Am J Physiol Endocrinol Metab 288: E826-E834, 2005.
First published December 7, 2004; doi:10.1152/ajpendo.00422.2004
0193-1849/05 $8.00
TRANSLATIONAL PHYSIOLOGY
Targeted overexpression of G protein-coupled receptor kinase-2 in osteoblasts promotes bone loss
Liming Wang,
Shiguang Liu,
L. Darryl Quarles, and
Robert F. Spurney
Division of Nephrology, Department of Medicine, Duke University and Durham Veterans Affairs Medical Centers, Durham, North Carolina
Submitted 6 September 2004
; accepted in final form 30 November 2004
 |
ABSTRACT
|
|---|
To investigate the role of G protein-coupled receptor kinases (GRKs) in regulating bone formation in vivo, we overexpressed the potent G protein-coupled receptor (GPCR) regulator GRK2 in osteoblasts, using the osteocalcin gene-2 promoter to target expression to osteoblastic cells. Using the parathyroid hormone (PTH) receptor as a model system, we found that overexpression of GRK2 in osteoblasts attenuated PTH-induced cAMP generation by mouse calvaria ex vivo. This decrease in GPCR responsiveness was associated with a reduction in bone mineral density (BMD) in transgenic (TG) mice compared with non-TG littermate controls. The decrease in BMD was most prominent in trabecular-rich lumbar spine and was not observed in cortical bone of the femoral shaft. Quantitative computed tomography indicated that the loss of trabecular bone was due to a decrease in trabecular thickness, with little change in trabecular number. Histomorphometric analyses confirmed the decrease in trabecular bone volume and demonstrated reduced bone remodeling, as evidenced by a decrease in osteoblast numbers and osteoblast-mediated bone formation. Osteoclastic activity also appeared to be reduced because urinary excretion of the osteoclastic activity marker deoxypyridinoline was decreased in TG mice compared with control animals. Consistent with reduced coupling of osteoblast-mediated bone formation to osteoclastic bone resorption, mRNA levels of both osteoprotegrin and receptor activator of NF-
B ligand were altered in calvaria of TG mice in a pattern that would promote a low rate of bone remodeling. Taken together, these data suggest that enhancing GRK2 activity and consequently reducing GPCR activity in osteoblasts produces a low bone-turnover state that reduces bone mass.
parathyroid hormone; osteoblast; osteoclast; osteocalcin; protein kinase
G PROTEIN-COUPLED RECEPTORS (GPCRs) play a key role in bone growth and remodeling (3, 12, 28, 36, 42). Multiple GPCRs are expressed in osteoblasts (3, 42) and likely regulate the local and systemic effects of hormones. In this regard, agonists of several GPCR systems in osteoblasts promote osteogenesis, including parathyroid hormone (PTH) and E- and F-series prostaglandins as well as agonists of a putative calcium-sensing receptor in osteoblasts (3, 14, 18, 31, 37, 42). Recently, treatment with PTH has been shown to reduce the risk of fractures in patients with osteoporosis (36). The therapeutic effects of these agonists may be limited, however, by the rapid attenuation of GPCR signaling that occurs in the continuous presence of agonist (11, 13, 27, 30, 40). This desensitization is largely mediated by direct phosphorylation of receptor serine and threonine residues by a family of seven enzymes termed G protein-coupled receptor kinases (GRKs) (13, 27, 30, 40). Because of the highly restricted tissue distribution of GRK1, GRK4, and GRK7 (30, 40), either GRK2, GRK3, GRK5, or GRK6 is likely to be the important endogenous regulator of GPCR responsiveness in bone. Recent studies from this laboratory and by others indicate that 1) GRKs are expressed in osteoblasts (5, 16, 47), and 2) GRK2 and/or GRK3 plays a dominant role in regulating responsiveness of GPCR systems in bone (10, 15, 33, 47). These data suggest that GRK2 and/or GRK3 plays an important role in modulating bone growth and remodeling. Indeed, previous studies from this laboratory (47) found that inhibiting GRK2 and GRK3 in osteoblasts enhances bone remodeling and increases bone mass.
To further investigate the role of GRK2 in regulating bone formation in vivo, we used the mouse osteocalcin gene-2 (OG2) promoter (9) to overexpress GRK2 (4, 20, 22) in osteoblastic cells and, in turn, enhance GRK2 activity in osteoblasts. Transgenic (TG) mice demonstrated 1) enhanced levels of GRK2 mRNA in bone, 2) decreased PTH-induced cAMP generation by mouse calvaria ex vivo, and 3) evidence of decreased osteoblastic and osteoclastic activity in vivo. Osteoblast-mediated bone formation appeared to be decreased to a greater extent than osteoclastic activity, however, because the low bone turnover state caused a reduction in bone mineral density (BMD) and bone volume that affected predominantly trabecular bone. Taken together, these data indicate that GRK2 is an important endogenous regulator of GPCR systems in bone and suggest that pharmacological manipulation of GRK activity in bone may be a strategy for modulating bone remodeling.
 |
MATERIALS AND METHODS
|
|---|
Materials.
Rat PTH(134) was obtained from Sigma (St. Louis, MO). Pfu DNA polymerase was obtained from Stratagene (La Jolla, CA), and Taq DNA polymerase was obtained from Promega (Madison, WI). All PCR primers were prepared by Operon (Alameda, CA). Cell culture reagents were obtained from GIBCO-BRL (Gaithersburg, MD), and [3H]adenine was purchased from New England Nuclear (Boston, MA). Dr. Darryl Quarles provided the rat osteosarcoma cell line ROS17/2.8 cells (32). Rabbit polyclonal antibodies to the COOH terminus of GRK2 (2) were a kind gift of Dr. Robert J. Lefkowitz. The cDNA for bovine GRK2 was also a gift of Dr. Robert J. Lefkowitz and was produced as previously described (24, 25, 26) by ligating the GRK2 cDNA to the human
-globulin polyadenylation signal (34). A 1.3-kb fragment of the OG2 promoter was provided by Dr. Gerard Karsenty (9).
Immunoblotting of GRKs.
Expression GRK2 was evaluated using previously described techniques (15, 16, 47) with a rabbit polyclonal antibody (2) that recognizes the COOH termini of both GRKs.
Transgene construction and creation of TG mice expressing GRK.
The transgene was constructed in the vector pcDNA 3.1 (Invitrogen, San Diego, CA). To create the transgene, a 1.3-kb fragment of the mouse OG2 promoter was ligated into the unique KpnI/EcoRI site of pcDNA 3.1 vector. The GRK2 cDNA, including the human
-globulin polyadenylation signal, was ligated in the unique EcoRI/XbaI site of pcDNA 3.1, just 3' to the promoter sequence.
Culture and transfection of ROS17/2.8 with the GRK2 transgene.
ROS17/2.8 cells were grown and subcultured as previously described (32). To determine whether our transgene could be expressed by osteoblastic cell lines, we created a construct in which transgene expression was driven solely by the OG2 promoter by removing the CMV promoter sequences in pcDNA 3.1 using the restriction enzymes MluI and HindIII. After the overhangs were filled in with Pfu DNA polymerase, the construct was circularized with T4 DNA ligase. To transfect ROS17/2.8 cells, cells were plated in 60-mm dishes (Costar, Cambridge, MA) and grown to
80% confluence. Cells were then transfected with the Transfast system (Promega) according to the directions of the manufacturer, using 5 µg of plasmid DNA. After selection in G418 (700 µg/ml concentration) for 2 wk, cells were harvested and transgene expression was evaluated by immunoblotting, as described above.
Creation of TG mice overexpressing GRK2.
To create TG mice, the transgene was purified by cesium chloride centrifugation and then linearized by cutting with the restriction enzymes HindIII/XbaI. The linearized transgene was then separated from vector sequences on a 0.8% agarose gel and extracted from the gel using the QIAquick gel extraction kit (Qiagen, Valencia, CA). To remove endotoxins, the transgene was further purified by treatment with the EndoFree Kit (Qiagen) according to the directions of the manufacturer. The purified transgene was injected into the pronuclei of one-cell mouse embryos and then surgically reimplanted into psuedopregnant females in the TG facility at Duke University Medical Center. The Duke TG facility uses the B6SJLF1/J F1 hybrid mouse strain to produce TG mice because 1) this strain superovulates, and 2) F2 TG mice are generally good breeders. TG mice were identified by the polymerase chain reaction as described below. All animal procedures were approved by the Animal Care and Use Committee of Duke University Medical Center.
Screening for TG mice by the PCR.
To screen for our TG animals, we performed PCR using Taq DNA polymerase (Promega) and 100200 ng of DNA prepared from mouse tails using the DNeasy Tissue Kit (Qiagen) according to the directions of the manufacturer. The PCR reaction was performed for 30 cycles using the primer pairs encompassing nucleotides 15671588 (GGAATCAAGCTACTGGACAGTG) of the bovine GRK2 cDNA (4) and nucleotides 469450 (GAAATTGGACAGCAAGAAAG) in the 3'-untranslated region of the human
-globulin mRNA (34), with the thermal cycler set at 94°C for 30 s, 50°C for 30 s, and 72°C for 2 min.
Transgene mRNA expression.
To investigate tissue-specific expression of the transgene, we treated total cellular RNA from mouse tissues with RNase-free DNase (GIBCO) and then reverse transcribed the DNase-treated RNA and performed PCR (RT-PCR). The reverse transcription reaction was performed with Superscript RT (GIBCO) and oligo(dT) primers using 2 µg of total cellular RNA prepared with the TRIzol reagent (GIBCO), according to the directions of the manufacturer. PCR was performed for 30 cycles using Taq DNA polymerase (Promega) and primer pairs encompassing nucleotides 15671588 (GGAATCAAGCTACTGGACAGTG) of the bovine GRK2 cDNA (33) and nucleotides 469450 (GAAATTGGACAGCAAGAAAG) in the 3'-untranslated region of the human
-globulin mRNA (34), with the thermal cycler set at 94°C for 30 s, 50°C for 30 s, and 72°C for 2 min. Control PCR reactions were performed for 30 cycles using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers (Clontech Laboratories, Palo Alto, CA) with the thermal cycler set at 94°C for 30 s, 58°C for 30 s, and 72°C for 2 min. PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide.
Measurement of osteocalcin and PTH levels in blood.
At 6 wk of age, mice were anesthetized with ketamine (90 mg/kg) and xylazine (10 mg/kg), and serum was collected using a retroorbital bleeding technique. Serum osteocalcin levels were quantitated using a two-site immunoradiometric assay from Immunotopics (San Clemente, CA) according to the directions of the manufacturer. Serum PTH levels were quantitated with the use of an enzyme-linked immunosorbant assay from Immunotopics according to the directions of the manufacturer.
Measurement of cAMP generation by mouse calvaria.
To determine whether the GRK2 transgene affected GPCR responsiveness in our TG animals, we measured PTH-induced cAMP generation by mouse calvaria ex vivo as previously described (47). For the experiments, a symmetric fragment of mouse calvarium containing portions of the occipital, frontal, and parietal bones was isolated aseptically from 6-wk-old mice. Calvaria were cut into right and left halves by dividing the bony fragment along the sagital suture line. Right and left halves were each divided into three fragments of equal size. Preliminary experiments suggested that this procedure for obtaining portions of mouse calvaria resulted in bony fragments that varied by <15% by weight (average weight 50.7 ± 1.1 mg). Individual bony fragments of calvaria were placed in separate wells of a six-well plastic culture dish (9.5 cm2/well; Costar, Cambridge, MA). For the cAMP measurements, the bony fragments were covered with DMEM containing 1% FCS and 2 µCi/ml [3H]adenine (New England Nuclear, Boston, MA). After 90 min, 100 µM IBMX was added to the medium. Twenty minutes later, calvaria were stimulated with either 100 nM PTH-(134) or 10 µM forskolin. After 10 min, the medium was aspirated, and the reaction was stopped by adding STOP solution (2.5% perchloric acid containing 100 µM cAMP and 1 µCi of [14C]cAMP) and placing the samples on ice. Generation of cAMP was then measured by the method of Salomon et al. (46) as previously described (15, 47). Data points are the results of triplicate measurements and are expressed as the percent increase above basal cAMP generation.
Expression of osteoprotegrin and receptor activator of NF-
B ligand mRNA.
To investigate the effect of the transgene on osteoprotegrin (OPG) and receptor activator of NF-
B ligand (RANKL) mRNA levels in bone, we performed semiquantitative RT-PCR using 2 µg of total cellular RNA isolated from mouse calvaria, as previously described (47). The reverse transcription reaction was performed with Superscript RT (GIBCO) and oligo(dT) primers using RNA prepared with the TRIzol reagent (GIBCO) according to the directions of the manufacturer. PCR for OPG was performed for 30 cycles using Taq DNA polymerase (Promega) and primers previously shown to specifically amplify OPG (47), with the thermal cycle set at 94°C for 30 s, 50°C for 30 s, and 72°C for 90 s. PCR for RANKL was performed for 30 cycles using Taq DNA polymerase (Promega) and primers previously shown to specifically amplify RANKL (47), with the thermal cycler set at 94°C for 30 s, 52°C for 30 s, and 72°C for 2 min. Thirty cycles of PCR were during the linear phase of template amplification in non-TG control mice. Control PCR reactions were performed for 25 cycles with GAPDH primers (Clontech Laboratories), with the thermal cycler set at 94°C for 30 s, 58°C for 30 s, and 72°C for 2 min. PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide.
Expression of GRK2 mRNA.
To determine whether mRNA for GRK2 was overexpressed in TG animals, we treated total cellular RNA from mouse calvaria with RNase-free DNase (GIBCO) and then performed RT-PCR. The reverse transcription reaction was performed with Superscript RT (GIBCO) and oligo(dT) primers, using 2 µg of total cellular RNA prepared with the TRIzol reagent (GIBCO) according to the manufacturer's recommendations. PCR was performed using the intron-spanning primer pairs encompassing nucleotides 174197 (GTGAGCTACCTGATGGCCATGGAG) and 10581041 (AGGCCCAGGATGATCTC) of the mouse GRK2 cDNA (20, 22). These portions of the mouse and bovine GRK2 cDNA are identical (4, 20), and therefore the primers are suitable for amplification of endogenous GRK2 mRNA and transgene mRNA. PCR was performed for 30 cycles using Taq DNA polymerase (Promega), with the thermal cycler set at 94°C for 30 s, 55°C for 30 s, and 72°C for 2 min. Thirty cycles of PCR was during the linear phase of template amplification in non-TG control mice. PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide. For DNA sequencing, the PCR products were cloned into the vector pCR2.1 according to the directions of the manufacturer (Invitrogen). The ligation reactions were used to transform DH5
competent cells according to the directions of the manufacturer (GIBCO). Individual clones containing insert were picked for sequencing.
Bone histomorphology.
Quantitative histomorphometric analyses of trabecular bone in lumbar vertebrae were performed using previously described techniques (47). Mice were given an intraperitoneal injection of tetracycline-HCl (30 µg/g body wt) followed by an injection of calcein (15 µg/gram body wt) on days 3 and 8 before death, respectively. After harvesting, nondecalcified sections were fixed in 70% ethanol, followed by staining with Villaneuava stain, embedding in methylmethacrylate, and sectioning longitudinally at a thickness of 510 µm. The 5-µm sections were stained with Goldner's stain and analyzed under transmitted light, and the 10-µm Villanueva-prestained sections were analyzed under fluorescent light, as previously described (47), using the Osteomeasure digitizing system (Osteometrics, Atlanta, GA). To analyze the effect of the transgene on cortical bone volume, the left tibia was prepared as described above for light microscopy and sectioned transversely at the tibulofibular junction to standardize the location of the transverse section. Five-micrometer µm sections were stained with Goldner's stain, and bone area (percentage of tissue area) was measured under transmitted light as previously described (47). The terminology and units used are those recommended by the Histomorphometry Nomenclature Committee of the American Society of Bone and Mineral Research (39).
Bone mineral densitometry (BMD and fat content measurements).
BMD was assessed with a Lunar PIXIMUS2 bone densitometer (Lunar, Madison, WI). The instrument was calibrated before scanning sessions using a Phantom with known BMD, according to the manufacturer's guidelines. For the studies, mice were anesthetized with ketamine (90 mg/kg) and xylazine (10-mg/kg dose) and then placed prone on the PIXImus platform. Whole body BMD was assessed by excluding the skull from the BMD measurement. BMD of lumbar spine was assessed by measuring the BMD of the lumbar vertebrae above the pelvis and below the ribs. Femoral BMD was assessed by measuring the middle one-third of the femoral shaft, avoiding the distal and proximal portions of the femur. Whole body fat content was also recorded in each of the densitometry scans. The individual densitometry measurements varied by 35% after repositioning.
Quantitative computed tomography.
High-resolution quantitative computed tomography (QCT) was used to evaluate trabecular bone volume and microarchitecture in the distal femur (µCT40; Scanco Medical, Basserdorf, Switzerland). The femur was scanned at 45 kEv with conebeam mode and a slice increment of 6 µm. Images from each group were generated at identical threshold. Scanning was started approximately at the growth plate and extended proximally for 350 slices. Morphometric analysis was performed on 150 slices extending proximally, beginning with the slice in which the femoral condyles had fully merged. The cortical bone and trabecular bone were separated manually on each slice by a cursor line. The three-dimensional structure was constructed and analyzed with the internal software of the µCT system. Morphometric parameters included the trabecular bone volume fraction (%), trabecular thickness (mm), trabecular number (no./mm), and trabecular spacing (mm).
Measurement of urinary deoxypyridinoline excretion.
Mice were placed in metabolic cages (Hatteras Instrument, Cary, NC), and urine was collected for 24 h. The urine volume was measured before storage at 70°C. Deoxypyridinoline (DPD) excretion was quantitated using the Pyrilinks-D assay kit (Metra Biosystems, Mountain View, CA) according to the recommendations of the manufacturer. Data were expressed as nanomoles DPD per millimole creatinine.
Weights and femur length.
Mice were weighed using a ScoutPro digital scale (Pine Brook, NJ) After euthanasia, femurs were harvested and cleaned of adherent soft tissues before measurement of femur length using a digital caliper (Stoelting, Wood Dale, IL).
Statistical analysis.
Data are presented as the means ± SE. For comparisons between two groups, statistical significance was assessed by a Student's t-test using the InStat computer program (GraphPad Software). For comparisons among more than two groups, statistical analysis was performed by analysis of variance followed by the Bonferroni procedure for multiple pairwise comparisons (51).
 |
RESULTS
|
|---|
Creation of a GRK2 transgene.
To determine whether modulation of GRK activity affects bone formation in vivo, we used a 1.3-kb fragment of the mouse OG2 promoter (see Fig. 1A) to target expression of GRK2 to osteoblasts (3). Before generating TG mice, we determined whether the transgene was expressed in the rat osteosarcoma cell line ROS17/2.8 cells. The GRK2 construct was designed so that expression of the transgene was driven solely by the OG2 promoter (see MATERIALS METHODS). For the studies, ROS17/2.8 cells were transfected with either empty vector or the GRK2 TG construct. The mammalian expression vector used in the experiments contained a neomycin-resistant cassette that permitted G418 selection. After stable transfectants were selected in G418, expression of GRK2 was investigated by immunoblotting. As shown in Fig. 1B, GRK2 was overexpressed by ROS17/2.8 cells transfected with the GRK2 transgene. With a longer exposure, a band for the endogenous GRK2 was also detected in cells transfected with vector. These data are consistent with the notion that the GRK2 transgene is targeted for expression in osteoblasts and achieves greater levels than endogenous GRK2 expression.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 1. Transgene construction and expression. A: G protein-coupled receptor kinase-2 (GRK2) transgene containing the 1.3-kb mouse osteocalcin gene-2 (OG2) promoter, the bovine GRK2 cDNA, and the human -globulin polyadenylation signal. Also shown are the approximate locations of the PCR primers (primer 1 and primer 2) used to screen for transgenic (TG) mice as well as detect expression of transgene mRNA by RT-PCR in mouse tissues. B: rat osteosarcoma cell line ROS17/2.8 cells were transfected with a mammalian expression vector containing our full-length transgene as well as a neomycin-resistant cassette. The constructs were designed so that expression of GRK2 was driven solely by the OG2 promoter (see MATERIALS AND METHODS). After G418 selection, expression of the GRK2 was investigated by immunoblotting. GRK2 was overexpressed by ROS17/2.8 cells transfected with the vector containing our full-length transgene but not in cells transfected with empty vector. C and D: expression of the transgene mRNA in tissues from TG mice and non-TG control animals, respectively. As shown in C, a PCR product of the appropriate size was detected in bone from TG mice using the GRK2 primers when an RT reaction (Rxn) was performed before PCR. A small amount of GRK2 PCR product was also detected in brain with additional PCR cycles, as has been reported by other investigators (17). Sequencing to the PCR product confirmed amplification of GRK2 mRNA. As shown in D, no GRK2 PCR products were detected in tissues from non-TG littermate controls. Control PCR reactions revealed a PCR product of the appropriate size in all tissues using the GAPDH primers when a RT reaction was performed before PCR.
|
|
Effect of GRK2 overexpression on osteoblast-mediated bone formation in vivo.
To determine whether our transgene affected bone formation in vivo, the linearized construct was injected into the pronuclei of one-cell mouse embryos and then surgically reimplanted into psuedopregnant females. Mice were screened for incorporation of the transgene by PCR, using primers specific for the transgene (Fig. 1A). Four independent lines were established from the founder animals, and identical results were obtained using the progeny from these independent founder lines. We first determined tissue-specific expression of our transgene by reverse transcription of total cellular RNA isolated from mouse tissues, followed by PCR using transgene-specific primers (Fig. 1, C and D). As shown in Fig. 1C, a PCR product of the appropriate size was detected in bone from TG mice using GRK2 primers when an RT reaction was performed before PCR. With additional PCR cycles, a small amount of GRK2 PCR product was also detected in brain, as has been reported by other investigators using this promoter sequence (17). Sequencing of the PCR product confirmed the presence of transgene mRNA. No GRK2 PCR products were detected in other tissues from the TG mice or in any of the tissues from the non-TG littermate controls (Fig. 1D). The control PCR reaction (GAPDH) confirmed that the RT reaction was successful in the tissues examined. These data suggest that transgene mRNA expression is targeted to bone with low levels of ectopic expression in brain.
To determine whether mRNA for GRK2 was overexpressed in TG animals, we performed semiquantitative RT-PCR using total cellular RNA isolated from calvaria of TG mice and non-TG littermate controls, as described in MATERIALS AND METHODS. The primers were designed to amplify both endogenous GRK2 mRNA as well as transgene mRNA (see MATERIALS AND METHODS). As shown in Fig. 2A, there was an increase in the levels of a PCR product of the appropriate size in TG animals compared with non-TG controls in the four founder lines. Sequencing to the PCR products confirmed amplification of endogenous mouse GRK2 (20) mRNA as well as TG bovine GRK2 (4) mRNA (see MATERIALS AND METHODS). These data suggest that GRK2 is overexpressed in bone from the four founder lines.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 2. Overexpression of GRK2 mRNA in bone attenuates parathyroid hormone (PTH) receptor signaling. A: semiquantitative RT-PCR was performed using total cellular RNA isolated from mouse calvaria from the 4 TG founder lines as well as from 4 non-TG littermate controls. The primers were designed to amplify both endogenous GRK2 mRNA as well as mRNA of the transgene (see MATERIALS AND METHODS). Enhanced expression of a GRK2 mRNA was detected in the TG founder animals compared with the non-TG controls. B and C: the effect of GRK2 overexpression on cAMP generation by mouse calvaria ex vivo after treatment with PTH-(134) or the direct adenylyl cyclase activator forskolin. As shown in B, PTH-induced cAMP generation was significantly decreased in calvaria from TG mice compared with non-TG littermate controls 10 min after the addition of PTH-(134). As shown C, forskolin-induced cAMP generation by mouse calvaria was similar in TG mice and non-TG control animals. Four TG and 4 non-TG mice were used in the studies presented B and C. *P = 0.0184 vs. non-TG littermate controls.
|
|
We next determined whether expression of the transgene was associated with altered responsiveness of GPCRs in bone by measuring PTH-induced cAMP generation by mouse calvaria ex vivo. As shown in Fig. 2B, we found that PTH-induced cAMP generation was significantly decreased in calvaria from TG mice compared with non-TG littermate controls 10 min after the addition of PTH-(134). In contrast, direct of activation adenylyl cyclase by forskolin increased cAMP generation by mouse calvaria from TG animals and controls to a similar extent (Fig. 2C). Basal cAMP generation was similar in both groups [215 ± 30 dpm (non-TG) vs. 233 ± 31 dpm (TG); P = not significant (NS)]. These data are consistent with the notion that enhancing GRK activity in osteoblasts decreases GPCR responsiveness in bone, and this effect is mediated by inhibiting receptor-effector coupling.
To investigate the phenotype of our TG mice, we first performed BMD measurements on mice at 56 wk of age and at 6 mo of age. Progeny from the four founder lines were used for the experiments, and identical results were obtained using these independent founder lines. As shown Fig. 3, there was a statistically significant decrease in both whole body BMD as well as BMD of trabecular-rich lumbar spine in TG mice compared with non-TG littermate controls at 56 wk of age. A similar pattern was seen in the 6-mo-old mice (Fig. 3), although the difference remained statistically significant only in lumbar spine. As shown in Table 1, whole body and lumbar spine BMD was similarly reduced in both male and female TG mice. In contrast, BMD of the femoral shaft was not altered by the presence of the transgene (Table 2). Femoral BMD was, however, reduced in female mice compared with male mice in both TG and non-TG animals. Femur length was similar in TG and non-TG animals but tended to be reduced in female mice compared with male mice (Table 2). Body weight and whole body fat content were not different in TG and non-TG animals (Table 3). Serum PTH levels were similar in both groups [26.6 ± 3.1 (non-TG) vs. 26.4 ± 5.7 (TG); P = NS]. Taken together, these data suggest that overexpression of GRK2 in osteoblastic cells decreased BMD and that the reduction in BMD affected predominantly trabecular bone.
To further investigate the effect of the transgene on trabecular bone, we measured trabecular bone volume in the distal femur using QCT. Results of these studies are shown in Fig. 4 and in Table 4. We found that overexpression of GRK2 in osteoblasts significantly decreased the volume of trabecular bone in distal femur of 5- to 6-wk-old mice. This decrease in bone volume was predominantly due to a decrease in trabecular thickness, with a more modest change in the number of trabeculae (Table 4). These data are consistent with the BMD studies and suggest that the GRK2 transgene causes a decrease in trabecular bone mass.

View larger version (102K):
[in this window]
[in a new window]
|
Fig. 4. Effect of GRK2 overexpression on trabecular bone volume. Trabecular bone volume was measured by examining trabecular bone in distal femur using quantitative computed tomography (QCT), as described in the MATERIALS AND METHODS. A and B: QCT scans from control mice and TG mice, respectively, that had the median trabecular bone volumes of the 7 TG and 7 non-TG animals that were studied. C and D: QCT scans from control mice and TG mice, respectively, that had the lowest trabecular bone volumes of the animals studied. As shown in Table 4, there was a significant decrease in trabecular bone volume in TG mice compared with non-TG littermate controls. The loss of trabecular bone was due to a decrease in trabecular thickness with a more modest change in trabecular number (Table 4).
|
|
We next performed bone histomorphometry on lumbar vertebrae isolated from mice at 56 wk of age. Data was similar in male and female animals and was therefore combined for the statistical analysis. As shown in Table 5, both trabecular bone volume and osteoblast perimeter were significantly decreased in TG mice compared with non-TG littermate controls. Osteoid surface and osteoclast perimeter were similar in the TG animals and non-TG littermates. The decrease in trabecular bone volume reflects, at least in part, diminished bone formation, since the dynamic indexes of bone formation showed a decrease in both the mineralizing perimeter as well as the bone formation rate (BFR) (Table 5). The mineral apposition rate (MAR) was not significantly affected by the presence of the transgene. To assess the effect of the transgene on cortical bone, additional histomorphometric studies were performed using tibias as described in MATERIALS AND METHODS. Cortical bone cross-sectional area of tibias was not different in TG mice compared with non-TG littermate controls [72.4 ± 0.8% (non-TG) vs. 71.2 ± 1.4% (TG); P = NS]. Taken together, these data are consistent with the notion that inhibition of GRK activity in osteoblasts caused a decrease in trabecular bone volume by reducing osteoblast-mediated bone formation.
Effect of the transgene on expression OPG and RANKL mRNA and excretion of DPD.
The osteoclast inhibitory factor OPG and the osteoclast differentiation factor RANKL are potent regulators of osteoclast development (49). Both OPG and RANKL are produced by osteoblasts (49), and agonists of several GPCR systems have been shown to modulate their production (29, 6, 38). We therefore determined whether our transgene affected OPG and RANKL mRNA levels. For the experiments, we performed semiquantitative RT-PCR using total cellular RNA isolated from calvaria of TG mice and non-TG littermate controls at 6 wk of age. As shown in Fig. 5A, OPG mRNA levels were increased in TG animals compared with non-TG littermate controls. In contrast, RANKL mRNA levels were decreased compared with those of controls (Fig. 5B). The GAPDH PCR products confirmed that the RT reaction was successful in the animals studied (Fig. 5C). Densitometric analyses indicated that the changes in OPG and RANKL mRNA levels were statistically significant in TG mice compared with non-TG controls (Fig. 5D) This alteration in the pattern of OPG and RANKL production would tend to inhibit osteoclast activation. We therefore measured urinary excretion of DPD, which is a marker of osteoclastic activity (9), in vivo. As shown in Fig. 5E, urinary excretion of DPD was decreased in TG mice compared with non-TG littermate controls. Serum osteocalcin levels tended to be higher in non-TG mice at 6 wk of age (880 ± 121 ng/ml) compared with TG mice (630 ± 38 ng/ml), but this difference did not reach statistical significance (P = 0.0914). These data suggest that the decrease in trabecular bone volume is not a result of increased osteoclastic activity.
 |
DISCUSSION
|
|---|
GPCR agonists are important endogenous regulators of bone remodeling (8, 28, 35, 37, 42, 45, 48). Moreover, agonists of several GPCR systems may be useful therapies for regenerating the trabecular skeleton (14, 18, 19, 21, 31, 37, 42, 50). The effects of GPCR agonists as anabolic agents may be modulated by the desensitization of receptor signaling that occurs in the continuous presence of agonist (13, 27, 30, 40). This decrease in receptor responsiveness is largely mediated by direct phosphorylation of GPCR proteins by a family of enzymes termed GRKs (13, 27, 30, 40). Recent studies suggest that GRK2 and/or GRK3 plays a dominant role in regulating responsiveness of GPCR systems in bone (11, 15, 33). In the present studies, we investigated the role of GRK2 in modulating GPCR responsiveness in vivo by overexpressing GRK2 in osteoblastic cells. We found that enhancing GRK2 activity in osteoblasts 1) inhibited PTH-induced cAMP generation by mouse calvaria ex vivo, 2) caused a reduction in BMD and trabecular bone volume, and 3) decreased bone remodeling, as evidenced by a reduction in osteoblast-mediated bone formation, as well as decreased osteoclastic activity, as evidenced by reduced excretion of DPD in urine. These findings suggest that GRKs play an important role in regulating GPCRs in bone and suggest that manipulation of GRK activity in bone may be a useful treatment strategy for modulating bone remodeling.
Although both bone formation and bone resorption were reduced in TG mice, the net effect of the transgene was a reduction in bone mass, as evidenced by a decrease in BMD and trabecular bone volume in the TG animals compared with non-TG littermate controls. Although this observation may initially seem paradoxical, bone mass is determined by the rate of bone formation relative to the rate of bone resorption. A decrease in bone mass occurs if the rate of bone formation is less than the rate of bone resorption. With regard to the present studies, the data suggest that both bone resorption and bone formation were reduced in the TG mice compared with the non-TG littermate controls. We speculate that the decrease in bone mass in the TG mice is caused by a decrease in osteoblastic activity out of proportion to the decrease in osteoclastic activity. These data suggest that enhancing GRK activity in osteoblasts diminishes the anabolic effects of GPCR systems, leading to bone loss.
Consistent with the BMD data, histomorphometric analysis indicated that trabecular bone volume was decreased in TG mice compared with non-TG littermate controls. In TG animals, the decrease in trabecular bone volume was associated with a diminished osteoblastic surface as well as a decrease in the BFR and mineralizing perimeter. This pattern of histomorphometric findings is consistent with the notion that the GRK2 transgene promotes a decrease in bone mass by decreasing the number of basic multicellular units (BMUs). In contrast to the BFR, however, MAR was not altered by the presence of the transgene. Because the BFR is derived from the MAR and mineralizing perimeter (39), these data suggest that the decrease in bone formation in TG mice is caused, predominantly, by a decrease in the mineralizing perimeter. The transgene, therefore, appears to reduce bone formation in TG mice by decreasing the number of BMUs without altering the activity of individual bone forming units. This decrease in the number of BMUs could be due to either a reduction in activation of new bone formation sites or to a diminished life span of existing sites. The observation that the OG2 promoter drives gene expression in postmitotic mature osteoblasts (3) suggests that osteoblast proliferation or increased recruitment of new osteoblasts was not the dominant factor leading to the decrease in the BFR and osteoblastic surfaces. Studies by Jilka et al. (23) may, however, be relevant with regard to mechanism. Theses investigators found that GPCR agonists such as PTH are potent inhibitors of osteoblast apoptosis both in vitro and in vivo. Moreover, studies from this laboratory (15) and by other investigators (10, 33) suggest that GRK2 potently inhibits responsiveness of the PTH receptor. Although further studies will be necessary to examine the role of apoptosis in our TG model, it is tempting to speculate that the decrease in osteoblastic surfaces and BFR in the present study may be mediated by promoting osteoblast apoptosis.
The study results are in agreement with previous investigations from this laboratory (47) that examined the osseous effects of inhibiting GRK activity in osteoblasts using TG technologies. In these previous studies, TG mice demonstrated enhanced bone remodeling, as evidenced by an increase in osteoblast-mediated bone formation, as well as enhanced osteoclastic activity, as evidenced by increased urinary DPD excretion. The net effect of the transgene in this previous study, however, was anabolic, because both BMD and trabecular bone volume were increased in TG mice compared with non-TG littermate controls. Thus inhibition of osteoblastic GRK activity increased bone mass, whereas, in the present study, enhancing GRK2 activity in osteoblasts decreased bone volume. Taken together, these data provide compelling evidence that modulating GRK activity in osteoblasts has potent effects on bone mass.
GRKs phosphorylate GPCR proteins at serine and threonine residues and, in turn, promote binding of a second group of protein cofactors termed arrestins, which interfere with receptor-effector coupling, presumably through steric mechanisms (30). In the present study, we measured cAMP generation by mouse calvaria ex vivo after treatment with either PTH-(134) or the direct adenylyl cyclase activator forskolin. We found that GPCR-stimulated cAMP generation was attenuated by the presence of the GRK2 transgene without altering cAMP generation after direct activation of adenylyl cyclase by forskolin. These data suggest that the ability of adenylyl cyclase to generate cAMP is intact; the reduction in PTH-induced cAMP generation is, therefore, caused by a decrease in the ability of the PTH receptor to couple to its effector systems (adenylyl cyclase). This pattern of attenuated GPCR responsiveness is mechanistically consistent with the known actions of the GRKs (30).
While a major action of GRKs is to phosphorylate GPCR proteins, GRK2 also has effects that are not directly related to receptor phosphorylation (27). For example, GRK2 has domains that show significant homology to proteins termed regulators of G protein signaling (RGS proteins). These RGS proteins enhance GTPase activity of G protein
-subunits and, in turn, decrease the duration of G protein
-subunit activation (27). RGS domains in GRK2 weakly enhance GTPase activity of G
q subunits but significantly impair the ability of G
q-coupled receptors to stimulate phospholipase C, apparently by sequestering G
q subunits and preventing coupling to their effector systems (27). Although the role of G
q-coupled signaling cascades in regulating bone mass are not known with certainty, studies using the PTH receptor system suggest that the anabolic effects of PTH in vivo are mediated predominantly by adenylyl cyclase-dependent pathways (1); G
q-coupled pathways have little effect on PTH-induced bone formation in vivo (1). In contrast, activation of the G
q-coupled receptor for prostaglandin F2
(7) potently stimulates new bone formation (41). In some instances, therefore, inhibition of G
q signaling by GRK2 might favor a reduction in bone mass. Thus it is possible that the effect of the transgene in the present study is, in part, mediated by mechanisms for inhibiting GPCR signaling not directly related to GPCR phosphorylation.
Normally, osteoblastic activity is closely coupled to the activity of osteoclasts. This coupling is due, at least in part, to production of the regulatory factors produced by osteoblasts (49), including the osteoclast inhibitory factor OPG and the osteoclast differentiation factor RANKL (29, 6, 38). In the present studies, we found that inhibition of osteoblastic activity by overexpression of GRK2 in osteoblasts was associated with enhanced mRNA levels of OPG and decreased mRNA levels of RANKL. This pattern of OPG and RANKL production would promote a low rate of bone remodeling. Indeed, excretion of the osteoclast activity marker, DPD, was decreased in urine of TG mice compared with control animals. Despite this increase in DPD excretion, we did not find a decrease in osteoclast perimeter in TG mice by bone histomorphometry. The inability to detect a difference in osteoclast number between TG and non-TG animals may, in part, be related to the sensitivity of the methodology. Alternatively, there may be little change in the actual number of osteoclasts, but the activity of individual osteoclasts is reduced. Taken together, the alterations in OPG and RANKL mRNA levels in conjunction with decreased urinary DPD excretion suggest that the transgene promotes reduced coupling of osteoblast-mediated bone formation to bone resorption by osteoclasts.
In summary, we found that overexpression of the potent GPCR regulator GRK2 in osteoblasts produced a low bone turnover state that reduced bone mass, ostensibly by reducing osteoblast-mediated bone formation out of proportion to osteoclast-mediated bone resorption. These studies, taken together with previous work from this laboratory (47), suggest that GRKs play a key role in regulating bone formation. We speculate that modulating GRK activity in bone may be a useful strategy for altering bone mass.
 |
GRANTS
|
|---|
These studies were supported by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grants R01-AR-4672 (R. F. Spurney) and RO1-AR-37308 (L. D. Quarles).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Cristy McGranahan for administrative assistance in preparing the manuscript.
Present addresses: S. Lui and D. Quarles are currently affiliated with the Kansas University Medical Center, Kansas City, KS 66160.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: R. F. Spurney, Box 3014, Duke Univ. Medical Center, Durham, NC 27710 (E-mail: spurn002{at}mc.duke.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Armamento-Villareal R, Ziambaras K, Abbasi-Jarhomi SH, Dimarogonas A, Halstead L, Fausto A, Avioli LV, and Civitelli R. An intact N terminus is requried for the anabolic action of parathyroid hormone on adult female rats. J Bone Miner Res 12: 384392, 1997.[CrossRef][Web of Science][Medline]
- Arriza JL, Dawson TM, Simerly RB, Martin LJ, Caron MG, Snyder SH, and Lefkowitz RJ. The G-protein-coupled receptor kinases BARK1 and BARK2 are widely distributed at synapses in rat brain. J Neurosci 12: 40454055, 1992.[Abstract]
- Aubin JE. Advances in the osteoblast lineage. Biochem Cell Biol 76: 899910, 1998.[CrossRef][Web of Science][Medline]
- Benovic JL, DeBasi A, Stone WC, Caron MG, and Lefkowitz RJ.
-Adrenergic kinase: primary structure delineates a multigene family. Science 246: 235240, 1989.[Abstract/Free Full Text]
- Bliziotes M, Murtagh J, and Wiren K.
-Adrenergic receptor kinase-like activity and
-arresting are expressed in osteoblastic cells. J Bone Miner Res 11: 820826, 1996.[Web of Science][Medline]
- Brandstrom H, Jonsson KB, Ohlsson C, Vidal O, Ljunghall S, and Ljunggren O. Regulation of osteoprotegrin mRNA levels by prostaglandin E2 in human bone marrow stromal cells. Biochem Biophys Res Commun 247: 338341, 1998.[CrossRef][Web of Science][Medline]
- Breyer RM, Bagdassarian CK, Myers SA, and Breyer MD. Prostanoid receptors: subtypes and signaling. Annu Rev Pharmacol Toxicol 41: 661690, 2001.[CrossRef][Web of Science][Medline]
- Canalis E. Osteogenic growth factors. In: Primer of Metabolic Bone Diseases and Disorders of Mineral Metabolism (5th ed.), edited by Favus MJ. Richmond, VA: Cadmus Professional Communications, 2003, p. 2832.
- Corral DA, Amling M, Priemel M, Loyer E, Fuchs S, Ducy P, Baron R, and Karsenty G. Dissociation between bone resorption and bone formation in osteopenic transgenic mice. Proc Natl Acad Sci USA 95: 1383513840, 1998.[Abstract/Free Full Text]
- Dicker F, Quitterer U, Winstel R, Honold K, and Lohse M. Phosphorylation-independent inhibition of parathyroid hormone receptor signaling by G protein-coupled receptor kinases. Proc Natl Acad Sci USA 96: 54765481, 1999.[Abstract/Free Full Text]
- Dohlman HG, Thorner J, Caron MG, and Lefkowitz RJ. Model systems for the study of seven-transmembrane-segment receptors. Annu Rev Biochem 60: 653688, 1991.[CrossRef][Web of Science][Medline]
- Eastel R. Treatment of postmenopausal osteoporosis. N Engl J Med 338: 736745, 1988.
- Ferguson SSG, Barak LS, Zhang J, and Caron MG. G-protein-coupled receptor regulation: role of G-protein-coupled receptor kinases and arrestins. Can J Physiol Pharmacol 74: 10951110, 1996.[CrossRef][Web of Science][Medline]
- Finkelstein JS, Klibanski A, Schaefer EH, Hornstein MD, Schiff I, and Neer RM. Parathyroid hormone for the prevention of bone loss induced by estrogen deficiency. N Engl J Med 331: 16181623, 1994.[Abstract/Free Full Text]
- Flannery PJ and Spurney RF. Domains of the parathyroid hormone (PTH) receptor required for regulation by G protein-coupled receptor kinases. Biochem Pharmacol 62: 10471058, 2001.[CrossRef][Web of Science][Medline]
- Flannery PJ and Spurney RF. Regulated expression of G protein coupled receptor kinases (GRKs) and
-arrestins in osteoblasts. Calcif Tissue Int 73: 153160, 2003.[CrossRef][Web of Science][Medline]
- Frendo JL, Xiao F, Fuchs S, Franceschi RT, Karsenty G, and Ducy P. Functional hierarchy between two OSE2 elements in the control of osteocalcin gene expression in vivo. J Biol Chem 273: 3050930516, 1998.[Abstract/Free Full Text]
- High WB. Effects of orally administered prostaglandin E2 on cortical bone turnover in adult dogs: a histomorphometric study. Bone 8: 363373, 1988.[CrossRef]
- Hock JM and Gera I. Effects of continuous and intermittent administration and inhibition of resorption on the anabolic response of bone to parathyroid hormone. J Bone Miner Res 7: 6572, 1992.[Web of Science][Medline]
- Hughes RJ, Anderson KL, Kiel D, and Insel PA. Cloning of GRK2 cDNA from S49 murine lymphoma cells. Am J Physiol Cell Physiol 270: C885C891, 1996.[Abstract/Free Full Text]
- Iida-Klein A, Zhou H, Lu SS, Bevine LR, Ducayen-Knowles M, Dempster DW, Nieves J, Lindsay R. Anabolic action of parathyroid hormone is skeletal site specific at the tissue and cellular levels in mice. J Bone Miner Res 17: 808816, 2002.[CrossRef][Web of Science][Medline]
- Jaber M, Koch WJ, Rockman H, Smith B, Bond RA, Sulik KK, Ross J, Lefkowitz RJ, Caron MG, and Giros B. Essential role of
-adrenergic receptor kinase 1 in cardiac development and function. Proc Natl Acad Sci USA 93: 1297412979, 1996.[Abstract/Free Full Text]
- Jilka RJ, Weinstein RS, Bellido T, Roberson P, Parfitt A, and Manolagas SC. Increased bone formation by prevention of osteoblast apoptosis with parathyroid hormone. J Clin Invest 104: 439446, 1999.[Web of Science][Medline]
- Koch WJ, Inglese J, Stone C, and Lefkowitz RJ. The binding site for the

subunits of heterotrimeric G proteins on the
-adrenergic receptor kinase. J Biol Chem 268: 82568260, 1993.[Abstract/Free Full Text]
- Koch WJ, Hawes BE, Inglese J, Luttrell LM, and Lefkowitz RJ. Cellular expression of the carboxyl terminus of a G protein-coupled receptor kinase attenuates G

-mediated signaling. J Biol Chem 269: 61936197, 1994.[Abstract/Free Full Text]
- Koch WJ, Rockman HA, Samama P, Hamilton R, Bond RA, Milano CA, and Lefkowitz RJ. Cardiac function in mice overexpressing the
-adrenergic receptor kinase or a
ARK inhibitor. Science 268: 13501353, 1995.[Abstract/Free Full Text]
- Kohout TA and Lefkowitz RJ. Regulation of G protein-coupled receptor kinases and arrestins during receptor desensitization. Mol Pharmacol 63: 918, 2003.[Free Full Text]
- Lanske B, Karaplis AC, Lee K, Luz A, Vortkamp A, Pirro A, Karperien M, Defize LHK, Ho C, Mulligan RC, Abou-Samra AB, Juppner H, Segre GV, and Kronenberg HM. PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth. Science 273: 663666, 1996.[Abstract]
- Lee SK and Lorenzo JA. Parathyroid hormone stimulates TRANCE and inhibits osteoprotegrin messenger ribonucleic acid expression in murine bone marrow cultures: correlation with osteoclast-like cell formation. Endocrinology 140: 35523561, 1999.[Abstract/Free Full Text]
- Lefkowitz RJ. G-protein-coupled receptor kinases. Cell 74: 409412, 1993.[CrossRef][Web of Science][Medline]
- Liu CC, Kalu DN, Salerno I, Echon R, Hollis BW, and Ray M. Preexisting bone loss associated with ovariectomy in rats is reversed by parathyroid hormone. J Bone Miner Res 6: 10711079, 1991.[Web of Science][Medline]
- Liu S, Guo R, and Quarles LD. Cloning and characterization of the proximal murine Phex promoter. Endocrinology 142: 39873995, 2001.[Abstract/Free Full Text]
- Malecz N, Bambino T, Bencsik M, and Nissenson RA. Identification of phosphorylation sites in the G protein-coupled receptor for parathyroid hormone. Receptor phosphorylation is not required for agonist-induced internalization. Mol Endocrinol 12: 18461856, 1998.[Abstract/Free Full Text]
- Marotta CA, Wilson JT, Forget BG, and Weissman SM. Human
-globulin messenger RNA. J Biol Chem 252: 50405053, 1977.[Abstract/Free Full Text]
- Mundy GR, Chen D, and Oyajobi BO. Bone-remodeling. In: Primer of Metabolic Bone Diseases and Disorders of Mineral Metabolism (5th ed.), edited by Favus MJ. Richmond, VA: Cadmus Professional Communications, 2003, p. 4658.
- Neer RM, Arnaud CD, Zanchetta JR, Prince R, Gaich GA, Reginster JY, Hodsman AB, Eriksen EF, Ish-Shalom S, Genant HK, Wang O, and Mitlak BH. Effect of parathyroid hormone (134) on fractures and bone mineral density in postmenopausal women with osteoporosis. N Engl J Med 344: 14341443, 2001.[Abstract/Free Full Text]
- Okada Y, Tomita M, Tsurukami H, Nakamura T, Alander C, Sohn J, Raisz L, Lorenzo J, and Pilbeam CC. Effects of prostaglandin G/H synthase-2 knockout on bone (Abstract). J Bone Miner Res 14: S173, 1999.
- Onyia JE, Miles RR, Yang X, Halladay DL, Hale J, Glasebrook A, McClure D, Seno DG, Sekhar S, and Martin TJ. In vivo demonstration that human parathyroid hormone 138 inhibits the expression of osteoprotegrin in bone with the kinetics of an immediate early gene. J Bone Miner Res 15: 863871, 2000.[CrossRef][Web of Science][Medline]
- Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, and Recker RR. Bone histomorphometry: standardization of nomenclature, symbols and units. J Bone Miner Res 2: 595610, 1987.[Web of Science][Medline]
- Premont RT, Inglese J, and Lefkowitz RJ. Protein kinases that phosphorylate activated G protein-coupled receptors. FASEB J 9: 175182, 1995.[Abstract]
- Quarles LD and Siddhanti SR. Guanine nucleotide binding-protein coupled signaling pathway regulation of osteoblast-mediated bone formation. J Bone Miner Res 11: 13751383, 1996.[Web of Science][Medline]
- Quarles LD. Cation sensing receptors in bone: a novel paradigm for regulating bone remodeling? J Bone Miner Res 11 :19711974, 1997.
- Recker RR and Barger-Lux MJ. Bone biopsy and histomorphometry in clinical practice. In: Primer of Metabolic Bone Diseases and Disorders of Mineral Metabolism (5th ed.), edited by Favus MJ. Richmond, VA: Cadmus Professional Communications, 2003, p. 213219.
- Reeve J, Meunier PJ, Parsons JA, Bernat M, Bijvoet OM, Courpron P, Edouard C, Klenerman L, Neer RM, Slock D, Vismans FJ, and Potts JT Jr. Anabolic effect of human parathyroid hormone fragment on trabecular bone in involution osteoporosis: a multicentre trial. Br Med J 280: 13401344, 1980.[Abstract/Free Full Text]
- Saino H, Matsuyama T, Takada J, Kaku T, Ishii S. Long-term treatment of indomethacin reduces vertebral bone mass and strength in ovariectomized rats. J Bone Miner Res 12: 18441850, 1997.[CrossRef][Web of Science][Medline]
- Salomon Y, Londos C, and Rodbell M. A highly sensitive adenylate cyclase assay. Anal Biochem 58: 541548, 1974.[CrossRef][Web of Science][Medline]
- Spurney RF, Flannery PJ, Garner SC, Athirakul K, Liu S, Guilak F, and Quarles LD. Anabolic effects of a G protein-coupled receptor kinase inhibitor expressed in osteoblasts. J Clin Invest 109: 13611371, 2002.[CrossRef][Web of Science][Medline]
- Strewler GL. The physiology of parathyroid hormone-related protein. N Engl J Med 342: 177185, 2000.[Free Full Text]
- Takahashi N, Udagawa N, and Suda T. A new member of the tumor necrosis factor ligand family, ODF/OPGL/TRANCE/RANKL, regulates osteoclast differentiation and function. Biochem Biophys Res Commun 256: 229255, 1999.
- Tam CS, Heersche JNM, Murray TM, and Parsons JA. Parathyroid hormone stimulates the bone apposition rate independently of its resorptive action: differential effects of intermittent and continuous administration. Endocrinology 100: 506512, 1982.
- Wallenstein S, Zucker CL, and Fleiss JL. Some statistical methods useful in circulation research. Circ Res 47: 112, 1980.[Abstract/Free Full Text]
Copyright © 2005 by the American Physiological Society.