Am J Physiol Endocrinol Metab 289: E123-E132, 2005;
doi:10.1152/ajpendo.00562.2004
0193-1849/05 $8.00
Increased cathepsin D release by Hyp mouse osteoblast cells
Naoko Matsumoto,
Oak D. Jo,
Remi N. J. Shih,
Elsa J. Brochmann,
Samuel S. Murray,
Victor Hong,
Jane Yanagawa, and
Norimoto Yanagawa
Medical and Research Services, Greater Los Angeles Veterans Affairs Healthcare System at Sepulveda, Sepulveda; and Department of Medicine, School of Medicine, University of California at Los Angeles, Los Angeles, California
Submitted 29 November 2004
; accepted in final form 15 February 2005
 |
ABSTRACT
|
|---|
The X-linked hypophosphatemia (XLH), the most common form of hereditary rickets, is caused by loss-of-function mutations of PHEX (phosphate-regulating gene with homology to endopeptidases on the X chromosome) leading to rachitic bone disease and hypophosphatemia. Available evidence today indicates that the bone defect in XLH is caused not only by hypophosphatemia and altered vitamin D metabolism but also by factor(s) locally released by osteoblast cells (ObCs). The identity of these ObC-derived pathogenic factors remains unclear. In our present study, we report our finding of a prominent protein in the culture media derived from ObC of the hypophosphatemic (Hyp) mice, a murine homolog of human XLH, which was identified as the murine procathepsin D (Cat D). By metabolic labeling studies, we further confirmed that Hyp mouse ObCs released greater amount of Cat D into culture media. This increased Cat D release by Hyp mouse ObCs was unlikely to be due to nonspecific cell damage or heterogeneous cell population and was found to be associated with an increased Cat D expression at the protein level, possibly due to a reduced Cat D degradation. However, we were not able to detect a direct effect of PHEX protein on Cat D cleavage. In support of the involvement of Cat D in mediating the inhibitory effect of Hyp mouse ObC-conditioned media on ObC calcification, we found that exposure to Cat D inhibited ObC 45Ca incorporation and that inhibition of Cat D abolished the inhibitory effect of Hyp mouse-conditioned media on ObC calcification. In conclusion, results from our present study showed that Hyp mouse ObCs release a greater amount of Cat D, which may contribute to the inhibitory effect of Hyp mouse ObC-conditioned media on ObC mineralization.
hypophosphatemia; rickets; bone; pepstatin
X-LINKED HYPOPHOSPHATEMIA (XLH) is an X-linked dominant disorder characterized by rachitic bone disease and hypophosphatemia with renal phosphate wasting (38). Since its first description by Albright et al. in 1937 (1), significant progress has been made in our understanding of this disorder, aided particularly by the discovery of a murine homolog, the hypophosphatemic (Hyp) mouse in 1976 (15), and the identification of the XLH candidate gene PHEX (phosphate-regulating gene with homology to endopeptidases on the X chromosome) in 1995 (39). Prevailing evidence today suggests that inactivating mutations of PHEX in bones and possibly other tissues lead to the release of factors that cause renal phosphate wasting and a bone mineralization defect (30).
However, despite extensive studies performed in Hyp mice and XLH patients, the etiology of the bone mineralization defect in XLH remains poorly understood. Although factors extrinsic to the bone, such as hypophosphatemia and deranged vitamin D metabolism, can contribute to the bone defect, available evidence indicates that the bone mineralization defect is also caused by intrinsic abnormalities in bones. Thus bone cross-transplant studies showed that the Hyp mouse bone defect could not be completely corrected after transplantation into the normal mouse (1214). Similarly, ex vivo cultures of Hyp mouse osteoblast cells (ObCs) showed impaired mineralization even after prolonged cultivation (26, 42). Recent studies also showed that the restoration of Phex function to Hyp mouse ObC enabled partial correction of the bone defect despite the persistent hypophosphatemia and vitamin D abnormality (23, 3). Finally, the observation that normal mouse ObC calcification was suppressed when cocultured with Hyp mouse ObC or exposed to conditioned media derived from Hyp mouse ObC provided more direct evidence for the involvement of locally released pathogenic factor(s) (26, 42). The identity of this ObC-derived pathogenic factor(s) remains unknown.
In search of the ObC-derived pathogenic factor(s) from Hyp mouse ObC-conditioned media, we found in our present study that primary cultured Hyp mouse ObC released a greater amount of cathepsin D (Cat D) into culture media and obtained evidence implicating the role of Cat D in mediating the inhibitory effect of Hyp mouse ObC-conditioned media on ObC calcification.
 |
METHODS
|
|---|
Animals.
Breeding pairs of heterozygous female Hyp C57BL/6J mice and wild-type male C57BL/6J mice were originally obtained from Jackson Laboratory (Bar Harbor, ME) to maintain a continuous supply of wild-type and Hyp mice. Offspring Hyp mice were identified from the wild-type normal mice at age 46 wk by their characteristic Hyp phenotypes, including hypophosphatemia (2.96 ± 0.17 vs. 5.43 ± 0.21 mg/dl, n = 20; P < 0.01) and short tail length (5.88 ± 0.09 vs. 7.93 ± 0.11 cm, n = 20; P < 0.01). All mice were housed in a climate-controlled vivarium and maintained on an ad libitum diet of standard mouse chow with free access to tap water for drinking. All experiments received prior approval from our Institutional Animal Care and Use Committee.
In vitro cell cultures.
The human ObC cell line, MG-63, was obtained from American Type Culture Collection (Manassas, VA), and the primary ObC cultures were grown from either femurs or calvaria obtained from normal and Hyp mice at age 68 wk. For ObC cultures from femurs, bones were first stripped of connective and muscle tissues aseptically and cleaned of bone marrow using sterile PBS with a 27-gauge needle. Bone chips were then subjected to collagenase (type IV, 1 mg/ml) digestion at 24°C for 20 min and placed in 60-mm Petri dishes (Nunc Interlab, Thousand Oaks, CA). For ObC cultures from calvaria, fragments of frontal and parietal bone were aseptically removed. After suture lines and endosteum were carefully dissected away, bone fragments were positioned on top of an inverted culture plate insert (Falcon Cell Strainer; Becton-Dickinson, Franklin Lakes, NJ) in a culture dish with endocranial surfaces facing downward. ObCs were grown in DMEM (Irvine Scientific, Santa Ana, CA) supplemented with 15% fetal calf serum (Omega Scientific, Tarzana, CA),
-glycerophosphate (10 mM), and ascorbate (0.28 mM). Cells were kept in a humidified atmosphere of 5% CO2-95% air, and the culture medium was changed every 34 days. For serial passages, cells were trypsinized with 0.1% trypsin in Ca2+-free and Mg2+-free PBS (Fisher Scientific, Pittsburgh, PA) also containing 0.5 mM EDTA and plated in appropriately sized culture plates. Cells were generally used at 2 wk after seeding and were serum deprived for 24 h before experiments. Conditioned media were collected after 48 h of incubation with confluent cells in serum-free culture media. Because both femoral and calvarial ObCs produced similar results, data from these two groups of ObCs were pooled.
Two-dimensional SDS-PAGE and protein identification.
Two-dimensional (2D) electrophoresis was performed according to the method of OFarrell (29). In brief, isoelectric focusing was carried out in glass tubes of inner diameter 2.0 nm using 2% pH 3.510 ampholines (Pharmacia, Baltimore, MD) for 9,600 V-h. To each sample, 50 ng of an IEF internal standard, tropomyosin (molecular weight 33,000, isoelectric point = 5.2) was added (arrowheads in Fig. 1). The enclosed tube gel pH gradient plot for this set of ampholines was determined with a surface pH electrode. After equilibration for 10 min in a buffer containing 10% glycerol, 50 mM dithiothreitol (DTT), 2.3% SDS, and 0.0625 M Tris (pH 6.8), the tube gel was sealed to the top of a stacking gel, which was on top of a 10% acrylamide slab gel. SDS slab gel electrophoresis was carried out for
4 h at 12.5 mA/gel, and proteins were visualized by silver staining. The protein spots of interest were excised and digested with endoprotease Lys-C, and the amino acid sequences of the resulting peptides were analyzed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS; HHMI Protein Core, Columbia Univ., New York, NY). We analyzed the amino acid sequences thus obtained using the Swiss-Prot protein database.

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 1. Protein analysis by two-dimensional electrophoreses (2D SDS-PAGE). Proteins contained in the normal and Hyp mouse osteoblast cell (ObC)-conditioned media were separated by 2D SDS-PAGE and visualized by silver staining. Compared with the normal mouse sample (left), the Hyp mouse sample (right) showed prominent protein bands at 50-kDa size with varying isoelectric points (circled). The same prominent protein bands were consistently found in at least 4 other pairs of samples examined. These protein spots were excised and digested with endoprotease Lys-C, and the amino acid sequences of the resulting peptides were analyzed by matrix-assisted laser desorption ionization-time of flight mass spectrometry. Amino acid sequences thus obtained were analyzed using the Swiss-Prot protein database, and the original protein was identified as the murine pro-cathepsin D (Cat D).
|
|
Metabolic labeling studies.
Cells were first incubated in methionine-cysteine-free DMEM (GIBCO, Carlsbad, CA) for 2 h at 37°C and labeled overnight at 37°C by adding Tran35S label (10 mCi/ml) (ICN Biochemicals, Irvine, CA) to DMEM. The media were removed after labeling, and cells washed with PBS before DMEM containing 2 mM methionine-cysteine was added. After incubation at 37°C for indicated time periods, media were collected, and cells were washed and scraped in PBS and centrifuged; the cell pellet was lysed in triple-detergent lysis buffer containing 50 mM Tris·HCl, pH 8.0, 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 100 µg/ml PMSF, 1 µg/ml aprotinin, 1% Nonidet P-40 (wt/vol), and 0.5% sodium deoxycholate. After 10 min of boiling, Cat D immunoprecipitation was carried out in 1.2 ml of TNN solution (50 mM Tris, pH 7.5, 250 mM NaCl, 5 mM EDTA, 0.5% Nonidet P-40) containing 0.4 mg/ml pefabloc, 10 µg/ml leupeptin, 10 µg/ml pepstatin, and 5 µg/ml aprotinin. To each sample, 50 µl of protein A/G-agarose mix (Oncogene Research Product, Cambridge, MA) were added and rotated at 4°C for 1 h. After centrifugation, the supernatants were collected and incubated with mouse anti-Cat D monoclonal antibody (Zymed Laboratories, San Francisco, CA) at 4°C overnight, followed by addition of 50 µl/ml of protein A/G-agarose mix and incubation for another 4 h at 4°C. The antibody-protein A/G-agarose complexes were then collected by centrifugation and washed twice in TNN solution at 4°C and resuspended in Laemmli buffer (2% SDS, 62 mM Tris, pH 6.8, 10% glycerol, 50 mM DTT), boiled, and loaded onto SDS-PAGE. The gels were dried and exposed to X-ray films, and the Cat D-related radiobands were quantified by a densitometer (Versa-Doc; Bio-Rad, Hercules, CA). To chase Cat D degradation, cells were labeled in a similar fashion, washed with PBS, and collected after incubation in DMEM containing 2 mM methionine/cysteine and cyclohexamide (35 µg/ml) at 37°C for indicated time periods. Cell lysates were then obtained and proceeded for immunoprecipitation as described. The radioactivity of the final sample was determined by liquid scintillation spectroscopy (1600-TR; Packard, Downers Grove, IL).
Calcification assays.
ObC calcification was measured by determining 45Ca incorporation within the cell layer and matrix as previously described (37). In brief, cells were incubated for 48 h in medium containing 0.5 µCi/ml of 45CaCl2 (ICN Biochemicals). Cell layers were then washed with HBSS and digested in 0.2 N NaOH. Aliquots of lysates were counted for 45Ca activity by liquid scintillation spectroscopy (1600-TR; Packard) or analyzed for total protein using Coomassie brilliant blue G250 with BSA as the standard (36). In some experiments, ObC calcification was also determined by Alizarin red-S histochemical staining. For this purpose, cell layers were fixed with ice-cold 70% ethanol for 1 h and then rinsed twice with deionized water. The cells were then stained with Alizarin red-S (40 mM, pH 4.2) for 10 min, followed by rinsing five times with deionized water and one wash with PBS for 15 min. After another wash with fresh PBS, the Alizarin red-S stain was extracted with 10% (wt/vol) cetylpyridium chloride in 10 mM sodium phosphate (pH 7) for 15 min. The extract was then transferred into a 96-well plate, and the absorbance at 562 nm was measured with a microplate reader (MRX, Dynatech Laboratories). To test the effect of conditioned media on ObC calcification, ObCs were incubated with conditioned media for 48 h at 37°C in a humidified atmosphere of 5% CO2-95% air before calcification analyses.
Enzyme assays and tartrate-resistant acid phosphatase staining.
The cell alkaline phosphatase and conditioned media lactate dehydrogenase (LDH) activities were measured by a spectrophotometer (Genesys 5; Milton Roy, Rochester, NY), using the phosphatase and LDH assay kits (Sigma, St. Louis, MO), respectively, according to manufacturers instructions, and the results were normalized for cell protein. To detect osteoclast cells, tartrate-resistant acid phosphatase (TRAP) staining was performed by using an acid phosphatase staining kit (Sigma), where citrate/acetone-fixed cells were incubated for 1 h at 37°C in the dark in the substrate solution containing naphthol AS-BI phosphoric acid and fast naphthol AS-BT phosphoric acid solution, with and without L-(+)-tartrate (0.67 M, pH 5.2). Cells were then rinsed with deionized water for 3 min and stained with acid hematoxylin solution. The tartaric acid-resistant phosphatase-containing osteoclast cells were not affected by tartrate and remained positively stained.
RT-PCR and quantitative real-time PCR.
Total RNA was extracted by Ultraspec RNA extract kit (Biotecx Lab, Houston, TX). For RT-PCR, cellular RNA samples were reverse transcribed with random hexamer (Thermoscript RT-PCR system; Life Technologies, Rockville, MD) and amplified in a thermocycler (GeneAmp PCR system 9700; Applied Biosystems, Foster City, CA) using primer pair specific for osteocalcin (CTCTCTCTGCTCACTCTGCT/AATAGTGATACCGTAGATGCGTT). The amplified products were size fractionated on 2% agarose gels. The absence of genomic DNA contamination was confirmed by the lack of PCR product from non-reverse-transcribed RNA samples. For quantitative real-time PCR, 1.0 µg of DNase I (Invitrogen, Carlsbad, CA)-treated RNA was reverse-transcribed in a similar fashion, and PCR reactions were carried out with 25 ng of cDNA, 150 nM each of forward and reverse primer, and 1x SYBER Green Supermix (Bio-Rad) in a total volume of 25 µl. Samples were amplified for 40 cycles in a real-time PCR detection system (iCycler iQ, Bio-Rad) with an initial melt at 95°C for 8.5 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. PCR product accumulation was monitored at multiple points during each cycle by measuring the increase in fluorescence caused by the binding of SYBER Green I to double-stranded DNA. The partial cycle at which a statistically significant increase in Cat D product was first detected (threshold cycle) was normalized to the threshold cycle for GAPDH. Postamplification melting curves were performed to confirm that a single PCR product was produced in each reaction. The primer pairs used for Cat D were TTCGTCCTCCTTCGCGATT/CTCCGTCATAGTCCGACGGATA; those for GAPDH were TGAACGGATTTGGCCGTATTG/ACCATGTAGTTGAGGTCAATGAAG.
Northern and Western blot analyses.
For Northern blots, cellular RNA was size fractionated on 1% agarose gels, transferred to nylon membranes, and probed with biotinyl-labeled Cat D cDNA probe. For Western blots, cell protein samples were extracted in a solution containing 50 mM Tris·HCl (pH 8.0), 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 1% protease inhibitor cocktail set III (Calbiochem). Protein samples were denatured by boiling in 2% SDS, separated on 415% gradient SDS-PAGE gels, and transferred to supported nitrocellulose membranes (Millipore, Bedford, MA). The cellulose membranes were blocked with 2% skim milk and probed with rabbit anti-mouse Cat D antisera (a generous gift from Dr. Uchiyama, Osaka University). After a washing with Tris-based saline with 0.05% Tween 20, membranes were probed with a secondary horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Pierce, Rockford, IL), and the signal of the secondary antibody was visualized by chemiluminescence with SuperSignal West Femto maximum sensitivity substrate (Pierce) according to the manufacturers instructions. The same membrane, after it was stripped with 9 g/dl glycine (pH 3.0), was probed for
-actin using mouse monoclonal anti-
-actin antibody (Sigma) with a secondary alkaline phosphatase-conjugated goat anti-mouse IgG antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Immunodetection was carried out with the Blue Phos kit (Kirkegaard Perry Lab).
Production of recombinant secreted PHEX.
A recombinant soluble, secreted form of human PHEX (secPHEX) was produced according to previously described procedures (7) with slight modifications. In brief, the human PHEX cDNA obtained from MG-63 cells, a human ObC cell line, was subjected to modifications, including the introduction of hydrophilic amino acid residues (LTVIAQQ) together with the deletion of four codons (LFLV) in the transmembrane domain and the addition of c-Myc/His tags into the COOH terminus. The cDNA encoded the final secPHEX was obtained by PCR using the primer pair GGTACCGCTCTTGAGACCAGCCACCAA/TCTAGACTA-ATGGTGATGATGGTGGTGCAGATCCTCTTCTGAGTGAGCTTCTGCTCCCATAGTCGGCAGGAGTCCAT. The amplified products were ligated into pGEM-T easy vector (Promega) and the positive clones were verified by DNA sequencing and subcloned into pcDNA3.1+ expression vector (Invitrogen). To generate a catalytically inactive form of secPHEX, the pcDNA3.1+/pGEM-T/PHEX vector, harboring a Glu581-to-Val substitution was produced by site-directed mutagenesis using the same PCR-based strategy referred to above and appropriate oligonucleotide primers. The linearized pcDNA3.1+ containing the cDNA encoding active or inactive secPHEX was then introduced into LLC-PK1 cells by electroporation (Gene Pulser II, Bio-Rad), and the stably transfected clones of LLC-PK1 cells were selected by their G418 resistance. The culture media derived from these transfected LLC-PK1 cells were collected, and the secPHEX secreted into culture media was purified with a polyhistidine column (Talon resin; Clontech, Palo Alto, CA) according to the manufacturers instructions. The yield of purified secPHEX was
300 µg/l of conditioned media.
PHEX enzymatic activity assays.
We evaluated the enzymatic activity of secPHEX thus produced by using a synthetic PHEX substrate peptide, Abz-GFSDYK(Dnp)-OH (PeptidoGenic Research, Livermore, CA), as previously described (10). Abz-GFSDYK(Dnp)-OH (10 µM) was incubated with 500 ng of secPHEX for 30 min at 37°C in 10 mM Bis-Tris buffer, pH 5.5, containing also 150 mM NaCl, and the fluorescence at emission wavelength = 420 nm and excitation wavelength = 320 nm was monitored by a spectrofluorometer (F-2000, Hitachi). The mutual effect between secPHEX and Cat D was tested by coincubation with Cat D (1 µg) with secPHEX (1 µg) under the same condition and probed with antibodies against Cat D (Zymed Laboratories) or anti-c-Myc antibody (Sigma) for secPHEX.
Cat D activity assays.
Conditioned media Cat D activities were determined by using a chromogenic substrate, Bz-Arg-Gly-Phe-Phe-Pro-4MeO
NA (Calbiochem, La Jolla, CA), as was previously described (31). In brief, the assay mixture (800 µl) consisted of two volumes of buffer solution (0.4 M citrate, at indicated pH) and one volume each of substrate solution and sample. The substrate was first dissolved in DMSO and then diluted to 10 mM with water to obtain a final concentration of 1% DMSO. Incubation was carried out at 37°C for 40 min, and the reaction was stopped with one volume of 1 mM pepstatin (Sigma). The release of 2-naphthylamine was measured in a spectrofluorometer (F-2000, Hitachi) at emission wavelength = 410 nm and excitation wavelength = 335 nm and expressed as fluorescence unit per milligram cell protein.
Induction of Cat D hyperexpression.
To induce Cat D hyperexpression, Cat D cDNA was first produced by RT-PCR with mRNA isolated from MG-63 cells, using primer pairs GCCGCCACCATGCAGCCCTCCA/GGACTCTCCTCTGTTTCTGTGC, and ligated into pGEM-T easy vector, and positive clones were verified by DNA sequencing and subcloned into pcDNA3.1+ vector. The pcDNA3.1+ containing the cDNA encoding full-length Cat D was then introduced into MG-63 cells by electroporation. Control cells were transfected in a similar fashion with pcDNA3.1+ vector without the Cat D cDNA insert. The successful induction of Cat D hyperexpression was confirmed by demonstrating higher cellular Cat D mRNA abundance with Northern blot analysis (data not shown).
Immunodepletion studies.
To remove Cat D from conditioned media by immunodepletion, mouse anti-Cat D monoclonal antibody (Zymed Laboratories) was added to Hyp mouse conditioned media at 6 µg/ml and incubated for 18 h at 4°C followed by the addition of 90 µl/ml protein G/A-agarose and incubation for another 4 h at 4°C. The antibody-protein A/G-agarose complexes were then removed by centrifugation, and the remaining supernatant was collected for study. As controls, separate Hyp mouse-conditioned media were treated in a similar fashion except that mouse IgG (Sigma) was used in place of mouse anti-Cat D antibody.
Statistical analyses.
At least three determinations were obtained for each data point. Experimental data are expressed as means ± SE. The significance of differences was analyzed by Students t-test for paired or unpaired data or by one-way ANOVA with individual elements analyzed by Scheffés method.
 |
RESULTS
|
|---|
Identification of Cat D from Hyp mouse-conditioned media.
Similar to previous reports (9, 11), we found that Hyp mouse ObC cultures incorporated significantly less 45Ca within the cell layer and matrix than normal mouse ObC cultures (3.51 ± 0.25 vs. 5.07 ± 0.36 nmol/mg protein, n = 5; P < 0.05) and the Hyp mouse ObC-conditioned media was capable of inhibiting normal mouse ObC 45Ca incorporation by an average of 26.6 ± 1.1% (n = 6) compared with the normal mouse-conditioned media. Because the normal mouse-conditioned media per se were without effect on ObC 45Ca incorporation compared with the plain culture medium, we considered it likely that the inhibitory effect of the Hyp mouse-conditioned media was caused by the presence of factor(s) exerting the same bioactivity rather than the absence of factor(s) exerting the opposite bioactivity. Therefore, we searched for proteins that are either unique or prominent in Hyp mouse ObC-conditioned media compared with that of the normal mouse by comparing 2D SDS-PAGE protein patterns (Fig. 1). Among many different protein spots between normal and Hyp mouse samples, we noticed protein spots at
50 kDa that were consistently prominent in all Hyp mouse samples (circled area in Fig. 1). These protein spots have the same molecular weight but varying isoelectric points and are likely to represent either isoforms or posttranslational modifications of a protein. These protein spots were excised, and amino acid sequences were determined by MALDI-TOF MS. We analyzed the amino acid sequences thus obtained using the Swiss-Prot protein database, and the original protein was identified as the murine precursor form of Cat D, i.e., pro-Cat D (EC 3.4.235).
Metabolic labeling studies.
To further confirm that Hyp mouse ObC released a greater amount of Cat D into culture media, metabolic labeling studies were performed. In these studies, the conditioned media collected from 35S-labeled normal and Hyp mouse ObCs were immunoprecipitated with anti-Cat D antibody and protein A/G-agarose, and the antibody-protein A/G-agarose complexes were analyzed by SDS-PAGE and fluorography. As shown in Fig. 2, top, an enhanced signal of the bands corresponding to pro-Cat D (
50 kDa), intermediate single-chain Cat D (
47 kDa), and mature heavy-chain Cat D (
34 kDa) was detected in the Hyp mouse-conditioned media compared with the normal mouse-conditioned media. This was further demonstrated when the signal intensities of these Cat D-related bands were quantified by a densitometer and normalized for cell protein (Fig. 2, bottom). Because both femoral and calvarial ObC gave similar results (Fig. 2, top), data from these two groups of cells were pooled.
Characterization of Hyp mouse ObC.
We found that both normal and Hyp mouse ObC cultures exhibited similar ObC characteristics, including the time-dependent increase of alkaline phosphatase activity (Fig. 3, left) and the expression of ObC markers such as osteocalcin mRNA at 15 days of culture (Fig. 3, right). With Hyp mouse ObC cultures, we also found no increase in conditioned media LDH activity, a marker for cell damage (Fig. 4, left), or TRAP-positive cells, a marker for osteoclast cells (Fig. 4, right). It was therefore deemed unlikely that the higher Cat D release by Hyp mouse ObCs was simply due to nonspecific cell damage or heterogeneous cell population, such as the outgrowth of cathepsin-secreting osteoclast cells.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 3. Expression of ObC markers in both normal and Hyp mouse ObC. Left: alkaline phosphatase activities of ObC at 5, 10, and 20 days of culture measured using the phosphatase assay kits and normalized for cell protein. Right: osteocalcin mRNA expression of ObC at 15 days of culture was assessed by RT-PCR using osteocalcin-specific primers. There was no difference in the time-dependent increase of alkaline phosphatase activity (left; mean ± SE, n = 3, P > 0.5) and the osteocalcin mRNA expression (right) between normal and Hyp mouse ObC. No PCR products were detected without reverse transcriptase (RT).
|
|

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 4. Conditioned medium lactate dehydrogenase (LDH) assays and ObC tartrate-resistant acid phosphatase (TRAP) staining. Conditioned medium LDH levels (left) were determined by using LDH assay kits and normalized for cell protein. ObC TRAP staining (right) was performed by using acid phosphatase staining kit in the presence (top) or absence (bottom) of L-(+)-tartrate (0.67 M, pH 5.2), followed by hematoxylin staining. TRAP-containing osteoclast cells are not affected by tartrate and can be identified by their positive staining (dark brown) in the presence of tartrate. There was no increase in either LDH levels (means ± SE, n = 8, P = 0.3) or TRAP-positive cells in Hyp mouse ObC cultures.
|
|
Cat D expression levels in ObC.
By Northern blot analysis, we found that the Cat D mRNA levels were not increased in Hyp mouse ObC (Fig. 5, left). This was also confirmed by quantitative real-time PCR, where the relative Cat D message level normalized against GAPDH was not significantly different between Hyp mouse and normal mouse ObC (Fig. 5, right). In contrast, by Western immunoblot, we found that the protein levels for pro-, intermediate, and mature Cat D were significantly higher in Hyp mouse ObCs (Fig. 6, left). A similar result was also obtained with the Hyp mouse ObC lysate from metabolic labeling studies, which produced enhanced protein band signals for all three forms of Cat D (Fig. 6, right). When the cell lysate 35S labels were chased with unlabeled methionine and in the presence of cycloheximide, we found a slower dissipation of the Hyp mouse ObC Cat D signals down to only
40% (i.e., 60% degradation) after up to 8 h of chase vs.
20% (i.e., 80% degradation) in the normal mouse ObC (Fig. 7). Considering the concurrent higher Cat D release from Hyp mouse ObC, these results therefore indicate that Cat D degradation is suppressed in Hyp mouse ObC and may thus contribute to the accumulation of Cat D proteins in these cells.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5. Cat D mRNA levels in normal and Hyp mouse ObC. Cat D mRNA levels in normal and Hyp mouse ObC were assessed by Northern blot analyses (left) and by quantitative real-time PCR (right). For Northern blots, cellular RNA samples were size fractionated and probed with biotinyl-labeled Cat D or GAPDH cDNA probe. For quantitative real-time PCR, the cDNA product from DNase-treated total RNA was used for PCR reactions carried out with specific primers and Syber green Supermix in a real-time PCR detection system, where the PCR product accumulation was monitored by the increase in fluorescence and the threshold cycle for Cat D product was normalized against that for GAPDH. There was no difference in Cat D mRNA levels between normal and Hyp mouse ObC by either Northern blot analyses or real-time PCR (means ± SE, n = 3; P = 0.14).
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 6. Cat D protein levels in normal and Hyp mouse ObCs. Cat D protein levels in normal and Hyp mouse ObCs were assessed by Western blot analyses (left) and by metabolic labeling studies (right). For Western blots, cell protein samples were size fractionated and probed with rabbit anti-mouse Cat D antisera and a secondary horseradish peroxidase-conjugated goat anti-rabbit IgG antibody for chemiluminescence detection. The same membrane was stripped and probed for -actin. For metabolic labeling studies, ObC were labeled with 35S overnight, and the cell lysate samples were immunoprecipitated with anti-Cat D antibody and protein A/G-agarose, followed by SDS-PAGE fluorography. The signals of radiobands corresponding to pro-Cat D (P, 50 kDa), intermediate single-chain Cat D (S, 47 kDa), and mature heavy-chain Cat D (H, 34 kDa) were quantified by a densitometer and normalized for cell protein. In contrast to mRNA, the protein levels for all forms of Cat D were significantly higher in Hyp mouse ObCs (means ± SE, n = 5; *P < 0.05).
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 7. Chase studies on Cat D degradation. ObCs were labeled with 35S overnight, washed with PBS, and collected at 0, 2, 4, and 8 h after incubation at 37°C in DMEM containing 2 mM methionine-cysteine and cycloheximide (35 µg/ml). Cell lysates thus obtained were immunoprecipitated with anti-Cat D antibody and protein A/G-agarose, and the Cat D-related radioactivities from the immunoprecipitates were determined by liquid scintillation spectroscopy. Compared with normal samples, where the 35S signal dissipated down to 20% (i.e., 80% degradation) after being chased for up to 8 h (left, with solid lines), the 35S signal of the Hyp samples dissipated down to only 40% (i.e., 60% degradation; right). In a separate group of normal mouse samples, the dissipation rate of 35S signals was reduced when protease inhibitors (protease inhibitor cocktail set III, Calbiochem) were added during the chase period ( with dashed line).
|
|
Lack of secPHEX effect on Cat D.
From these results, the possibility may arise that the loss of Phex function in Hyp mouse ObC could lead to a decrease in Cat D degradation if Cat D were a Phex substrate. We therefore carried out studies to examine the effect of Phex protein on Cat D. For this purpose, a recombinant soluble, secPHEX, was produced as described previously (7). As shown in Fig. 8A, the secPHEX thus produced was enzymatically active against a synthetic chromogenic substrate, Abz-GFSDYK(Dnp)-OH, whereas the nonactive mutant secPHEX (G581V) was without effect. The effect of secPHEX on Cat D was then tested by coincubating secPHEX with Cat D. As shown in Fig. 8C, secPHEX (1 µg) did not cleave Cat D (1 µg) after up to 1-h incubation at 37°C. Conversely, Cat D was also without effect on secPHEX (Fig. 8B). Incubation with secPHEX (5 µg/ml) also did not affect the 35S-labeled Cat D signals, including pro-Cat D, contained in Hyp mouse-conditioned media obtained from metabolic labeling studies (Fig. 8D).
Cat D activity in conditioned media.
To test whether the Cat D activity in Hyp mouse-conditioned media was increased as the result of a greater Cat D release by Hyp mouse ObCs, we measured conditioned media Cat D activity by using a chromogenic Cat D substrate, Bz-Arg-Gly-Phe-Phe-Pro-4MeO
NA. In view of the pH dependency of Cat D activity, these assays were conducted at pH 6.5 so as to simulate the pH value normally found in the culture medium under 5% CO2-95% air with confluent cells. As shown in Fig. 9, a significantly higher Cat D activity was detected in Hyp mouse-conditioned media.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 9. Conditioned media Cat D activities. Cat D activity was determined by using a chromogenic substrate, Bz-Arg-Gly-Phe-Phe-Pro-4MeO NA. Fluorescence of the 2-naphthylamine released was measured in a spectrofluorometer at wavelength emission = 410 nm and wavelength excitation = 335 nm and expressed as fluorescence unit (FU) per mg cell protein. Open bars indicate the results of untreated samples (control, n = 7; *P < 0.01 vs. normal samples), and solid bars indicate the results of immunodepleted samples (n = 4; P = 0.13).
|
|
Effect of Cat D on ObC calcification.
Because cathepsins are known to be the important proteases involved in bone extracellular matrix turnover (6), we tested the effect of Cat D on ObC calcification by either adding Cat D extracellularly to culture media or by raising intracellular Cat D levels through Cat D overexpression. As shown in Fig. 10, AC, exposure to Cat D (108 M) in culture media for 48 h significantly reduced normal mouse ObC 45Ca incorporation and Alizarin red-S staining. Similarly, MG-63 cells overexpressing Cat D had significantly less 45Ca incorporation and Alizarin red-S staining than the control MG-63 cells that were similarly transfected but without Cat D cDNA insert (Fig. 10, DF). We also found that the conditioned media collected from Cat D-overexpressing MG-63 cells were capable of inhibiting normal mouse ObC 45Ca incorporation by 19.1 ± 1.6% (n = 5) compared with the conditioned media collected from control MG-63 cells. In separate experiments, we found that ObC 32P uptake was not affected by either exposure to Cat D (108 M) or Cat D overexpression (data not shown).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 10. Effects of Cat D and Cat D overexpression on ObC calcification. ObC calcification was assessed by determining the incorporation of 45Ca into cell layers and extracellular matrix (A and D) and by Alizarin red-S staining (C and F). Alizarin red-S was further extracted with 10% (wt/vol) cetylpyridium chloride in 10 mM sodium phosphate (pH 7), and the absorbance at 562 nm was measured using a microplate reader (B and E). ObC mineralization was significantly reduced when ObCs were exposed to Cat D by adding Cat D (108 M) to culture media for 48 h (AC; n = 6, *P < 0.02) or by Cat D overexpression induced by transfecting with pcDNA 3.1+ vector carrying Cat D cDNA (DF; n = 7, *P < 0.01). For overexpression studies, ObCs transfected in a similar fashion but without Cat D cDNA insert were used as the control.
|
|
Effects of Cat D inhibition in Hyp mouse-conditioned media.
To examine the role of Cat D in mediating the inhibitory effect of Hyp mouse-conditioned media on ObC calcification, we tested the effect of inhibiting Cat D activity by either using the Cat D inhibitor pepstatin (10 µM) or immunodepleting Cat D from the conditioned media with anti-Cat D antibody. Pepstatin inhibited Cat D activity to levels below detection (data not shown), and, as shown in Fig. 9, Cat D immunodepletion reduced Cat D activity in Hyp mouse-conditioned media to a level not significantly different from normal mouse-conditioned media. We found that these two maneuvers were equally effective in averting the inhibitory effect of Hyp mouse-conditioned media on ObC 45Ca incorporation (Fig. 11).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 11. Effects of pepstatin and Cat D immunodepletion on the inhibitory effect of Hyp mouse-conditioned media. Incubation with Hyp mouse-conditioned media alone significantly lowered normal mouse ObC 45Ca incorporation (n = 6; * P < 0.05). This inhibitory effect was abolished when the higher Cat D activity in Hyp mouse-conditioned media was lowered by pepstatin (10 µM) (n = 4) or by Cat D immunodepletion (n = 6). Results are presented as the percentage of 45Ca incorporation by normal mouse ObC exposed to normal mouse-conditioned media treated in a similar fashion.
|
|
 |
DISCUSSION
|
|---|
There is convincing evidence that the bone mineralization defect in XLH is caused not only by hypophosphatemia and deranged vitamin D metabolism but also by intrinsic bone defects involving local release of factor(s) capable of inhibiting bone mineralization. Aiming to identify these ObC-derived pathogenic factors, we compared 2D SDS-PAGE protein patterns between normal and Hyp mouse ObC-conditioned media and identified a prominent protein in Hyp mouse ObC-conditioned media as the murine pro-Cat D (circled area in Fig. 1). This increased release of Cat D into culture medium by Hyp mouse ObC was further confirmed by metabolic labeling studies, where increased signals of Cat D-related bands, including the precursor pro-Cat D (
50 kDa), the intermediate single-chain Cat D (
47 kDa), and the mature heavy-chain Cat D (
34 kDa), were detected in the conditioned media collected from 35S-labeled Hyp mouse ObC (Fig. 2). It is unlikely that this was due to heterogeneous cell population, because both normal and Hyp mouse ObCs exhibited similar ObC characteristics, including the time-dependent increase of alkaline phosphatase activity (Fig. 3, left) and the expression of ObC marker such as osteocalcin (Fig. 3, right). It is also unlikely that this occurred through nonspecific cell damage with leakage of this lysosomal protein because we found that the LDH level, a marker for cell damage, was not increased in Hyp mouse-conditioned media compared with normal mouse-conditioned media (Fig. 4, left). The possibility that the increased Cat D release was due to the outgrowth of cathepsin-secreting osteoclast cells was also deemed unlikely because all mouse bones in our study were cultured under the condition favorable of ObC outgrowth, i.e., in the presence of
-glycerophosphate and ascorbate. This notion was confirmed by the lack of increased TRAP-positive cells in our Hyp mouse ObC cultures (Fig. 4, right).
We found that the increased release of Cat D by Hyp mouse ObC was associated with an increased Cat D expression at protein but not mRNA level (Figs. 5 and 6), indicating alterations at posttranscriptional steps. By chasing the cell 35S-Cat D signals after replenishing unlabeled methionine and in the presence of the translational inhibitor cyclohexamide, we found a slower dissipation of Cat D-related protein signals down to only
40% (i.e., 60% degradation) in Hyp mouse ObCs compared with
20% (i.e., 80% degradation) in normal mouse ObCs after chasing for up to 8 h (Fig. 7). These results therefore indicate a reduced Cat D degradation in Hyp mouse ObC and suggest its contribution to the accumulation of Cat D protein in Hyp mouse ObC. Although these findings may raise the possibility that the loss of Phex function in Hyp mouse ObC could lead to a decrease in Cat D degradation if Cat D were a Phex substrate, we found no evidence for a direct action of PHEX protein on either pro- or mature Cat D (Fig. 8, BD). The secPHEX used in our present study is similar to that reported previously (7), which contained most of its extracellular domain, including the substrate-binding catalytic site, and was confirmed to be active against the substrate Abz-GFSDYK(Dnp)-OH (10) (Fig. 8A). Although this may not completely rule out the possibility that the recombinant secPHEX does not have the correct conformation for it to be active on Cat D, we also found no evidence for Cat D cleavage by using membrane fraction prepared from LLC-PK1 cells transfected with membrane-bound PHEX (data not shown). Because the substrates of Phex are generally considered to be small peptides that fit into the S1' pocket of PHEX protein (10), it is probably not unexpected to find that PHEX does not cleave Cat D directly. Nonetheless, despite the lack of evidence for a direct PHEX protein action on Cat D, the loss of Phex function in Hyp mouse ObC is likely to be responsible for the altered Cat D metabolism because we found in separate studies that suppression of PHEX expression in MG-63 cells by PHEX antisense caused similar changes in Cat D metabolism (unpublished observations). It is therefore likely that the loss of Phex function alters Cat D metabolism in Hyp mouse ObC in an indirect fashion, possibly involving other protease systems or other factors mediating the degradation of Cat D.
The reason why Hyp mouse ObC hypersecrete pro- and mature-Cat D is not immediately clear. Cat D, the lysosomal aspartic protease, is produced as a precursor, pre-pro-Cat D, which is cleaved to produce pro-Cat D and eventually targeted to lysosomes via a mannose 6-phosphate receptor (MPR)-dependent pathway (21). Unloading of the proenzyme in acidic endosomes and continuous recycling of the receptors normally ensure the proper lysosomal segregation of pro-Cat D so that only a minor portion is secreted by normal cells. However, under certain conditions, hypersecretion of pro-Cat D may occur (2). A prototypical example of cathepsin secretion under physiological condition can be found in bones where the lysosomal enzymes secreted from the ruffled border membrane of osteoclast cells are activated in the acidic microenvironment at the site of bone resorption (6). Under pathological conditions, hypersecretion of pro-Cat D has also been described in various types of tumor cells due to altered MPR-dependent or -independent pathways (9, 18). Although our present study does not identify any specific mechanism responsible for Cat D hypersecretion by Hyp mouse ObC, the fact that all forms of Cat D were equally retained indicates the involvement of a mechanism of decreased early transcript catabolism. It is possible that the accumulation of pro-Cat D protein in these cells can result in saturation of the MPR pathway and lead to increased secretion of pro-Cat D, as was found in human breast cancer cells (24). Whether Hyp mouse ObC also hypersecrete intermediate- and mature-Cat D is less clear because the apparent secretion of these forms of Cat D may occur after they were fully processed intracellularly and therefore passed through the lysosomal trafficking pathway and/or through processing of pro-Cat D extracellularly via autocatalysis (41).
Irrespective of the underlying mechanism, we were able to detect a parallel increase in Cat D activity in Hyp mouse-conditioned media (Fig. 9). It is noteworthy that, although the optimal pH for Cat D activity is generally between 3 and 5, we were able to detect a higher Cat D activity in Hyp mouse-conditioned media at pH 6.5, a pH value normally found in culture media under 5% CO2-95% air with confluent cells. It is therefore likely that the Hyp mouse ObC were exposed to higher Cat D activity, both intracellularly and extracellularly, while in culture. Because cathepsins are known to be among the major proteases involved in the degradation of bone extracellular matrix (6), we hypothesized that this higher Cat D activity may contribute to the inhibitory effect of Hyp mouse-conditioned media on ObC calcification. In support of this possibility, we found that the exposure to Cat D, through either addition of Cat D to the culture medium or induction of Cat D overexpression, significantly inhibited ObC 45Ca incorporation (Fig. 10). We also found that the inhibitory effect of Hyp mouse-conditioned media was abolished when their higher Cat D activity was lowered by using Cat D inhibitor, pepstatin, or by immunodepletion (Figs. 9 and 11). Together, these results support the possibility that Cat D may serve as an important factor mediating the inhibitory effect of Hyp mouse-conditioned media on ObC calcification. To lend further support to this notion, we found in our separate studies that Hyp mouse bones exhibit altered Cat D distribution and in vivo treatment with pepstatin was effective to improve their bone mineralization defect (25).
Although the mechanisms whereby Cat D inhibits ObC calcification remain unclear, it is to be noted that our present study does not prove that the inhibition of ObC calcification is through a direct action of Cat D. Many studies have now shown that pro- and mature-Cat D can function not only as a protease but also as a ligand (16, 32) and is involved in a broad spectrum of cellular activities, including cell proliferation and apoptosis (4, 16, 20, 32, 40). It is therefore possible that, besides its direct action as a protease on matrix proteins, Cat D may inhibit ObC calcification indirectly through its interactions with other factors affecting cascades of cellular functions. This complexity of Cat D actions is probably also more in line with the multifaceted osteomalacic changes of Hyp mouse bones recently described by Miao et al. (26, 27). Although we do not have direct evidence from our present study to implicate that Cat D may also affect ObC mineralization, i.e., hydroxyapatite formation, it is tempting to speculate that this may be the case based on its known effect on extracellular matrix proteins and our finding that pepstatin treatment in Hyp mice improved their bone morphology (25).
Also to be noted is that Cat D was only one of the many different protein spots between normal and Hyp mouse-conditioned media that remain to be identified, and our present study does not exclude the involvement of other factors besides Cat D in mediating the inhibitory effect of Hyp mouse-conditioned media on ObC mineralization. In this regard, it is of interest to note that secretary proteins, such as matrix extracellular phosphoglycoprotein (MEPE) (33) and frizzled related protein 4 (5), have also been implicated in Hyp mouse bone defect. Whether the Cat D abnormality described in our present study is related to these proteins is unknown. Nevertheless, it is of particular interest to note that recent studies by Rowe et al. (34) showed that the inhibition of mineralization by MEPE was localized to a small COOH-terminal peptide containing the acidic serine-aspartate-rich motif (ASARM) peptide, which can be released through MEPE cleavage by cathepsin B, but not Cat D (17). The important role of MEPE-ASARM peptide was further strengthened by recent studies demonstrating the correlation of serum/tissue MEPE-ASARM peptide levels with renal and bone phenotypes in XLH patients and Hyp mice (8, 19) and the direct interaction between MEPE and PHEX protein via the MEPE-ASARM motif (35). Because Cat D is known to be capable of inactivating cysteine protease inhibitors, cystatins (22), and activating pro-Cat B (28), Cat D may thus participate in the regulation of MEPE/ASARM levels indirectly through cathepsin B. Further studies are needed to examine these possibilities.
In conclusion, we have found in our present study that Hyp mouse ObC had increased release of Cat D and obtained results implicating the potential role of Cat D as a mineralization inhibitory factor in Hyp mouse ObC-conditioned media. Although the mechanisms responsible for Cat D hypersecretion and its inhibition on bone mineralization remain to be delineated, our present findings, together with others (11), implicate the emergence of upregulation of a wide variety of proteases as one of the unique Hyp phenotypes. How the loss of Phex function leads to the upregulation of other protease systems and whether these in vitro findings are applicable to the bone defects in XLH patients await future studies to be clarified.
 |
GRANTS
|
|---|
This work was supported by grants (to N. Yanagawa) from the National Institute of Diabetes and Digestive and Kidney Diseases (DK-AR58886) and the Department of Veterans Affairs.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: N. Yanagawa, Sepulveda VA Medical Center (111R), 16111 Plummer St., Sepulveda, CA 91343 (e-mail: nori{at}ucla.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Albright F, Butler AM, and Bloomberg E. Resistance to vitamin D therapy. Am J Dis Child 54: 529547, 1937.
- Andrews NW. Regulated secretion of conventional lysosomes. Trends Cell Biol 10: 316321, 2000.[CrossRef][Web of Science][Medline]
- Bai X, Miao D, Panda D, Grady S, McKee MD, Goltzman D, and Karaplis AC. Partial rescue of the Hyp phenotype by osteoblast-targeted PHEX (phosphate-regulating gene with homologies to endopeptidases on the X chromosome) expression. Mol Endocrinol 16: 29132925, 2002.[Abstract/Free Full Text]
- Berchem G, Glondu M, Gleizes M, Brouillet JP, Vignon F, Garcia M, and Liaudet-Coopman E. Cathepsin D affects multiple tumor progression steps in vivo: proliferation, angiogenesis and apoptosis. Oncogene 21: 59515955, 2002.[CrossRef][Web of Science][Medline]
- Berndt T, Craig TA, Bowe AE, Vassiliadis J, Reczek D, Finnegan R, Jan De Beur SM, Schiavi SC, and Kumar R. Secreted frizzled-related protein 4 is a potent tumor- derived phosphaturic agent. J Clin Invest 112: 785794, 2003.[CrossRef][Web of Science][Medline]
- Blair HC. How the osteoclast degrades bone. Bioessays 20: 837846, 1998.[CrossRef][Web of Science][Medline]
- Boileau G, Tenenhouse HS, Desgroseillers L, and Crine P. Characterization of PHEX endopeptidase catalytic activity: identification of parathyroid-hormone-related peptide107139 as a substrate and osteocalcin, PPi and phosphate as inhibitors. Biochem J 355: 707713, 2001.[Web of Science][Medline]
- Bresler D, Bruder J, Mohnike KL, Fraser D, and Rowe PSN. Serum MEPE-ASARM peptides are elevated in X-linked rickets (HYP): implications for phosphaturia and rickets. J Endocrinol 183: R1R9, 2004.[Abstract/Free Full Text]
- Capony F, Rougeot C, Montcourrier P, Cavailles V, Salazar G, and Rochefort H. Increased secretion, altered processing, and glycosylation of pro-cathepsin D in human mammary cancer cells. Cancer Res 49: 39043909, 1989.[Abstract/Free Full Text]
- Campos M, Couture C, Hirata IY, Juliano MA, Loisel TP, Crine P, Juliano L, Boileau G, and Carmona AK. Human recombinant endopeptidase PHEX has a strict S1' specificity for acidic residues and cleaves peptides derived from fibroblast growth factor-23 and matrix extracellular phosphoglycoprotein. Biochem J 373: 271279, 2003.[CrossRef][Web of Science][Medline]
- Dubois SG, Ruchon AF, Delalandre A, Boileau G, and Lajeunesse D. Role of abnormal neutral endopeptidase-like activities in Hyp mouse bone cells in renal phosphate transport. Am J Physiol Cell Physiol 283: C1414C1421, 2002.[Abstract/Free Full Text]
- Ecarot B, Glorieux FH, Desbarats M, Travers R, and Labelle L. Defective bone formation by Hyp mouse bone cells transplanted into normal mice: evidence in favor of an intrinsic osteoblast defect. J Bone Miner Res 7: 215220, 1992.[Web of Science][Medline]
- Ecarot-Charrier B, Glorieux FH, Travers R, Desbarats M, Bouchard F, and Hinek A. Defective bone formation by transplanted Hyp mouse bone cells into normal mice. Endocrinology 123: 768773, 1988.[Abstract/Free Full Text]
- Ecarot B, Glorieux FH, Desbarats M, Travers R, and Labelle L. Effect of 1,25-dihydroxyvitamin D3 treatment on bone formation by transplanted cells from normal and X-linked hypophosphatemic mice. J Bone Miner Res 10: 424431, 1995.[Web of Science][Medline]
- Eicher EM, Southard JL, Scriver CR, and Glorieux FH. Hypophosphatemia: mouse model for human familial hypophosphatemic (vitamin D-resistant) rickets. Proc Natl Acad Sci USA 73: 46674671, 1976.[Abstract/Free Full Text]
- Fusek M and Vetvicka V. Mitogenic function of human procathepsin D: the role of the propeptide. Biochem J 303: 775780, 1994.
- Guo R, Rowe PS, Liu S, Simpson LG, Xiao ZS, and Darryl Quarles LD. Inhibition of MEPE cleavage by Phex. Biochem Biophys Res Commun 297: 3845, 2002.[CrossRef][Web of Science][Medline]
- Isidoro C, Baccino FM, and Hasilik A. Mis-sorting of procathepsin D in metastogenic tumor cells is not due to impaired synthesis of the phosphomannosyl signal. Int J Cancer 70: 561566, 1997.[CrossRef][Web of Science][Medline]
- Jain A, Fedarko NS, Collins MT, Gelman R, Ankrom MA, Tayback M, and Fisher LW. Serum levels of matrix extracellular phosphoglycoprotein (MEPE) in normal humans correlate with serum phosphorus, parathyroid hormone and bone mineral density. J Clin Endocrinol Metab 89: 41584161, 2004.[Abstract/Free Full Text]
- Kidd VJ, Lahti JM, and Teitz T. Proteolytic regulation of apoptosis. Semin Cell Dev Biol 11: 191201, 2000.[CrossRef][Web of Science][Medline]
- Kornfeld S. Trafficking of lysosomal enzymes. FASEB J 1: 462468, 1987.[Abstract]
- Lenarcic B, Kos J, Dolenc I, Lucovnik P, Krizaj I, and Turk V. Cathepsin D inactivates cysteine proteinase inhibitors, cystatins. Biochem Biophys Res Commun 154: 765772, 1988.[CrossRef][Web of Science][Medline]
- Liu S, Guo R, Tu Q, and Quarles LD. Overexpression of Phex in osteoblasts fails to rescue the Hyp mouse phenotype. J Biol Chem 277: 36863697, 2002.[Abstract/Free Full Text]
- Mathieu M, Vinon F, Capony F, and Rochefort H. Estradiol down-regulates the mannose-6-phosphate/insulin-like growth factor-H receptor gene and induces cathepsin D in breast cancer cells: a receptor saturation mechanism to increase the secretion of lysosomal proenzymes. Mol Endocrinol 5: 815822, 1991.[Abstract/Free Full Text]
- Matsumoto N, Jo O, Shih RN, and Yanagawa N. Role of cathepsin D in Hyp mouse bone defect (Abstract). J Am Soc Nephrol 14: 467A, 2003.
- Miao D, Bai X, Panda D, McKee M, Karaplis A, and Goltzman D. Osteomalacia in hyp mice is associated with abnormal phex expression and with altered bone matrix protein expression and deposition. Endocrinology 142: 926939, 2001.[Abstract/Free Full Text]
- Miao D, Bai X, Panda DK, Karaplis AC, Goltzman D, and McKee MD. Cartilage abnormalities are associated with abnormal Phex expression and with altered matrix protein and MMP-9 localization in Hyp mice. Bone 34: 638647, 2004.[Medline]
- Nishimura Y, Kawabata T, and Kato K. Identification of latent procathepsins B and L in microsomal lumen: characterization of enzymatic activation and proteolytic processing in vitro. Arch Biochem Biophys 261: 6471, 1988.[CrossRef][Web of Science][Medline]
- OFarrell PH. High resolution two-dimensional electrophoresis of proteins. J Biol Chem 250: 40074021, 1975.[Abstract/Free Full Text]
- Quarles LD. FGF23, PHEX, and MEPE regulation of phosphate homeostasis and skeletal mineralization. Am J Physiol Endocrinol Metab 285: E1E9, 2003.[Abstract/Free Full Text]
- Ribari O and Sziklai I. Cathepsin D activity in otosclerotic bone and perilymph. Acta Otolaryngol (Stockh) 105: 549552, 1988.
- Rochefort H and Liaudet-Coopman E. Cathepsin D in cancer metastasis: a protease and a ligand. APMIS 107: 8695, 1999.[Web of Science][Medline]
- Rowe PS, de Zoysa PA, Dong R, Wang HR, White KE, Econs MJ, and Oudet CL. MEPE, a new gene expressed in bone marrow and tumors causing osteomalacia. Genomics 67: 5468, 2000.[CrossRef][Web of Science][Medline]
- Rowe PS, Kumagai Y, Gutierrez G, Garrett IR, Blacher R, Rosen D, Cundy J, Navvab S, Chen D, Drezner MK, Quarles LD, and Mundy GR. MEPE has the properties of an osteoblastic phosphatonin and minhibin. Bone 34: 303319, 2004.[Medline]
- Rowe PSN, Garrett IR, Schwarz PM, Carnes DL, Lafer EM, Mundy GR, and Gutierrez GE. Surface plasmon resonance (SPR) confirms that MEPE binds to PHEX via the MEPE-ASARM motif: a model for impaired mineralization in X-linked rickets (HYP). Bone 36: 3346, 2005.[Medline]
- Sedmak JJ and Grossberg SE. A rapid, sensitive, and versatile assay for protein using Coomassie brilliant blue G250. Anal Biochem 79: 544552, 1977.[CrossRef][Web of Science][Medline]
- Shih NR, Jo OD, and Yanagawa N. Effects of PHEX antisense in human osteoblast cells. J Am Soc Nephrol 13: 394399, 2002.[Abstract/Free Full Text]
- Tenenhouse HS. X-linked hypophosphataemia: a homologous disorder in humans and mice. Nephrol Dial Transplant 14: 333341, 1999.[Abstract/Free Full Text]
- The Consortium. A gene (PEX) HYP with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets. Nat Genet 11: 130136, 1995.[CrossRef][Web of Science][Medline]
- Tsukuba T, Okamoto K, Yasuda Y, Morikawa W, Nakanishi H, and Yamamoto K. New functional aspects of cathepsin D and cathepsin E. Mol Cell 10: 601611, 2000.
- Wittlin S, Rosel J, Hofmann F, and Stover DR. Mechanisms and kinetics of procathepsin D activation. Eur J Biochem 265: 384393, 1999.[Web of Science][Medline]
- Xiao ZS, Guo CR, Nesbitt T, Drezner MK, and Quarles LD. Intrinsic mineralization defect in Hyp mouse osteoblasts. Am J Physiol Endocrinol Metab 275: E700E708, 1998.[Abstract/Free Full Text]
Copyright © 2005 by the American Physiological Society.