AJP - Endo Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 288: E701-E706, 2005. First published November 30, 2004; doi:10.1152/ajpendo.00519.2004
0193-1849/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
288/4/E701    most recent
00519.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (29)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Slominski, A.
Right arrow Articles by Wortsman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Slominski, A.
Right arrow Articles by Wortsman, J.

CRH stimulation of corticosteroids production in melanocytes is mediated by ACTH

Andrzej Slominski,1 Blazej Zbytek,1 Andrzej Szczesniewski,2 Igor Semak,3 Jan Kaminski,1 Trevor Sweatman,4 and Jacobo Wortsman5

Departments of 1Pathology and Laboratory Medicine and 4Pharmacology, Health Science Center, University of Tennessee, Memphis, Tennessee; 2Agilent Technologies, Incorporated, Schaumburg, Illinois; 3Department of Biochemistry, Belarus State University, Minsk, Belarus; and 5Department of Medicine, Southern Illinois University, Springfield, Illinois

Submitted 29 October 2004 ; accepted in final form 23 November 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 NOTE ADDED IN PROOF
 GRANTS
 REFERENCES
 
The response to systemic stress is organized along the hypothalamic-pituitary-adrenal axis (HPA), whereas the response to a peripheral stress (solar radiation) is mediated by epidermal melanocytes (cells of neural crest origin) responsible for the pigmentary reaction. Melanocytes express proopiomelanocortin (POMC), corticotropin-releasing hormone (CRH), and CRH receptor-1 (CRH-R1) and can produce corticosterone. In the present study, incubation of normal epidermal melanocytes with CRH was found to trigger a functional cascade structured hierarchically and arranged along the same algorithm as in the HPA axis: CRH activation of CRH-R1 stimulated cAMP accumulation and increased POMC gene expression and production of ACTH. CRH and ACTH also enhanced production of cortisol and corticosterone, and cortisol production was also stimulated by progesterone. The chemical identity of the cortisol was confirmed by liquid chromatography-mass spectrometry without mass spectrometry-mass spectrometry analyses. POMC gene silencing abolished the stimulatory effect of CRH on corticosteroid synthesis, indicating that this is indirect and mediated via production of ACTH. Thus the melanocyte response to CRH is highly organized along the same functional hierarchy as the HPA axis. This pattern demonstrates the fractal nature of the response to stress with similar activation sequence at the single-cell and whole body levels.

corticotropin-releasing hormone; adrenocorticotropic hormone; cortisol; corticosterone


THE HYPOTHALAMIC-PITUITARY-ADRENAL (HPA) AXIS is activated by stress-sensoring central circuits to produce and release corticotropin-releasing hormone (CRH). This, in turn, stimulates anterior pituitary CRH receptor type-1 (CRH-R1) (3, 5), which enhances the production and secretion of the anterior pituitary-derived proopiomelanocortin (POMC) peptide ACTH (22). Upon its release into systemic circulation, ACTH activates the MC2 receptors (MC2-R) of the adrenal gland to induce steroid production and secretion, most prominently corticosterone (rodents) and cortisol (humans). These steroids are powerful anti-inflammatory factors that counteract the stressors and buffer tissue damage (3). The same steroids act to terminate the stress response by attenuating CRH and POMC peptide production.

The skin, because of its location at the interface between external environment and internal milieu, acts to preserve body homeostasis. This is a complete function that includes the barrier-forming properties of the epidermis, the secretory activity of adnexal structures, and activities of the local immune and pigmentary systems, as well as vascular and mesenchymal components of the dermis. Being continuously exposed to acute transfers of solar, thermal, and mechanical energy, the skin requires instant responses for the restoration of its structural and functional integrity. Thus precise stress-response coordination is an additional cutaneous function that appears to be served by locally expressed neuroendocrine activities (17, 19, 20).

We have proposed that, because of the cutaneous expression of HPA mediators of the stress response and the similar functional relevance of the two structures, it was possible that the operational drives were organized in similar regulatory order (12, 17, 19, 20). This is based on the intrinsic capabilities of the skin to actually produce CRH peptides and POMC as well as express the corresponding receptors (6, 14, 15, 17, 19, 20, 24). The skin is also a powerful steroidogenic tissue, as it expresses genes and enzymes involved in the production of steroids and can also transform cholesterol to pregnenolone or progesterone to deoxycorticosterone and corticosterone (2, 911, 21, 23, 24). Cutaneous expression of these neuroendocrine elements is subject to regulation by environmental factors (17, 19, 20).

We therefore evaluated directly whether the cutaneous expression of endocrine mediators represents random usage or whether it is a full organizational duplication of the HPA axis (12, 17). The latter would assume that information flow in this cutaneous axis is structured hierarchically; thus CRH-mediated activation of CRH-R1 would be followed by POMC expression with production of ACTH, which would then stimulate cortisol/corticosterone production. Because {alpha}-melanocyte-stimulating hormone ({alpha}-MSH) is not a functional component of the sustained stress response, processing of ACTH to this peptide was not studied. In the current investigation, we used an experimental model of cultured normal epidermal melanocytes (expressing exclusively CRH-R1; Ref. 14), because pigmentary reaction is a classical response to the environmental stress represented by UV solar light exposure (13, 16, 17, 19, 20).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 NOTE ADDED IN PROOF
 GRANTS
 REFERENCES
 
Cell culture. Normal human epidermal melanocytes from moderately pigmented skin (Cascade Biologics, Portland, OR) and immortalized PIG-I human melanocytes were cultured as described (14). Cells were seeded into multiwell plates, incubated for 24 h in EpiLife medium with EpiLife Defined Growth Supplement free of serum and pituitary extract (Cascade Biologics). Afterward, the cells were washed three times with PBS and then incubated in supplement-free EpiLife medium with or without CRH (American Peptide, Sunnyvale, CA), ACTH, forskolin, or IBMX (0.1 mM) or progesterone (1 µM) (Sigma, St. Louis, MO) at indicated concentrations (see figures) (14). After 12 h, CRH or ACTH was added again, and at 24 h, media were collected for steroid assays and cells for protein or RNA extractions.

ACTH production. ACTH(1–39) concentrations in cell extracts (diluted with water 1:4) and in supernatants were measured with two-site ELISA (Alpco Diagnostics, Windham, NH). It uses affinity-purified goat polyclonal antibody to human ACTH(34–39) and a mouse monoclonal antibody to the midregion and NH2 terminus of human ACTH(1–24). In accordance with the manufacturer's instructions, the intra-assay coefficient of variation was ≤4.2%, sensitivity was 0.46 pg/ml, and cross-reactivity with {beta}-endorphin was <0.01% and with {alpha}-MSH <5.65%. ACTH concentration in cell extracts was normalized to total protein content [quantified with bicinchoninic acid (BCA) reagent; Pierce Biotechnology, Rockford, IL].

Cortisol and corticosterone determination. Cortisol and corticosterone levels in supernatants were measured with ELISA. Corticosterone and cortisol ELISA kits were purchased from R&D Systems (Minneapolis, MN; the majority of assays) or from Bio-Quant (San Diego, CA; to measure the effect of progesterone concentration). To exclude cross-reactivity interference on the assay values, cortisol levels were measured in media incubated with serial dilutions of progesterone in multiwell plates; these values were then subtracted from values obtained from the melanocyte-conditioned media. Steroid concentrations in cell extracts were normalized to total protein content (quantified with BCA reagent, Pierce Biotechnology).

cAMP assays. cAMP concentration was measured by a cAMP functional assay kit (Packard BioScience, Meriden, CT) as described previously (7). Briefly, serial dilutions of CRH and urocortin peptides were added to the supplement-free culture media containing 0.5 mM IBMX, and the cells were incubated with the ligand for 1 h at 37°C and 5% CO2 in the incubator. The signal in cell extracts was measured by the Fusion-{alpha} instrument (Packard BioScience). cAMP concentration was recalculated from the standard curve according to the manufacturer's protocol (Packard BioScience).

POMC promoter activity. Luciferase reporter gene plasmid containing POMC promoter region and fragment of the exon 1 (from –394 to +365 bp) was constructed, and transient transfections were performed as described previously (7). Transfection media were changed at 24 h, and cells were treated as above. Relative reporter gene response was calculated as described (7). Briefly, luciferase and Renilla luciferase signals were recorded with a TD-20/20 luminometer (Turner Designs, Sunnyvale, CA), and then, after subtraction of background, the resulting POMC-specific signal was divided by the Renilla signal (signal proportional to the number of transfected cells). The values obtained were divided by the mean value of control (untreated) cells.

POMC gene silencing and CRH-R1 specificity control. Cells were transfected with POMC short interfering RNA (siRNA) and antisense oligonucleotides according to the manufacturer's instructions (Santa Cruz Biotechnology), using a reported sequence of POMC antisense and scrambled oligonucleotides (4). Gene silencing efficiency was determined with POMC real-time RT-PCR and ACTH ELISA. Medium and cell collection were as above. Antalarmin (10–5 M, CRH-R1 antagonist; Sigma) was added 1 h before CRH.

Real-time RT-PCR. Reverse transcription of RNA samples pretreated with DNase I was performed with SuperScript First-Strand Synthesis System (Invitrogen Life Technologies, Carlsbad, CA). The primers were designed with ABI Primer Express, with sequences as follows: POMC (Genebank accession no. NM_000939) forward CTACGGCGGTTTCATGACCT, reverse CCCTCACTCGCCCTTCTTG; 18S rRNA (Genebank accession no. X03205) forward TTCGGAACTGAGGCCATGAT, reverse TTTCGCTCTGGTCCGTCTTG. The reaction was performed with Sybr Green PCR Master Mix; data were collected on an ABI Prism 7700 and analyzed on Sequence Detector 1.9.1 (ABI, Foster City, CA). POMC amounts were related to 18S rRNA by the comparative critical threshold method.

Liquid chromatography-mass spectrometry analysis with auto mass spectrometry-mass spectrometry. Melanocytes were washed three times with PBS and then incubated in supplement-free EpiLife medium supplemented with 1 µM progesterone and 100 nM CRH for 24 h. Collected media were passed through GMF 0.45-µm pore-size filters (Whatman, Clifton, NJ). Steroids were extracted twice with methylene chloride at a ratio of 1:1. The methylene chloride layers were combined and dried under a stream of nitrogen. The dry samples were sent shipped on dry ice for liquid chromatography-mass spectrometry (LC/MS) analyses at Agilent Technologies (Schaumburg, IL).

The residues were dissolved in methanol containing 0.1% formic acid and analyzed by LC/MS/MS using an Agilent 1100 LC/MSD-Trap-XCT system (Agilent Technologies, Palo Alto, CA). The samples were separated on an 1100 LC capillary equipped with a Zorbax SBC18 column (1 x 50 mm, 3.5-µm particle size) coupled to the LC-MSD-Trap-XCT system. Separation was performed at a flow rate of 75 µl/min by mobile phase consisting of solvent A (water with 0.1% formic acid) and solvent B (35% methanol with 0.1% formic acid) with the following program: linear increase of solvent B concentration to 45% from 0 to 10 min, followed by isocratic mode (45% solvent B) from 10 to 15 min; linear gradient (45–55% solvent B) from 15 to 25 min; isocratic mode (55% solvent B) from 25 to 30 min; linear gradient (55–70% solvent B) from 30 to 40 min; and isocratic mode (70% solvent B) from 40 to 50 min.

The MS operated in electron spray ionization-positive ion mode with a scan mass-to-charge ratio (m/z) from 50 to 400, and nitrogen was used as the nebulizing gas. The MS parameters were as follows: ionization temperature (325°C), nebulizer gas flow (7 l/min), HV capillary 3500 V, smart parameters setting, trap drive (48.2), and with auto MS/MS on.

Data analysis. Data were analyzed with Student's t-test (for 2 groups) or ANOVA and with an appropriate post hoc test (for >2 groups) using Prism 4.00 (GraphPad Software, San Diego, CA) and are presented as means ± SE (n = 3–6).


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 NOTE ADDED IN PROOF
 GRANTS
 REFERENCES
 
CRH (100 nM) stimulated POMC mRNA expression in a time-dependent manner (Fig. 1A). POMC increase (2-fold) became statistically significant at 1–6 h of incubation to reach a maximum 14-fold increase at 24 h. Addition of CRH at concentrations as low as 1 nM stimulated POMC promoter activity 28-fold (Fig. 1A, inset), with accompanied increased production of ACTH (Fig. 1B). Because activation of CRH-R1 is coupled to production of cAMP (Fig. 1B, inset), the stimulated POMC expression and ACTH production were likely connected to cAMP-dependent pathways. The same pathway also underlies the response to CRH in the pituitary during systemic stress (5, 22).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Corticotropin-releasing hormone (CRH) stimulates proopiomelanocortin (POMC) gene expression in the melanocytes. A: CRH stimulates POMC mRNA production (open bars, control; solid bars, 100 nM CRH) and POMC promoter activity (inset shows stimulation of POMC promoter activity by CRH during 24 h of incubation). Ethidium bromide staining shows PCR products obtained after 1 h of treatment. Cells were incubated with or without 100 nM CRH, RNA was extracted, and POMC mRNA levels were measured with real-time RT-PCR. B: CRH stimulates ACTH production. Cells were incubated with serial dilutions of CRH for 24 h. Inset: CRH stimulates cAMP production (cells were incubated with graded concentrations of CRH for 1 h). Differences between control and CRH or ACTH treatment: *P < 0.05 and **P < 0.01.

 
The skin is known to express the genes involved in the synthesis of adrenal corticosteroids as well as their enzymatically active protein products, including P450scc, adrenodoxin, adrenodoxin reductase, and P450c17 (9, 21, 23). Moreover, actual functional activity for these enzymes has been clearly demonstrated in cell extracts and cultured skin cells (10, 11, 23). Consistent with these findings, metabolism of progesterone to deoxycorticosterone and corticosterone has been documented in cultured malignant melanocytes (11, 17), although not in keratinocytes (18). Therefore, following the pathway of adrenal steroidogenesis, we tested normal melanocytes for basal production of cortisol. Addition of progesterone (1 µM) stimulated significantly (5.6-fold) cortisol production; the effect was further enhanced by the presence of IBMX (0.1 mM) (12.5-fold increase) in the media (Fig. 2). Analysis by LC/MS did demonstrate then the presence of a [M+H]+ ion at m/z = 363 with a retention time of 11 min, corresponding to the characteristics of the cortisol standard (Fig. 3). Final confirmation of the product identity as cortisol was obtained with MS/MS analysis, which yielded the same fragment ions at m/z = 345 ([M+H]+-H2O), m/z = 327 ([M+H]+-2H2O), and m/z = 309 ([M+H]+-3H2O) as those of the cortisol standard (Fig. 3).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. Effect of progesterone addition on cortisol synthesis. Cells were incubated with progesterone (10–6 M) and/or IBMX (10–4 M) for 24 h. Differences between control and progesterone or progesterone plus IBMX treatment: *P < 0.05 and **P < 0.01.

 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3. Identification of cortisol by liquid chromatography-mass spectrometry without mass-spectrometry-mass-spectrometry (LC/MS2). LC/MS of cortisol standard (A) shows [M+H]+ ion at mass-to-charge ratio (m/z) = 363 with retention time of 11 min. The same [M+H]+ ion (m/z = 363, real mass 362) (B) with identical retention time (11 min) is present in extracts from melanocyte media. MS/MS analysis of experimental sample (D) yielded the same fragment ions at m/z = 345, m/z = 327, and m/z = 309 (resulting from the loss of 1, 2, and 3 molecules of water, respectively) as those of the cortisol standard (C).

 
Once we verified that melanocytes in vitro do produce cortisol, we tested the effects of CRH and found significant peptide stimulation of cortisol production in a dose-dependent manner (Fig. 4, inset). The CRH effect was specific (abolished by the CRH-R1 antagonist antalarmin) and dependent on POMC expression, e.g., POMC siRNA or POMC antisense oligos completely abolished CRH stimulation (Fig. 4). As would have been expected from these findings, ACTH itself induced production of cortisol in a dose-dependent manner, demonstrating unequivocally that CRH-induced cortisol synthesis acts through an indirect mechanism, requiring mediation by ACTH (Fig. 5). This functional sequence is likely operated by Gs-dependent pathways, since forskolin directly stimulated cortisol synthesis (Fig. 5, inset) and melanocytes are known to express the MC2-R gene (9).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4. CRH stimulates cortisol production. Cells were incubated with 100 nM CRH for 24 h. CRH-induced cortisol production is a secondary event, as it is attenuated by POMC gene silencing with antisense oligonucleotides or with short interfering RNA (siRNA) (cells transfected with gene silencers 24 h before CRH treatment); it is also specific (inhibited by antalarmin, added 1 h before CRH). Inset: effect of increasing concentrations of CRH. Differences between control and CRH treatment: *P < 0.05 and **P < 0.01. Differences between CRH treatment and CRH plus inhibitors: ##P < 0.01.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5. ACTH and forskolin stimulate cortisol production. Cells were incubated with graded concentrations of ACTH for 24 h. Inset: stimulation by forskolin. Differences between control and treatment: *P < 0.05 and **P < 0.01.

 
Because we had found that malignant melanocytes synthesize corticosterone (11, 17), we also tested the effect of CRH and ACTH on production of this steroid. As a first step, we analyzed conditioned media from melanocytes for the presence of corticosterone by ELISA, which showed lower production of corticosterone than cortisol (Fig. 6). Similar to cortisol production, CRH also stimulated corticosterone production in a dose-dependent manner, effects that were abolished by POMC gene silencing (Fig. 6A), indicating again ACTH mediation. Moreover, ACTH stimulated melanocyte corticosterone production in a dose-dependent manner (Fig. 6B), pointing to mediation by a Gs-dependent pathway, similar to cortisol.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6. CRH and ACTH stimulate corticosterone production. A: CRH (100 nM)-induced corticosterone production (24 h of incubation) is attenuated by POMC gene silencing with antisense oligonucleotides or with siRNA (cells transfected with gene silencers 24 h before CRH treatment) and by antalarmin (CRH receptor-1-specific antagonist, added 1 h before CRH). Inset: effect of increasing concentrations of CRH. Differences between control and CRH treatment: *P < 0.05. Differences between CRH treatment and CRH plus inhibitors: #P < 0.01. B: ACTH stimulates corticosterone production. Differences between control and treatment: **P < 0.01.

 
Thus our findings in normal human epidermal melanocytes have uncovered a CRH-based signaling system configured as a functional equivalent of the HPA (possible evolutionary continuum), e.g., CRH through interaction with CRH-R1 activates production of POMC-derived peptides; among those is ACTH, which in turn directly stimulates local corticosteroidogenesis. Hypothalamic CRH is the main coordinator of the central response to stress (1, 3), but CRH is also produced by human epidermal keratinocytes and melanocytes (20), and UVB radiation stimulates CRH production in melanocytes (8). This suggests not only an epidermal stress-response system but also that the system would be structured hierarchically along the same algorithm as in the HPA axis. In contrast with the predominant endocrine mechanism for CRH HPA action in the skin, CRH could potentially function through auto-, para-, or intracrine modes of action. This complex response system would be susceptible to local regulation, since, similar to the pituitary and brain, the skin has preserved cytokines and growth factors as biological modifiers of CRH- and POMC-related peptide function (17, 19, 20). Taken together, our findings strongly suggest evolutionary conservation at the central and peripheral levels of the stress-response signals. Moreover, the common ectodermal origin of the brain and epidermis raises the important question of whether the peripheral CRH-signaling system is an evolutionary duplication of its central homolog or whether it has ancestral origin.

To conclude, the stress-response HPA system has both condensed (peripheral) and expanded (central) versions that follow similar functional sequential activation and differ only in the space allocated to each step.


    NOTE ADDED IN PROOF
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 NOTE ADDED IN PROOF
 GRANTS
 REFERENCES
 
Independently, the team from Dr. Paus’ laboratory has found that CRH stimulates ACTH and cortisol production in human hair follicles maintained in organ culture in vitro (Ito N, Ito T, Kromminga A, Bettermann A, Takigawa M, Kees F, Straub RH, and Paus R. Human hair follicles display a functional equivalent of the hypothalamic-pituitary-adrenal (HPA) axis and synthesize cortisol. FASEB J. In press).


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 NOTE ADDED IN PROOF
 GRANTS
 REFERENCES
 
This work was supported by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant AR-047079 (to A. Slominski) and a training grant from the Johnson and Johnson Skin Research Center (to B. Zbytek).


    ACKNOWLEDGMENTS
 
We thank Dr. A. Pisarchik for construction of the reporter gene plasmid containing human POMC promoter and fragment of exon 1. Real-time RT-PCR was performed on ABI Prism 7770 in the Molecular Resource Center at the University of Tennessee, Memphis, TN. The excellent administrative assistance of Christine Crawford is also acknowledged.


    FOOTNOTES
 

Address for reprint requests and other correspondence: A. Slominski, Dept. of Pathology and Laboratory Medicine, Univ. of Tennessee Health Science Center, 930 Madison Ave. Room 519, Memphis, TN 38103 (E-mail: aslominski{at}utmem.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 NOTE ADDED IN PROOF
 GRANTS
 REFERENCES
 

  1. Aguilera G. Corticotropin releasing hormone, receptor regulation and the stress response. Trends Endocrinol Metab 9: 329–336, 1998.[CrossRef][Medline]
  2. Chen W, Thiboutot D, and Zouboulis CC. Cutaneous androgen metabolism: basic research and clinical perspectives. J Invest Dermatol 119: 992–1007, 2002.[CrossRef][Web of Science][Medline]
  3. Chrousos GP. The hypothalamic-pituitary-adrenal axis and immune-mediated inflammation. N Engl J Med 332: 1351–1362, 1995.[Free Full Text]
  4. Frankel B, Longo SL, Rodziewicz GS, and Hodge CJ Jr. Antisense oligonucleotide-induced inhibition of adrenocorticotropic hormone release from cultured human corticotrophs. J Neurosurg 91: 261–267, 1999.[Web of Science][Medline]
  5. Grammatopoulos DK and Chrousos GP. Functional characteristics of CRH receptors and potential clinical applications of CRH-receptor antagonists. Trends Endocrinol Metab 13: 436–444, 2002.[CrossRef][Web of Science][Medline]
  6. Luger T, Paus R, Slominski A, and Lipton J. Cutaneous neuromodulation: the proopiomelanocortin system. Ann NY Acad Sci 885: 1–479, 1999.[Web of Science][Medline]
  7. Pisarchik A and Slominski A. Molecular and functional characterization of novel CRFR1 isoforms from the skin. Eur J Biochem 271: 2821–2830, 2004.[Web of Science][Medline]
  8. Slominski A, Baker J, Ermak G, Chakraborty A, and Pawelek J. UVB stimulates production of corticotropin releasing factor (CRF) by human melanocytes. FEBS Lett 399: 175–176, 1996.[CrossRef][Web of Science][Medline]
  9. Slominski A, Ermak G, and Mihm M. ACTH receptor, CYP11A1, CYP17 and CYP21A2 genes are expressed in skin. J Clin Endocrinol Metab 81: 2746–2749, 1996.[Abstract]
  10. Slominski A, Gomez-Sanchez C, Foecking MF, and Wortsman J. Active steroidogenesis in the normal rat skin. Biochim Biophys Acta 1474: 1–4, 2000.[Medline]
  11. Slominski A, Gomez-Sanchez CE, Foecking MF, and Wortsman J. Metabolism of progesterone to DOC, corticosterone and 18OHDOC in cultured human melanoma cells. FEBS Lett 455: 364–366, 1999.[CrossRef][Web of Science][Medline]
  12. Slominski A and Mihm M. Potential mechanism of skin response to stress. Int J Dermatol 35: 849–851, 1996.[Web of Science][Medline]
  13. Slominski A and Pawelek J. Animals under the sun: effects of UV radiation on mammalian skin. Clin Dermatol 16: 503–515, 1998.[CrossRef][Web of Science][Medline]
  14. Slominski A, Pisarchik A, Tobin DJ, Mazurkiewicz JE, and Wortsman J. Differential expression of a cutaneous corticotropin-releasing hormone system. Endocrinology 145: 941–950, 2004.[Abstract/Free Full Text]
  15. Slominski A, Szczesniewski A, and Wortsman J. Liquid chromatography-mass spectrometry detection of corticotropin-releasing hormone and proopiomelanocortin-derived peptides in human skin. J Clin Endocrinol Metab 85: 3582–3588, 2000.[Abstract/Free Full Text]
  16. Slominski A, Tobin DJ, Shibahara S, and Wortsman J. Melanin pigmentation in mammalian skin and its hormonal regulation. Physiol Rev 84: 1155–1228, 2004.[Abstract/Free Full Text]
  17. Slominski A and Wortsman J. Neuroendocrinology of the skin. Endocr Rev 21: 457–487, 2000.[Abstract/Free Full Text]
  18. Slominski A, Worstman J, Foecking MF, Shackleton CH, Gomez-Sanchez CE, and Szczesniewski A. Gas chromatography/mass spectrometry characterization of corticosteroid metabolism in human immortalized keratinocytes. J Invest Dermatol 118: 310–315, 2002.[CrossRef][Web of Science][Medline]
  19. Slominski A, Wortsman J, Luger T, Paus R, and Solomon S. Corticotropin releasing hormone and proopiomelanocortin involvement in the cutaneous response to stress. Physiol Rev 80: 979–1020, 2000.[Abstract/Free Full Text]
  20. Slominski A, Wortsman J, Pisarchik A, Zbytek B, Linton EA, Mazurkiewicz JE, and Wei ET. Cutaneous expression of corticotropin-releasing hormone (CRH), urocortin, and CRH receptors. FASEB J 15: 1678–1693, 2001.[Abstract/Free Full Text]
  21. Slominski A, Zjawiony J, Wortsman J, Semak I, Stewart J, Pisarchik A, Sweatman T, Marcos J, Dunbar C, and Tuckey RT. A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin. Eur J Biochem 271: 4178–4188, 2004.[Web of Science][Medline]
  22. Smith AI and Funder JW. Proopiomelanocortin processing in the pituitary, central nervous system, and peripheral tissues. Endocr Rev 9: 159–179, 1988.[Abstract/Free Full Text]
  23. Thiboutot D, Jabara S, McAllister JM, Sivarajah A, Gilliland K, Cong Z, and Clawson G. Human skin is a steroidogenic tissue: steroidogenic enzymes and cofactors are expressed in epidermis, normal sebocytes, and an immortalized sebocyte cell line (SEB-1). J Invest Dermatol 120: 905–914, 2003.[CrossRef][Web of Science][Medline]
  24. Zouboulis CC, Seltmann H, Hiroi N, Chen W, Young M, Oeff M, Scherbaum WA, Orfanos CE, McCann SM, and Bornstein SR. Corticotropin-releasing hormone: an autocrine hormone that promotes lipogenesis in human sebocytes. Proc Natl Acad Sci USA 99: 7148–7153, 2002.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
Y. Sainte Marie, A. Toulon, R. Paus, E. Maubec, A. Cherfa, M. Grossin, V. Descamps, M. Clemessy, J.-M. Gasc, M. Peuchmaur, et al.
Targeted Skin Overexpression of the Mineralocorticoid Receptor in Mice Causes Epidermal Atrophy, Premature Skin Barrier Formation, Eye Abnormalities, and Alopecia
Am. J. Pathol., September 1, 2007; 171(3): 846 - 860.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. A Zmijewski, R. K Sharma, and A. T Slominski
Expression of molecular equivalent of hypothalamic-pituitary-adrenal axis in adult retinal pigment epithelium
J. Endocrinol., April 1, 2007; 193(1): 157 - 169.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
288/4/E701    most recent
00519.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (29)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Slominski, A.
Right arrow Articles by Wortsman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Slominski, A.
Right arrow Articles by Wortsman, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.