Am J Physiol Endocrinol Metab 289: E586-E590, 2005.
First published May 17, 2005; doi:10.1152/ajpendo.00090.2005
0193-1849/05 $8.00
Interleukin-6 is a negative regulator of visfatin gene expression in 3T3-L1 adipocytes
Susan Kralisch,1
Johannes Klein,2
Ulrike Lossner,1
Matthias Bluher,1
Ralf Paschke,1
Michael Stumvoll,1 and
Mathias Fasshauer1
1Department of Internal Medicine III, University of Leipzig, Leipzig; 2 Department of Internal Medicine I,University of Lübeck, Lübeck, Germany
Submitted 1 March 2005
; accepted in final form 11 May 2005
 |
ABSTRACT
|
|---|
Visfatin is a novel adipocytokine exerting insulin-mimetic effects in various insulin-sensitive tissues such as liver, muscle, and fat. In contrast, interleukin (IL)-6 is a proinflammatory adipose-secreted factor that induces insulin resistance and plasma concentrations that correlate with the development of type 2 diabetes mellitus. In the present study, the impact of IL-6 on visfatin gene expression in 3T3-L1 adipocytes was determined by quantitative real-time reverse transcription-polymerase chain reaction. Interestingly, 30 ng/ml IL-6 time-dependently downregulated visfatin synthesis with a significant 40% suppression seen after 4 h of treatment. Furthermore, the addition of IL-6 for 16 h dose-dependently suppressed visfatin mRNA with significant effects first observed at concentrations as low as 3 ng/ml and a maximal 43% reduction at 30 ng/ml effector. Moreover, inhibitor studies suggested that the negative effect of IL-6 on visfatin expression is, at least in part, mediated by p44/42 mitogen-activated protein kinase. In contrast, troglitazone did not reverse the negative effect of IL-6 on visfatin synthesis under these conditions. Taken together, our study suggests that IL-6 might influence glucose tolerance in part by regulation of the novel insulin-mimetic adipocytokine visfatin.
adipocytokine; diabetes mellitus; insulin resistance; obesity
INSULIN RESISTANCE and type 2 diabetes mellitus are frequently associated with obesity (10). In recent years, the connection between increased adiposity and impaired insulin responsiveness of target tissues has been better elucidated. Thus fat cells secrete various proteins called adipocytokines that influence insulin sensitivity profoundly.
Among those, interleukin (IL)-6 is a proinflammatory cytokine plasma, concentrations of which correlate with the development of type 2 diabetes mellitus (6). In accordance with these findings, administration of recombinant IL-6 in rodent models and in humans in vivo leads to hyperglycemia and compensatory hyperinsulinemia (22, 23). Because
25% of systemic IL-6 originates from subcutaneous adipocytes in vivo and omental fat cells secrete even two- to threefold more IL-6 than subcutaneous adipocytes in vitro, IL-6 is regarded as an adipocytokine (7, 15).
Most recently, by use of a differential display method, visfatin was isolated as a novel adipocytokine that is preferentially expressed in visceral compared with subcutaneous fat (8). Visfatin, which is identical to pre-B cell colony-enhancing factor (PBEF), was originally cloned as a cytokine-like growth factor, enhancing the effect of IL-7 and stem cell factor on early stage B cells (20). Fukuhara et al. (8) demonstrated convincingly that visfatin had insulin-mimetic effects in several animal models of insulin resistance and obesity in vivo. Moreover, addition of visfatin to 3T3-L1 adipocytes and L6 myocytes increased basal glucose uptake, and glucose release was suppressed from H4-II-E-C3 hepatocytes in vitro (8). Signaling studies suggested that visfatin directly stimulates the insulin receptor; however, the binding site appeared to be different from that for insulin (8). Interestingly, plasma visfatin concentrations correlated strongly with the amount of visceral fat in human subjects (8).
Thus the data accumulated so far suggest that visfatin is a novel adipocyte-secreted factor that strongly correlates to visceral obesity and has insulin-mimetic effects. However, it is not known whether proinflammatory IL-6 might impair glucose tolerance, at least in part, by downregulation of visfatin. In the present study, therefore, we examined the effect of IL-6 on visfatin gene expression in 3T3-L1 adipocytes in vitro. We demonstrate for the first time that IL-6 suppresses visfatin mRNA synthesis. Furthermore, we present evidence that this inhibitory effect is partially mediated via p44/42 mitogen-activated protein (MAP) kinase but is not reversible by troglitazone pretreatment under the conditions studied.
 |
MATERIALS AND METHODS
|
|---|
Materials.
Cell culture reagents were purchased from Life Technologies (Grand Island, NY). Oligonucleotides were purchased from MWG-Biotech (Ebersberg, Germany). Dexamethasone, IL-6, insulin, isobutylmethylxanthine, and troglitazone were purchased from Sigma Chemical (St. Louis, MO). Antibodies detecting phospho- or total p44/42 MAP kinase were purchased from Cell Signaling Technology (Beverly, MA).
Culture and differentiation of 3T3-L1 cells.
3T3-L1 cells (American Type Culture Collection, Rockville, MD) were differentiated as described (3). Briefly, confluent preadipocytes were cultured for 3 days in DMEM containing 25 mM glucose (DMEM-H), 10% fetal bovine serum, and antibiotics (culture medium) further supplemented with 1 µM insulin, 0.5 mM isobutylmethylxanthine, and 0.1 µM dexamethasone and 3 days in culture medium with 1 µM insulin. After this period, 3T3-L1 cells were grown for 36 more days in culture medium, after which at least 95% of the cells had accumulated fat droplets. IL-6 treatment was performed in DMEM-H without any additions.
Analysis of visfatin mRNA.
Visfatin mRNA expression was determined by quantitative real-time RT-PCR in a fluorescent temperature cycler (ABI Prism 7000; Applied Biosystems, Darmstadt, Germany), as described previously (1). In brief, total RNA was isolated from 3T3-L1 adipocytes with TRIzol reagent (Life Technologies). RNA (1 µg) was reverse transcribed using standard reagents (Life Technologies), and 2 µl of each RT reaction was amplified in a 26-µl PCR. Samples were incubated in the ABI Prism 7000 for an initial denaturation at 95°C for 10 min. Then, 40 PCR cycles were performed using the following conditions: 95°C for 15 s, 60°C for 1 min, and 72°C for 1 min. The following primer pairs were used: visfatin (accession no. NM-021524) TCGGTTCTGGTGGCGCTTTGCTAC (sense) and AAGTTCCCCGCTGGTGTCCTATGT (antisense); and 36B4 (accession no. NM-007475) AAGCGCGTCCTGGCATTGTCT (sense) and CCGCAGGGGCAGCAGTGGT (antisense). SYBR Green I fluorescence emissions were determined after each cycle, and synthesis of visfatin and 36B4 mRNA was quantified using the second derivative maximum method of the ABI Prism 7000 software (Applied Biosystems). This method determines the crossing points of individual samples by an algorithm identifying the first turning point of the fluorescence curve. Visfatin synthesis was calculated relative to 36B4, which was used as an internal control due to its resistance to hormonal regulation (13). Specific transcripts were confirmed by melting-curve profiles (cooling the sample to 68°C and heating slowly to 95°C with measurement of fluorescence) at the end of each PCR, and the specificity of the PCR was further verified by subjecting the amplification products to agarose gel electrophoresis.
Western blotting.
Western blotting was performed essentially as described (11). Briefly, cells were harvested in lysis buffer (50 mM HEPES, 137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM Na4P2O7, 10 mM NaF, 2 mM EDTA, 10% glycerol, 1% Igepal CA-630, 2 mM vanadate, 2 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 10 µg/ml aprotinin, pH 7.4) and lysates were clarified. Equal amounts of protein were resolved by SDS-PAGE, transferred to nitrocellulose membranes, blocked for 1 h, and immunoblotted with p44/42 MAP kinase antibodies for 2 h. Specifically bound primary antibodies were detected with peroxidase-coupled secondary antibody and enhanced chemiluminescence.
Statistical analysis.
Results are shown as means ± SE. Differences between various treatments were analyzed by unpaired Student's t-tests with P values <0.01 considered highly significant and <0.05 considered significant.
 |
RESULTS
|
|---|
Measurement of visfatin mRNA levels in 3T3-L1 adipocytes.
First, the reliability of the quantitative real-time RT-PCR method was tested. For this purpose, increasing amounts of reverse-transcribed total cellular RNA were quantified with specific primer pairs for visfatin (Fig. 1). Linearity between total RNA used per reaction and amount of mRNA measured by the ABI Prism 7000 software was obtained between 2 and 200 ng of total RNA (Fig. 1).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1. Measurement of visfatin mRNA levels in 3T3-L1 adipocytes. Increasing amounts of total RNA from fully differentiated 3T3-L1 cells were subjected to quantitative real-time RT-PCR with primers specific for visfatin, as described in MATERIALS AND METHODS. Data are expressed relative to mRNA levels measured with 200 ng RNA (=100%). Inset: agarose gel electrophoresis of the PCR product at cycle 25.
|
|
Visfatin mRNA expression is downregulated by IL-6.
We tested whether the adipocytokine IL-6 might influence visfatin synthesis in 3T3-L1 adipocytes in vitro. In fact, IL-6 treatment for 16 h significantly decreased visfatin mRNA in a dose-dependent manner (Fig. 2). A significant 31% downregulation was first seen at concentrations as low as 3 ng/ml IL-6 and maximal 43% suppression of visfatin mRNA at 30 ng/ml effector (P < 0.01; Fig. 2). Moreover, the negative effect of IL-6 was time dependent (Fig. 3). Thus significant 40% downregulation of visfatin mRNA was first seen after 4 h of treatment, and suppression persisted for
24 h (P < 0.01; Fig. 3).

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 2. Dose-dependent inhibition of visfatin mRNA by IL-6. Differentiated 3T3-L1 cells were serum starved for 6 h before various concentrations of IL-6 were added for 16 h. Extraction of total RNA and quantitative real-time RT-PCR determining visfatin mRNA levels normalized to 36B4 expression were performed as described in MATERIALS AND METHODS. Data are shown relative to untreated control (Con) cells (=100%) and represent means ± SE of 3 independent experiments. **P < 0.01, *P < 0.05 comparing IL-6-treated with untreated Con cells.
|
|

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 3. Time-dependent inhibition of visfatin synthesis by IL-6. After overnight serum deprivation, 3T3-L1 fat cells were treated with IL-6 (30 ng/ml) for the indicated time periods. Total RNA was extracted and subjected to quantitative real-time RT-PCR as described in MATERIALS AND METHODS. Visfatin mRNA levels normalized to 36B4 expression were determined relative to untreated control cells (=100%). Data represent means ± SE of 3 independent experiments. **P < 0.01 comparing IL-6-treated with untreated adipocytes.
|
|
Effect of IL-6 is partly mediated by p44/42 MAP kinase.
We tested whether signaling proteins such as Janus kinase 2 (JAK2), p44/42 MAP kinase, p38 MAP kinase, and phosphatidylinositol (PI) 3-kinase, which have been implicated in IL-6 signaling, might play a role in downregulation of visfatin mRNA. For this purpose, 3T3-L1 adipocytes were pretreated with specific pharmacological inhibitors for 1 h before IL-6 (30 ng/ml) was added for 16 h. The PI 3-kinase inhibitor LY-294002 (10 µM) alone significantly downregulated basal visfatin mRNA expression to 45% of the levels seen in untreated control cells (P < 0.01; Fig. 4A). In contrast, inhibition of JAK2, p44/42 MAP kinase, and p38 MAP kinase with AG-490 (10 µM), PD-98059 (50 µM), and SB-203580 (20 µM), respectively, did not significantly influence basal visfatin mRNA synthesis (Fig. 4A). Again, visfatin mRNA was downregulated to 47% of control levels after 16 h of IL-6 treatment (P < 0.01; Fig. 4A). Interestingly, inhibition of p44/42 MAP kinase by PD-98059 significantly reversed this inhibition to 75% of the expression seen in untreated adipocytes (P < 0.05; Fig. 4A). In contrast, inhibition of JAK2, p38 MAP kinase, and PI 3-kinase did not significantly influence suppression of visfatin mRNA by IL-6 (Fig. 4A). Furthermore, we determined whether IL-6 directly stimulates p44/42 MAP kinase phosphorylation. Treatment of 3T3-L1 adipocytes with 30 ng/ml IL-6 time-dependently increased phosphorylation of p44/42 MAP kinase with maximal effects that were detectable 15 min after effector addition (Fig. 4B). Furthermore, IL-6-induced p44/42 MAP kinase phosphorylation could be completely inhibited by pretreatment with 50 µM PD-98059 (Fig. 4C).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 4. Inhibition of visfatin expression by IL-6 is mediated in part via p44/42 MAP kinase. A: after 5 h of serum starvation, differentiated 3T3-L1 adipocytes were cultured in the presence or absence of AG-490 (AG, 10 µM), PD-98059 (PD, 50 µM), SB-203580 (SB, 20 µM), or LY-294002 (LY, 10 µM) for 1 h before IL-6 (30 ng/ml) was added for additional 16 h. After total RNA extraction, quantitative real-time RT-PCR was performed as described in MATERIALS AND METHODS. Visfatin mRNA expression normalized to 36B4 is expressed relative to untreated Con cells (=100%). Results are means ± SE of 3 independent experiments. **P < 0.01 comparing untreated with IL-6- and LY-294002-treated cells; *P < 0.05 comparing IL-6-treated with PD-98059-pretreated adipocytes. IL-6 (30 ng/ml) was added for the indicated time periods (B) or for 30 min (C) in the presence or absence of PD-98059 pretreatment (50 µM, 17 h). Western blotting was performed as described in MATERIALS AND METHODS. Representative blots from 2 independent experiments are shown.
|
|
Troglitazone does not affect downregulation of visfatin by IL-6 and TNF-
.
We determined whether the thiazolidinedione troglitazone might affect downregulation of visfatin by IL-6. Treatment of 3T3-L1 cells with 10 µM troglitazone reduced basal visfatin expression to 79% of controls; however, this effect did not reach statistical significance (P > 0.05; Fig. 5). Again, IL-6 downregulated visfatin expression to 69% of controls (P < 0.01; Fig. 5). Interestingly, this decrease was not significantly reversed by troglitazone pretreatment under these conditions (Fig. 5). Furthermore, we have recently shown that TNF-
downregulates visfatin expression (12). In accord with these results, treatment of 3T3-L1 cells with 20 ng/ml TNF-
reduced visfatin expression by 25% (P < 0.05; Fig. 5). Again, troglitazone pretreatment did not influence this downregulation, similar to the data obtained with IL-6 (Fig. 5).
 |
DISCUSSION
|
|---|
In the present study, we show for the first time that visfatin expression is inhibited by IL-6 in fat cells in vitro. Several mechanisms by which IL-6 influences glucose tolerance have been suggested in recent years. Thus IL-6, similar to TNF
, impairs insulin signaling in fat cells and hepatocytes, a mechanism that might be mediated by suppressor of cytokine signaling proteins (5, 19, 21). Furthermore, we have recently demonstrated paracrine downregulation of insulin-sensitizing adiponectin (4), as well as stimulation of insulin resistance-inducing monocyte chemoattractant protein-1 (2), in fat cells by IL-6. Our present findings suggest that IL-6-mediated downregulation of the insulin-mimetic visfatin in fat may be a novel mechanism by which this adipocytokine impairs glucose tolerance. Furthermore, because IL-6 plasma levels increase with body weight, its effect on adipose cells probably does not contribute to increased visfatin levels found in obesity (8). However, it has to be pointed out that visfatin is not exclusively expressed in fat and that regulation of this adipocytokine by IL-6 might be different in other tissues. In fact, Ognjanovic et al. (17) have demonstrated significant induction of visfatin (=PEBF) mRNA expression after IL-6 treatment in amniotic epithelial cells. Clearly, more work is needed to determine the expression and regulation of visfatin in other insulin-sensitive tissues, including liver and muscle, to better understand its role in glucose metabolism.
The major steps in IL-6 signaling have been elucidated in more detail in recent years. IL-6 induces gp130 homodimerization at the plasma membrane, and gp130-associated kinases such as JAK1, JAK2, and tyrosine kinase 2 become activated and phosphorylate the cytoplasmic tail of gp130 (9, 16). In the present study, we show that pharmacological inhibition of JAK2 by AG-490 does not reverse inhibition of visfatin mRNA synthesis by IL-6. These data suggest that kinases apart from JAK2, such as JAK1, might mediate the negative effect of IL-6 on visfatin mRNA. Downstream signaling proteins such as p44/42 MAP kinase, p38 MAP kinase, and PI 3-kinase are activated by signal transducer and activator of transcription-1 and -3, as well as Src homology 2 (SH2)-domain-containing tyrosine phosphatase-2, which bind to the tyrosine-phosphorylated gp130 (9). In the present study, we confirm that IL-6 potently induces p44/42 MAP kinase phosphorylation. Because effective pharmacological inhibition of p44/42 MAP kinase by PD-98059 partly reverses inhibition of visfatin expression, this molecule appears to mediate some of the negative effect of IL-6. Moreover, PI 3-kinase appears as a positive regulator of basal visfatin synthesis in fat cells because inhibition of this signaling protein leads to significantly lower mRNA levels of this adipocytokine. In contrast, p38 MAP kinase is probably not involved in visfatin regulation.
Insulin-sensitizing thiazolidinediones that activate peroxisome proliferator-activated receptor (PPAR)
prevent certain actions of IL-6- and TNF-
related to insulin resistance in 3T3-L1 adipocytes (14, 18). Thus troglitazone or pioglitazone pretreatment reverses the reduction in insulin receptor or insulin receptor substrate-1 phosporylation caused by TNF-
(18). Furthermore, rosiglitazone reestablishes insulin-induced lipogenesis impaired by IL-6 (14). In the current study, PPAR
activation by troglitazone is not sufficient to reverse IL-6- and TNF-
-induced visfatin downregulation, implying that this nuclear hormone receptor is not primarily involved in regulation of visfatin by IL-6 and TNF-
under the conditions studied.
Taken together, our results demonstrate for the first time significant suppression of visfatin gene expression in 3T3-L1 adipocytes by IL-6. Furthermore, we present evidence that this effect is mediated in part via p44/42 MAP kinase and that PI 3-kinase may have a role in maintaining basal visfatin expression. Because visfatin has been suggested as a novel insulin-mimetic adipocytokine, downregulation of this factor by IL-6 in fat might play a role in the pathogenesis of the insulin resistance syndrome.
 |
GRANTS
|
|---|
This work was supported by a grant of the Deutsche Forschungsgemeinschaft (FA-376/3-1) and the Deutsche Diabetes Gesellschaft to M. Fasshauer.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: M. Fasshauer, Ph.-Rosenthal-Str.27, 04103 Leipzig, Germany. (e-mail: mathias.fasshauer{at}medizin.uni-leipzig.de)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Fasshauer M, Klein J, Kralisch S, Klier M, Lossner U, Bluher M, and Paschke R. Growth hormone is a positive regulator of adiponectin receptor 2 in 3T3-L1 adipocytes. FEBS Lett 558: 2732, 2004.[CrossRef][ISI][Medline]
- Fasshauer M, Klein J, Kralisch S, Klier M, Lossner U, Bluher M, and Paschke R. Monocyte chemoattractant protein 1 expression is stimulated by growth hormone and interleukin-6 in 3T3-L1 adipocytes. Biochem Biophys Res Commun 317: 598604, 2004.[CrossRef][ISI][Medline]
- Fasshauer M, Klein J, Neumann S, Eszlinger M, and Paschke R. Isoproterenol inhibits resistin gene expression through a G(S)-protein-coupled pathway in 3T3-L1 adipocytes. FEBS Lett 500: 6063, 2001.[CrossRef][ISI][Medline]
- Fasshauer M, Kralisch S, Klier M, Lossner U, Bluher M, Klein J, and Paschke R. Adiponectin gene expression and secretion is inhibited by interleukin-6 in 3T3-L1 adipocytes. Biochem Biophys Res Commun 301: 10451050, 2003.[CrossRef][ISI][Medline]
- Fasshauer M, Kralisch S, Klier M, Lossner U, Bluher M, Klein J, and Paschke R. Insulin resistance-inducing cytokines differentially regulate SOCS mRNA expression via growth factor- and Jak/Stat signaling pathways in 3T3-L1 adipocytes. J Endocrinol 181: 129138, 2004.[Abstract]
- Fasshauer M and Paschke R. Regulation of adipocytokines and insulin resistance. Diabetologia 46: 15941603, 2003.[CrossRef][ISI][Medline]
- Fried SK, Bunkin DA, and Greenberg AS. Omental and subcutaneous adipose tissues of obese subjects release interleukin-6: depot difference and regulation by glucocorticoid. J Clin Endocrinol Metab 83: 847850, 1998.[Abstract/Free Full Text]
- Fukuhara A, Matsuda M, Nishizawa M, Segawa K, Tanaka M, Kishimoto K, Matsuki Y, Murakami M, Ichisaka T, Murakami H, Watanabe E, Takagi T, Akiyoshi M, Ohtsubo T, Kihara S, Yamashita S, Makishima M, Funahashi T, Yamanaka S, Hiramatsu R, Matsuzawa Y, and Shimomura I. Visfatin: a protein secreted by visceral fat that mimics the effects of insulin. Science 307: 426430, 2005.[Abstract/Free Full Text]
- Heinrich PC, Behrmann I, Muller-Newen G, Schaper F, and Graeve L. Interleukin-6-type cytokine signaling through the gp130/Jak/STAT pathway. Biochem J 334: 297314, 1998.
- Kahn BB and Flier JS. Obesity and insulin resistance. J Clin Invest 106: 473481, 2000.[ISI][Medline]
- Klein J, Fasshauer M, Ito M, Lowell BB, Benito M, and Kahn CR. Beta(3)-adrenergic stimulation differentially inhibits insulin signaling and decreases insulin-induced glucose uptake in brown adipocytes. J Biol Chem 274: 3479534802, 1999.[Abstract/Free Full Text]
- Kralisch S, Klein J, Lossner U, Bluher M, Paschke R, Stumvoll M, and Fasshauer M. Hormonal regulation of the novel adipocytokine visfatin in 3T3-L1 adipocytes. J Endocrinol 185: R1R8 2005.[Abstract/Free Full Text]
- Laborda J. 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Res 19: 3998, 1991.[Free Full Text]
- Lagathu C, Bastard JP, Auclair M, Maachi M, Capeau J, and Caron M. Chronic interleukin-6 (IL-6) treatment increased IL-6 secretion and induced insulin resistance in adipocyte: prevention by rosiglitazone. Biochem Biophys Res Commun 311: 372379, 2003.[CrossRef][ISI][Medline]
- Mohamed-Ali V, Goodrick S, Rawesh A, Katz DR, Miles JM, Yudkin JS, Klein S, and Coppack SW. Subcutaneous adipose tissue releases interleukin-6, but not tumor necrosis factor-alpha, in vivo. J Clin Endocrinol Metab 82: 41964200, 1997.[Abstract/Free Full Text]
- Murakami M, Hibi M, Nakagawa N, Nakagawa T, Yasukawa K, Yamanishi K, Taga T, and Kishimoto T. IL-6-induced homodimerization of gp130 and associated activation of a tyrosine kinase. Science 260: 18081810, 1993.[Abstract/Free Full Text]
- Ognjanovic S, Bao S, Yamamoto SY, Garibay-Tupas J, Samal B, and Bryant-Greenwood GD. Genomic organization of the gene coding for human pre-B-cell colony enhancing factor and expression in human fetal membranes. J Mol Endocrinol 26: 107117, 2001.[Abstract]
- Peraldi P, Xu M, and Spiegelman BM. Thiazolidinediones block tumor necrosis factor-alpha-induced inhibition of insulin signaling. J Clin Invest 100: 18631869, 1997.[ISI][Medline]
- Rotter V, Nagaev I, and Smith U. Interleukin-6 (IL-6) induces insulin resistance in 3T3-L1 adipocytes and is, like IL-8 and tumor necrosis factor-alpha, overexpressed in human fat cells from insulin-resistant subjects. J Biol Chem 278: 4577745784, 2003.[Abstract/Free Full Text]
- Samal B, Sun Y, Stearns G, Xie C, Suggs S, and McNiece I. Cloning and characterization of the cDNA encoding a novel human pre-B-cell colony-enhancing factor. Mol Cell Biol 14: 14311437, 1994.[Abstract/Free Full Text]
- Senn JJ, Klover PJ, Nowak IA, and Mooney RA. Interleukin-6 induces cellular insulin resistance in hepatocytes. Diabetes 51: 33913399, 2002.[Abstract/Free Full Text]
- Stith RD and Luo J. Endocrine and carbohydrate responses to interleukin-6 in vivo. Circ Shock 44: 210215, 1994.[ISI][Medline]
- Tsigos C, Papanicolaou DA, Kyrou I, Defensor R, Mitsiadis CS, and Chrousos GP. Dose-dependent effects of recombinant human interleukin-6 on glucose regulation. J Clin Endocrinol Metab 82: 41674170, 1997.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
T. Luk, Z. Malam, and J. C. Marshall
Pre-B cell colony-enhancing factor (PBEF)/visfatin: a novel mediator of innate immunity
J. Leukoc. Biol.,
April 1, 2008;
83(4):
804 - 816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Sun, J. Bishop, S. Khalili, S. Vasdev, V. Gill, D. Pace, D. Fitzpatrick, E. Randell, Y.-G. Xie, and H. Zhang
Serum visfatin concentrations are positively correlated with serum triacylglycerols and down-regulated by overfeeding in healthy young men
Am. J. Clinical Nutrition,
February 1, 2007;
85(2):
399 - 404.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Bailey, J C. Loredo-Osti, P. Lepage, J. Faith, J. Fontaine, K. M. Desbiens, T. J. Hudson, C. Bouchard, D. Gaudet, L. Perusse, et al.
Common Polymorphisms in the Promoter of the Visfatin Gene (PBEF1) Influence Plasma Insulin Levels in a French-Canadian Population.
Diabetes,
October 1, 2006;
55(10):
2896 - 2902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S Kralisch, U Lossner, M Bluher, R Paschke, M Stumvoll, and M Fasshauer
Tissue inhibitor of metalloproteinase 1 expression and secretion are induced by {beta}-adrenergic stimulation in 3T3-L1 adipocytes.
J. Endocrinol.,
June 1, 2006;
189(3):
665 - 670.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2005 by the American Physiological Society.