to rise in Ppara KO mice over this period and was upregulated 614 fold after 6 days of CL.
The metabolic and gene expression patterns were strongly reflected in the histological appearance of the adipose tissue. In WT mice, Adrb3 stimulation uniformly reduced cell size by fragmenting the central lipid droplet into multiple lipid droplets and generating new mitochondria that filled the space between lipid droplets. In KO mice, Adrb3 stimulation failed to expand mitochondrial oxidative metabolism in adipocytes and resulted in two populations of unilocular adipocytes with reduced and unchanged or elevated lipid stores. These observations suggest that lipid mobilization is suppressed in some adipocytes of Ppara KO mice. It is clear that stromal/immune cells are recruited to individual fat cells, presumably through the release of potent chemotaxic cytokines like Ccl2 and Ccl9, and it is likely that the localized inflammatory responses of these cells suppresses phenotypic functions, such as lipid mobilization in nearby adipocytes.
A working model for involvement of Ppara in adipose tissue remodeling is given in Fig. 10. This model proposes that a major role of Ppara is to direct mobilized fatty acids toward mitochondrial oxidation and away from extracellular efflux. Under control conditions, WAT has low capacity for fatty acid oxidation, and most fatty acids that are mobilized by Adrb3 activation are released. It is hypothesized that excessive fatty acid efflux evokes proinflammatory responses in resident stromal/adipophage and recruited myeloid cells and that this proinflammatory state suppresses fat cell function. Chronic Adrb3 stimulation sharply upregulates the expression and activity of Ppara, resulting in a greatly expanded capacity for oxidation of fatty acids within adipocytes. This expanded oxidative capacity limits fatty acid efflux, thereby limiting inflammation and restoring adipocyte functions. This model clearly favors the metabolic actions of Ppara in adipocytes and is consistent with the known proinflammatory effects of fatty acids, and the ability of chronic (but not acute) Adrb3 activation to lower circulating fatty acid levels (2, 14, 31). Additionally, Ppara could directly inhibit proinflammatory gene expression by suppressing the activity of nuclear factor-
B (3, 23, 27, 28). In either case, the present data indicate that Ppara plays a critical role in limiting WAT inflammation during chronic lipolytic activation.
An important unresolved question is the mechanism by which Adrb3 stimulation upregulates Ppara expression and activity. Protein kinase A has been shown to phosphorylate Ppara and increase its transcriptional activity, whereas lipolysis could provide agonists for the receptor (8, 18). Peroxisome proliferator-activated receptor-
coactivator-1
(Ppargc1a) is a cAMP-inducible coactivator that could affect the expression and activity of Ppara (24). Expression of Ppargc1a was too low to be detected by microarray; however, analysis by qRT-PCR indicated its expression peaked on the 1st day of CL treatment and recovered to control levels by 7 days. Thus Ppargc1a could be a triggering event; however, its expression does not appear to be coordinated with the upregulation of Ppara.
Recent work has shown that chronic obesity, like acute CL treatment, elevates inflammatory cytokine production in adipose tissue and recruits circulating monocytes/macrophages, although the mechanisms involved are poorly understood (13, 32, 33, 35). Chronic obesity is associated with excessive lipolysis (12, 20), and it is possible that fatty acids contribute to the proinflammatory state seen in obesity. The present results indicate that Ppara can be a key regulator of inflammatory signaling during lipolytic stress and that expanding
-oxidation in adipocytes could be an effective means of limiting WAT inflammation and its impact on systemic insulin sensitivity.
 |
GRANTS
|
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-062292 and DK-066505 and Michigan Economic Development Corporation Grant MLSC-27.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Todd Leff, Robert MacKenzie, Sorin Draghici, and H.-P. Moore for helpful comments.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: J. G. Granneman, CIMER/WSU, 111 Lande Research Bldg., 550 E. Canfield, Detroit, MI 48201 (e-mail: jgranne{at}med.wayne.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Barger PM and Kelly DP. PPAR signaling in the control of cardiac energy metabolism. Trends Cardiovasc Med 10: 238245, 2000.[CrossRef][Web of Science][Medline]
- Busch AK, Cordery D, Denyer GS, and Biden TJ. Expression profiling of palmitate- and oleate-regulated genes provides novel insights into the effects of chronic lipid exposure on pancreatic beta-cell function. Diabetes 51: 977987, 2002.[Abstract/Free Full Text]
- Cabrero A, Alegret M, Sanchez RM, Adzet T, Laguna JC, and Carrera MV. Increased reactive oxygen species production down-regulates peroxisome proliferator-activated alpha pathway in C2C12 skeletal muscle cells. J Biol Chem 277: 1010010107, 2002.[Abstract/Free Full Text]
- Cousin B, Cinti S, Morroni M, Raimbault S, Ricquier D, Penicaud L, and Casteilla L. Occurrence of brown adipocytes in rat white adipose tissue: molecular and morphological characterization. J Cell Sci 103: 931942, 1992.[Abstract/Free Full Text]
- Djouadi F, Weinheimer CJ, and Kelly DP. The role of PPAR alpha as a "lipostat" transcription factor. Adv Exp Med Biol 466: 211220, 1999.[Web of Science][Medline]
- Granneman JG, Burnazi M, Zhu Z, and Schwamb LA. White adipose tissue contributes to UCP1-independent thermogenesis. Am J Physiol Endocrinol Metab 285: E1230E1236, 2003.[Abstract/Free Full Text]
- Granneman JG, Li P, Lu Y, and Tilak J. Seeing the trees in the forest: selective electroporation of adipocytes within adipose tissue. Am J Physiol Endocrinol Metab 287: E574E582, 2004.[Abstract/Free Full Text]
- Granneman JG, Li P, Zhu Z, and Lu Y. Metabolic and cellular plasticity in white adipose tissue I: effects of B3-adrenergic receptor activation. Am J Physiol Endocrinol Metab 289: E608E616, 2005.[Abstract/Free Full Text]
- Gulick T, Cresci S, Caira T, Moore DD, and Kelly DP. The peroxisome proliferator-activated receptor regulates mitochondrial fatty acid oxidative enzyme gene expression. Proc Natl Acad Sci USA 91: 1101211016, 1994.[Abstract/Free Full Text]
- Hallett MB, Cole C, and Dewitt S. Detection and visualization of oxidase activity in phagocytes. Methods Mol Biol 225: 6167, 2003.[Medline]
- Himms-Hagen J, Melnyk A, Zingaretti MC, Ceresi E, Barbatelli G, and Cinti S. Multilocular fat cells in WAT of CL-316243-treated rats derive directly from white adipocytes. Am J Physiol Cell Physiol 279: C670C681, 2000.[Abstract/Free Full Text]
- Hinsch W, Klages C, and Seubert W. On the mechanism of malonyl-CoA-independent fatty-acid synthesis. Different properties of the mitochondrial chain elongation and enoylCoA reductase in various tissues. Eur J Biochem 64: 4555, 1976.[Web of Science][Medline]
- Johnson JA, Fried SK, Pi-Sunyer FX, and Albu JB. Impaired insulin action in subcutaneous adipocytes from women with visceral obesity. Am J Physiol Endocrinol Metab 280: E40E49, 2001.[Abstract/Free Full Text]
- Juge-Aubry CE, Somm E, Giusti V, Pernin A, Chicheportiche R, Verdumo C, Rohner-Jeanrenaud F, Burger D, Dayer JM, and Meier CA. Adipose tissue is a major source of interleukin-1 receptor antagonist: upregulation in obesity and inflammation. Diabetes 52: 11041110, 2003.[Abstract/Free Full Text]
- Kato H, Ohue M, Kato K, Nomura A, Toyosawa K, Furutani Y, Kimura S, and Kadowaki T. Mechanism of amelioration of insulin resistance by beta3-adrenoceptor agonist AJ-9677 in the KK-Ay/Ta diabetic obese mouse model. Diabetes 50: 113122, 2001.[Abstract/Free Full Text]
- Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, and Wahli W. Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin Invest 103: 14891498, 1999.[Web of Science][Medline]
- Khatri P, Bhavsar P, Bawa G, and Draghici S. Onto-Tools: an ensemble of web-accessible, ontology-based tools for the functional design and interpretation of high-throughput gene expression experiments. Nucleic Acids Res 32: W449W456, 2004.[Abstract/Free Full Text]
- Khatri P, Draghici S, Ostermeier GC, and Krawetz SA. Profiling gene expression using onto-express. Genomics 79: 266270, 2002.[CrossRef][Web of Science][Medline]
- Lazennec G, Canaple L, Saugy D, and Wahli W. Activation of peroxisome proliferator-activated receptors (PPARs) by their ligands and protein kinase A activators. Mol Endocrinol 14: 19621975, 2000.[Abstract/Free Full Text]
- Loncar D, Afzelius BA, and Cannon B. Epididymal white adipose tissue after cold stress in rats. I. Nonmitochondrial changes. J Ultrastruct Mol Struct Res 101: 109122, 1988.[CrossRef][Medline]
- Mauriege P, Prudhomme D, Lemieux S, Tremblay A, and Despres JP. Regional differences in adipose tissue lipolysis from lean and obese women: existence of postreceptor alterations. Am J Physiol Endocrinol Metab 269: E341E350, 1995.[Abstract/Free Full Text]
- Mii S and Green DE. Studies on the fatty acid oxidizing system of animal tissues. VIII. Reconstruction of fatty acid oxidizing system with triphenyltetrazolium as electron acceptor. Biochim Biophys Acta 13: 425432, 1954.[Medline]
- Miller WH Jr and Faust IM. Alterations in rat adipose tissue morphology induced by a low-temperature environment. Am J Physiol Endocrinol Metab 242: E93E96, 1982.[Abstract/Free Full Text]
- Poynter ME and Daynes RA. Peroxisome proliferator-activated receptor alpha activation modulates cellular redox status, represses nuclear factor-kappaB signaling, and reduces inflammatory cytokine production in aging. J Biol Chem 273: 3283332841, 1998.[Abstract/Free Full Text]
- Puigserver P, Wu Z, Park CW, Graves R, Wright M, and Spiegelman BM. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92: 829839, 1998.[CrossRef][Web of Science][Medline]
- Rich PR, Mischis LA, Purton S, and Wiskich JT. The sites of interaction of triphenyltetrazolium chloride with mitochondrial respiratory chains. FEMS Microbiol Lett 202: 181187, 2001.[CrossRef][Web of Science][Medline]
- Riepe MW, Niemi WN, Megow D, Ludolph AC, and Carpenter DO. Mitochondrial oxidation in rat hippocampus can be preconditioned by selective chemical inhibition of succinic dehydrogenase. Exp Neurol 138: 1521, 1996.[CrossRef][Web of Science][Medline]
- Spencer NF, Poynter ME, Im SY, and Daynes RA. Constitutive activation of NF-kappaB in an animal model of aging. Int Immunol 9: 15811588, 1997.[Abstract/Free Full Text]
- Staels B, Koenig W, Habib A, Merval R, Lebret M, Torra IP, Delerive P, Fadel A, Chinetti G, Fruchart JC, Najib J, Maclouf J, and Tedgui A. Activation of human aortic smooth-muscle cells is inhibited by PPARalpha but not by PPARgamma activators. Nature 393: 790793, 1998.[CrossRef][Medline]
- Sugden MC, Bulmer K, Gibbons GF, Knight BL, and Holness MJ. Peroxisome-proliferator-activated receptor-alpha (PPARalpha) deficiency leads to dysregulation of hepatic lipid and carbohydrate metabolism by fatty acids and insulin. Biochem J 364: 361368, 2002.[CrossRef][Web of Science][Medline]
- Torkko JM, Koivuranta KT, Miinalainen IJ, Yagi AI, Schmitz W, Kastaniotis AJ, Airenne TT, Gurvitz A, and Hiltunen KJ. Candida tropicalis Etr1p and Saccharomyces cerevisiae Ybr026p (Mrf1'p), 2-enoyl thioester reductases essential for mitochondrial respiratory competence. Mol Cell Biol 21: 62436253, 2001.[Abstract/Free Full Text]
- Tripathy D, Mohanty P, Dhindsa S, Syed T, Ghanim H, Aljada A, and Dandona P. Elevation of free fatty acids induces inflammation and impairs vascular reactivity in healthy subjects. Diabetes 52: 28822887, 2003.[Abstract/Free Full Text]
- Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, and Ferrante AW Jr. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 112: 17961808, 2003.[CrossRef][Web of Science][Medline]
- Wisse BE. The inflammatory syndrome: the role of adipose tissue cytokines in metabolic disorders linked to obesity. J Am Soc Nephrol 15: 27922800, 2004.[Abstract/Free Full Text]
- Wu P, Peters JM, and Harris RA. Adaptive increase in pyruvate dehydrogenase kinase 4 during starvation is mediated by peroxisome proliferator-activated receptor alpha. Biochem Biophys Res Commun 287: 391396, 2001.[CrossRef][Web of Science][Medline]
- Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, Sole J, Nichols A, Ross JS, Tartaglia LA, and Chen H. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J Clin Invest 112: 18211830, 2003.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
A. De Pauw, S. Tejerina, M. Raes, J. Keijer, and T. Arnould
Mitochondrial (Dys)function in Adipocyte (De)differentiation and Systemic Metabolic Alterations
Am. J. Pathol.,
September 1, 2009;
175(3):
927 - 939.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P. Mottillo, X. J. Shen, and J. G. Granneman
Role of hormone-sensitive lipase in beta-adrenergic remodeling of white adipose tissue
Am J Physiol Endocrinol Metab,
November 1, 2007;
293(5):
E1188 - E1197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mazzucotelli, N. Viguerie, C. Tiraby, J.-S. Annicotte, A. Mairal, E. Klimcakova, E. Lepin, P. Delmar, S. Dejean, G. Tavernier, et al.
The Transcriptional Coactivator Peroxisome Proliferator Activated Receptor (PPAR){gamma} Coactivator-1{alpha} and the Nuclear Receptor PPAR{alpha} Control the Expression of Glycerol Kinase and Metabolism Genes Independently of PPAR{gamma} Activation in Human White Adipocytes
Diabetes,
October 1, 2007;
56(10):
2467 - 2475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. G. Granneman, P. Li, Z. Zhu, and Y. Lu
Metabolic and cellular plasticity in white adipose tissue I: effects of {beta}3-adrenergic receptor activation
Am J Physiol Endocrinol Metab,
October 1, 2005;
289(4):
E608 - E616.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2005 by the American Physiological Society.