AJP - Endo AJP: Heart and Circulatory Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 287: E1082-E1089, 2004. First published August 3, 2004; doi:10.1152/ajpendo.00179.2004
0193-1849/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/6/E1082    most recent
00179.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, E. B.
Right arrow Articles by Winder, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, E. B.
Right arrow Articles by Winder, W. W.

Endurance training increases LKB1 and MO25 protein but not AMP-activated protein kinase kinase activity in skeletal muscle

E. B. Taylor, D. Hurst, L. J. Greenwood, J. D. Lamb, T. D. Cline, S. N. Sudweeks, and W. W. Winder

Department of Physiology and Developmental Biology, Brigham Young University, Provo, Utah 84602

Submitted 26 April 2004 ; accepted in final form 23 July 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
LKB1 complexed with MO25 and STRAD has been identified as an AMP-activated protein kinase kinase (AMPKK). We measured relative LKB1 protein abundance and AMPKK activity in liver (LV), heart (HT), soleus (SO), red quadriceps (RQ), and white quadriceps (WQ) from sedentary and endurance-trained rats. We examined trained RQ for altered levels of MO25 protein and LKB1, STRAD, and MO25 mRNA. LKB1 protein levels normalized to HT (1 ± 0.03) were LV (0.50 ± 0.03), SO (0.28 ± 0.02), RQ (0.32 ± 0.01), and WQ (0.12 ± 0.03). AMPKK activities in nanomoles per gram per minute were HT (79 ± 6), LV (220 ± 9), SO (22 ± 2), RQ (29 ± 2), and WQ (42 ± 4). Training increased LKB1 protein in SO, RQ, and WQ (P < 0.05). LKB1 protein levels after training (%controls) were SO (158 ± 17), RQ (316 ± 17), WQ (191 ± 27), HT (106 ± 2), and LV (104 ± 7). MO25 protein after training (%controls) was 595 ± 71. Training did not affect AMPKK activity. MO25 but not LKB1 or STRAD mRNA increased with training (P < 0.05). Trained values (%controls) were MO25 (164 ± 22), LKB1 (120 ± 16), and STRAD (112 ± 17). LKB1 protein content strongly correlated (r = 0.93) with citrate synthase activity in skeletal muscle (P < 0.05). In conclusion, endurance training markedly increased skeletal muscle LKB1 and MO25 protein without increasing AMPKK activity. LKB1 may be playing multiple roles in skeletal muscle adaptation to endurance training.

adenosine 5'-monophosphate-activated protein kinase; diabetes; serine-threonine kinase-11; Ste20-related adaptor protein


LKB1 (SERINE-THREONINE KINASE-11; STK11) in complex with the regulatory proteins MO25 and Ste20-related adaptor protein (STRAD) has recently been identified as a major upstream kinase for the AMP-activated protein kinase (AMPK) (16, 42, 49). LKB1 requires association with STRAD for catalytic activity that is enhanced by binding to MO25 (1, 16). MO25 stabilizes the interaction between LKB1 and STRAD and is thought to act as a scaffolding protein (5, 30). AMPK is a master metabolic regulator responsible for modulating cellular responses to an energy challenge (15, 38, 47). These responses include increased glucose uptake (3, 18, 22, 29), increased fatty acid oxidation (29, 46), decreased protein synthesis (4, 9, 20), and induction of mitochondrial biogenesis (2, 48). AMPK has been the subject of intense investigation because of its potential as a therapeutic target for antidiabetic drugs (25, 32, 37). Full activation of AMPK requires phosphorylation of its activation loop at Thr172 by an AMPK kinase (AMPKK) (17, 44). Thus the LKB1-STRAD-MO25 AMPKK complex may be a key regulator of the downstream effects of AMPK, including the regulation of exercise-induced glucose uptake.

LKB1 is a tumor suppressor protein regulating cell proliferation and polarity (7). Inactivating mutations in LKB1 were discovered as the causative agent for Peutz-Jeghers syndrome (PJS) in 1998 (19). PJS is an autosomal dominant disorder characterized by the development of hamartomatous polyps in the gastrointestinal tract and the pigmentation of mucous membranes. PJS is also associated with a considerable increase in risk for the development of cancer of the intestine, stomach, pancreas, breast, cervix, lung, ovary, testis, and uterus (7). Whereas LKB1 is predominantly a nuclear protein, association with STRAD, which is essential for AMPKK activity and LKB1-mediated G1 cell cycle arrest, anchors it in the cytoplasm (1, 16, 45).

STRAD is a pseudokinase that lacks several amino acid residues essential for kinase activity. LKB1 binding with STRAD results in the activation of LKB1, the phosphorylation of both LKB1 and STRAD, and the translocation of the LKB1-STRAD complex from the nucleus to the cytoplasm (1). The recently resolved crystal structure of the MO25-STRAD complex reveals that MO25 binds directly to the COOH terminus of STRAD (30). The authors of that study propose that MO25 is a potential scaffold protein for other regions of STRAD-LKB1, LKB1 substrates, and LKB1 regulatory components.

The effects of exercise on AMPK signaling in skeletal muscle have been studied extensively (15). Endurance training reduces the activation of AMPK in response to exercise in both rats and humans (12, 33, 50). Endurance training has also been shown to alter the expression of AMPK subunits in both rats and humans (12, 13, 33). The most recent of these studies found an increase in basal AMPK activity with training (13). The attenuated AMPK activation and increased basal AMPK activity with endurance training may be a result of altered AMPKK signaling. However, in contrast to AMPK, neither the role nor regulation of AMPKK in skeletal muscle is well understood.

The LKB1 protein content and AMPKK activity in different types of skeletal muscle and their regulation by endurance training are not well characterized. Investigating the role and regulation of AMPKK by endurance training may yield new insight into the regulation of glucose transport and fatty acid oxidation by exercise. Such information may be important for developing new treatments and prevention strategies for type 2 diabetes and the metabolic syndrome (37). Additionally, because LKB1 is a tumor suppressor and regulator of cell growth, it may serve as an etiological intersection between type 2 diabetes and some cancers (23, 28, 31, 34). Here, we present the results of our investigation on the effects of endurance training on AMPKK activity and LKB1 protein content in skeletal muscle, heart, and liver.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal care and training protocol. All procedures were approved by the Institutional Animal Care and Use Committee of Brigham Young University. Male Sprague-Dawley (SAS:VAF) rats (Sasco, Wilmington, MA) were housed in a temperature-controlled (21–22°C) room with a 12:12-h light-dark cycle. Rats were assigned to either a training or control group. Training rats were fed standard rat chow (Harlan Teklad rodent diet; Madison, WI) and water ad libitum. Control rats were food restricted to maintain body weight similar to that of training rats. Body weights at the end of the study were 356 ± 5 g for trained rats and 353 ± 4 g for control rats. Rats were trained on a motor-driven rodent treadmill 5 days/wk for 10–11 wk up a 15% grade in a room maintained at 16–17°C. Initially, rats completed two 45-min exercise bouts per day at 16 m/min. Training progressed to a single 120-min exercise bout at 32 m/min with 30-s sprints at 53 m/min every 10 min for the final 4–5 wk. Rats were anesthetized 18–24 h after the last training bout by intraperitoneal injection of pentobarbital sodium (48 mg/kg body wt). Food consumption was 23 ± 1 g for control rats and 21 ± 1 g for trained rats the night before collection of tissues. These values are not statistically different from each other (P < 0.05).

Buffers. Dithiothreitol (DTT), AMP, ATP, [{gamma}-32P]ATP , phenylmethylsulfonyl fluoride (PMSF), 4-(2-aminoethyl)-benzenesulfonyl fluoride (AEBSF), benzamidine, soybean trypsin inhibitor, and AMARA peptide (Zinsser, UK) were added just before use when included. "Tissue homogenization buffer" contained 50 mM Tris·HCl, 250 mM mannitol, 50 mM NaF, 5 mM sodium pyrophosphate, 1 mM EDTA, 1 mM EGTA, 0.5% Triton X-100, 1 mM benzamidine, 1 µg/ml soybean trypsin inhibitor, 1 mM DTT, and 0.2 mM AEBSF, pH 7.4, at 4°C. "AMPK{alpha}1312 storage buffer" contained 50 mM Tris·HCl, 250 mM mannitol, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.02% (wt/vol) Brij-35, and 10% (vol/vol) glycerol, pH 7.4, at 4°C. For composition of Laemmli's buffer, see Ref. 24. "AMPKK assay buffer" contained 100 mM HEPES, 200 mM NaCl, 20% glycerol, 2 mM EDTA, 12.5 mM MgCl2, 0.5 mM AMP, 0.5 mM ATP, and 2.0 mM DTT, pH 7.0. "Phosphorylation buffer" contained 40 mM HEPES, 80 mM NaCl, 8% glycerol, 0.8 mM EDTA, 0.8 mM DTT, 5 mM MgCl2, 0.2 mM AMP, 0.2 mM ATP, 0.33 mM AMARA peptide, and 0.133 µCi/µl [{gamma}-32P]ATP , pH 7.0. Phosphate-buffered saline (PBS) contained 140 mM NaCl, 2.7 mM KCl, 2.1 mM KH2PO4, and 9.9 mM Na2HPO4, pH 7.3. PBST contained PBS with 1% Tween-20 (Calbiochem, San Diego, CA).

Tissue processing. Soleus muscle (SO), deep lateral red quadriceps (RQ), superficial white quadriceps (WQ), liver (LV), and the ventricular portion of the heart (HT) were excised and immediately clamp frozen in liquid nitrogen. Tissue was ground with ceramic pestles and mortars under liquid nitrogen and thoroughly homogenized with a glass homogenizer. One part tissue was homogenized in nine parts (wt/vol) tissue homogenization buffer. Tissue homogenates for immunoblotting and AMPKK activity assays were centrifuged at 700 g for 10 min to remove connective tissue and then frozen at –95°C before assays and blots.

Polyethylene glycol precipitations. AMPKK activity was enriched in RQ homogenates by polyethylene glycol (PEG) precipitation (17). Homogenates were centrifuged at 5,000 g for 10 min. PEG precipitations were then performed by adding 0.32 ml of 25% PEG 6000 (Calbiochem)/ml muscle homogenates to yield a PEG concentration of 6% (wt/vol). After a 15-min incubation on ice, homogenates were centrifuged at 30,000 g for 15 min. PEG was added to the 6% PEG supernatant to bring PEG concentration to 10% (wt/vol). Homogenates with 10% PEG were incubated on ice for 30 min and then centrifuged at 30,000 g for 15 min. Pellets were resuspended in one-tenth of the original homogenate volume and frozen at –95°C before assays and blots.

Preparation of {alpha}1312. AMPK{alpha}1 mRNA was isolated from homogenized rat gastrocnemius muscle, using the Qiagen RNeasy kit (Valencia, CA). cDNA coding for the first 312 amino acids of the {alpha}1-subunit was obtained (35 cycles of 94°C for 20 s, 54°C for 30 s, and 72°C for 1 min) with the SuperScript One Step RT-PCR System (GIBCO/Invitrogen, Carlsbad, CA). cDNA was further amplified (35 cycles of 94°C for 15 s, 55°C for 30 s, and 69°C for 1 min) with Platinum pfx high-fidelity DNA polymerase (GIBCO/Invitrogen). Cut sites for the restriction enzymes NcoI and XhoI were included in the primers, which were the following: forward primer 5'-AGCTGCCATGGCCGAGAAGCAGAAGCA-3' and reverse primer 5'-AGCTGCTCGAGTTAGTACAGGCAGCTGAGGAC-3'. AMPK{alpha}1312 cDNA was cloned into the pET-30a vector with a 6x-His-Tag using the restriction sites NcoI (NH2 terminal) and XhoI (COOH terminal). The insert was ligated to the vector after treatment with calf intestinal alkaline phosphatase (Promega, Madison, WI) by use of the Roche Rapid DNA Ligation Kit (Nutley, NJ). The ligated vector and insert were first introduced into nonexpression host NovaBlue cells and then into expression host BL21(DE3) cells using heat shock (Novagen, Madison, WI). Single transformed colonies were used to create glycerol (80%) stocks. Standard Luria-Bertani (LB) broth with kanamycin (30 µg/ml) was inoculated with transformed bacteria from glycerol stocks. Bacteria were cultured at 30°C, and isopropyl-{beta}-thiogalactopyranoside (IPTG; 1 mM) was added to induce production of {alpha}1312 when optical density (OD)600 reached 0.6. Cells were incubated an additional 2.5 h after induction with IPTG. After incubation, cells were placed on ice for 5 min and then centrifuged for 5 min at 5,000 g at 4°C. Pellets were resuspended in 5 ml of 1x BugBuster/g cells (Novagen), 1 mM PMSF, 0.2g/ml lysozyme, and 0.1 µl/ml benzonase. After resuspension, cells were incubated at room temperature for 20 min with slow shaking. Resuspended cells were centrifuged at 16,000 g for 20 min at 4°C. Supernatant was applied to, and AMPK{alpha}1312 eluted from, a manual His-Bind column according to the manufacturers instructions (Novagen). Eluates were concentrated with Centricon Plus-20 Centrifugal Filter Devices (Millipore, Billerica, MA), diluted in AMPK{alpha}1312 storage buffer, concentrated again, and then frozen at –95°C.

AMPKK activity assay. The AMPKK activity of tissue homogenates was assayed by the activation of a standardized preparation of bacterially expressed AMPK{alpha}1312 (14). Activation of {alpha}1312 was measured by 32P incorporation from [{gamma}-32P]ATP into AMARA peptide (16). For AMPKK assays, tissue homogenates were diluted (vol/vol) in tissue homogenization buffer as follows: SO 1:1, RQ 1:1, WQ 1:1, HT 1:3, and LV 1:5. Diluted tissue homogenates (2 µl) were incubated with AMPKK assay buffer (4 µl) and AMPK{alpha}1312 in storage buffer (4 µl) for 12 min. Phosphorylation buffer (15 µl) was added, and the reaction was stopped by spotting 1-cm2 pieces of P81 filter paper (Whatman, Tewksbury, MA) with the final reaction mixture (15 µl) after 12 min. Filter papers were washed 6 x 5 min in 100 ml of 1% phosphoric acid, rinsed with acetone, dried, and counted for 10 min in 3 ml of Ecolite scintillation fluid (ICN, Irvine, CA).

Western blots. Homogenates were diluted in 4x Laemmli's buffer and water (1:1:2) and then separated by SDS-PAGE at 200 V for 35 min in 7.5% Tris·HCl, 50 µl/well Ready Gels (Bio-Rad, Hercules, CA.) Proteins were transferred from the gels to nitrocellulose membranes at 100 V for 50 min. Membranes were blocked in PBST and 5% blotting-grade blocker nonfat dry milk (Bio-Rad) for 1 h. Membranes were incubated overnight at 4°C in PBST, 5% blocking milk, and anti-LKB1 antibody (1:2,500). Antibodies for LKB1 and heat shock protein 90 (HSP90) were obtained from Cell Signaling Technology (Beverly, MA). Antibody for MO25 from rabbit was made against the peptide MPFPFGKSHKSPAD(C) and obtained from Affinity BioReagents (Golden, CO). Human MO25 was cloned into a pET14 vector for expression with a his-tag by MCLAB (San Francisco, CA). This recombinant MO25 was used as a standard and for competition studies in Western blotting for MO25. After incubation with the first antibody, membranes were washed twice with PBST for 10 min and twice with PBS for 5 min. Membranes were then incubated for 1 h at room temperature in PBST, 3% blocking milk, and anti-rabbit immunoglobin horseradish peroxidase-linked whole antibody from donkey (1:1,500; Amersham Pharmacia, Piscataway, NJ). After incubation with the second antibody, membranes were washed twice with PBST for 10 min and twice with PBS for 5 min. Membranes were covered with enhanced chemiluminescence (ECL) Western blotting detection reagent (Amersham Pharmacia), enclosed in plastic wrap, and visualized on Hyperfilm ECL high-performance chemiluminescence film (Amersham Pharmacia). Relative amounts of LKB1 were quantified by measuring spot size and intensity with AlphaEaseFC software (Alpha Innotech, San Leandro, CA).

Citrate synthase assay. Aliquots from raw tissue homogenates of SO, RQ, and WQ were slow frozen at –20°C overnight and subjected to two additional freeze-thaw cycles. Citrate synthase was assayed according to the method of Srere (43).

Real-time PCR. Relative changes in mRNA with training were examined by real-time PCR. Total mRNA was isolated from 30 mg of tissue from trained and control RQ muscle with the RNeasy fibrous tissue kit (Qiagen) according to the manufacturer's instructions. Samples were homogenized with an Ultra-Turrax T8 (IKA, Wilmington, NC). cDNA libraries for each sample were generated using the SuperScript III first-strand synthesis kit (Invitrogen) according to the manufacturer's instructions. Real-time PCR using gene-specific primers for LKB1, MO25, and STRAD mRNA and 18S rRNA was performed, using the Platinum SYBR Green qPCR Supermix UDG kit (Invitrogen) with an ABI-7000 real-time PCR System. Primers (Invitrogen) were the following: LKB1 forward, AGAGGAAGTGGGTCAGAATGGA; LKB1 reverse, CCGGCCTTCTGGCTTCA; MO25 forward, GGTTGCCATGAAAGAAATTCTGT; MO25 reverse, AGCTGTGCTACGGCCTCTGT; STRAD forward, TCCGAGGCTTTACCTGAGTTG; STRAD reverse, AGACTGGCTGCCCTCGAA; 18S forward, GTGCATGGCCGTTCTTAGTTG; and 18S reverse, GCCACTTGTCCCTCTAAGAAGTTG. Samples were amplified in triplicate. Amplification protocol was 50°C for 2 min and 95°C for 10 min and then 60 cycles of 95°C for 15 s, 60°C for 20 s, and 72°C for 30 s. For postamplification dissociation to generate melting curves, temperature was raised from 60°C to 95°C. Cycle threshold (CT) was calculated by fitting the fluorescence curves ({Delta}RN) to a sigmoidal function and then obtaining the second derivative of the function using Graph Pad Prism software. Relative fold expression was calculated using the 2–{Delta}{Delta}CT method after normalizing to 18S RNA (26).

Statistics. Two-sample Student's t-tests were used to assess the training effect on relative LKB1 protein content and AMPKK activity for a given tissue. Comparisons of LKB1 protein content and AMPKK activity across tissues were done by one-way analysis of variance (ANOVA). When main effects reached significance, the Fisher least significant difference (LSD) multiple comparison test was used to determine the location. For all tests, statistical significance was set at P < 0.05. All statistical procedures were performed with the NCSS statistical program (Kaysville, Utah). All data are reported as means ± SE.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We observed a differential distribution of AMPKK activity and LKB1 protein content across the tissues studied. Table 1 shows the AMPKK activities in homogenates from trained and control LV, HT, WQ, RQ, and SO. Training had no effect on AMPKK activity. Activity was the greatest in LV followed by HT, WQ, RQ, and SO. LV and HT were significantly different from each other and WQ, RQ, and SO. SO and WQ were different from each other but not RQ (ANOVA, Fisher LSD, P < 0.05).


View this table:
[in this window]
[in a new window]
 
Table 1. AMPKK activities from trained and control rat homogenates of SO, RQ, WQ, HT, and LV

 
LKB1 protein content was greatest in HT followed by LV, RQ, SO, and WQ (Fig. 1). With the exception of RQ and SO, all groups were significantly different from one another (ANOVA, Fisher LSD, P < 0.05). Figure 2 shows citrate synthase activity for SO, RQ, and WQ from trained and untrained rats (n = 8). Citrate synthase activity increased significantly with training in all types of skeletal muscle (P < 0.05).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. Relative LKB1 protein abundance in soleus (SO), red quadriceps (RQ), white quadriceps (WQ), heart (HT), and liver (LV) from control rats determined by Western blotting. Values are means ± SE; n = 7–8. *HT, LV, and WQ were significantly different from each other, SO, and RQ. SO and RQ were not significantly different from each other (P < 0.05).

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Citrate synthase activities from trained and control SO, RQ, and WQ. Values are means ± SE; n = 8. *Citrate synthase activities from trained SO, RQ, and WQ were significantly greater compared with controls (P < 0.05).

 
In contrast to AMPKK activity, LKB1 protein content increased significantly (P < 0.05) in trained SO, RQ, and WQ but not HT or LV. Figure 3 shows relative LKB1 protein levels in tissues from trained rats as percentage of LKB1 protein levels in controls. LKB1 protein in trained RQ was 316% of LKB1 protein in control RQ. Trained WQ and SO were 191% and 159% of control values, respectively. To ensure that diet restriction did not affect AMPKK activity and LKB1 protein content, we compared AMPKK activity and LKB1 protein content in tissues from control rats with tissues from rats fed ad libitum. No differences were observed (data not shown). Because nuclear LKB1 might have been removed with the centrifugation at 700 g to remove connective tissue, we compared raw, uncentrifuged muscle homogenates from trained and control RQ for LKB1 protein levels. LKB1 protein content was markedly greater in raw homogenates from trained RQ compared with control RQ (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3. Relative LKB1 protein abundance in trained rats as percentage of controls determined by Western blotting. Values are means ± SE; n = 7–8. *Significant increases in LKB1 occurred in SO, RQ, and WQ but not HT or LV (P < 0.05).

 
Although LKB1 protein content did not correlate (r = 0.27) with AMPKK activity, LKB1 protein levels strongly correlated with citrate synthase activity in trained and control tissues at r = 0.93 (P < 0.05). Figure 4 shows a scatter plot and regression line for LKB1 protein content and citrate synthase activity.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4. Correlation (r = 0.93, P < 0.05) between relative LKB1 protein content and citrate synthase activity in trained (Tr) and control (Con) SO, RQ, and WQ (n = 8). Red, red quadriceps; Sol, soleus; Wht, white quadriceps.

 
In addition to LKB1 protein, MO25 protein increased substantially with training. MO25 protein in trained RQ was 595% of MO25 in control RQ (Fig. 5). For unknown reasons, Western blots for MO25 indicate that it has a molecular mass of ~55 kDa in rat skeletal muscle. MO25 in rat LV was found at ~39 kDa. MO25 antibody strongly detected recombinant MO25 protein when used as a standard during Western blotting. Both the antigen peptide and recombinant MO25 protein effectively blocked binding of MO25 antibody in Western blot competition studies. We were unable to obtain antibody for STRAD. Western blots comparing levels of HSP90 from trained and control RQ indicated a trend for an increase in HSP90 with training (P = 0.09). Normalized HSP90 values in control and trained RQ were 100 ± 23% and 188 ± 56%, respectively.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Relative MO25 protein abundance in trained and control RQ determined by Western blotting. Values are means ± SE; n = 7–8. *Significant increase in MO25 protein occurred in RQ with training (P < 0.05).

 
Relative levels of LKB1 (Fig. 6A), STRAD (Fig. 6B), and MO25 (Fig. 6C) mRNA were measured for increases with training in RQ, the tissue showing the greatest increase in LKB1 protein. Relative levels of LKB1, STRAD, and MO25 mRNA were not compared. In contrast to LKB1 protein, LKB1 mRNA did not increase with training. STRAD mRNA also did not increase. Conversely, MO25 mRNA did increase with training and was 164% of MO25 mRNA in control RQ (P < 0.05).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6. Relative amounts of LKB1 (A), Ste20 related adaptor protein (B; STRAD), and MO25 (C) mRNA in trained and control RQ. Values are means ± SE; n = 8. Control values are set to 100% with trained values expressed as percentage of controls. No significant difference was found between trained and control RQ for either LKB1 mRNA or STRAD mRNA. *MO25 mRNA was significantly higher in trained RQ compared with controls (P < 0.05).

 
AMPKK activities in homogenates and resuspended PEG precipitates from trained and control RQ were compared (Fig. 7). No training effect was found. Resuspended PEG precipitates had significantly more AMPKK activity than homogenates per milligram of protein (Fisher LSD, P < 0.05). Overall, AMPKK activity in PEG precipitates was 5.8-fold the AMPKK activity in homogenates.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7. AMP-activated protein kinase kinase (AMPKK) activity in homogenates and resuspended polyethylene glycol (PEG) precipitates from trained and control RQ measured in pmol of phosphorylated AMARA peptide per min per mg of protein. Values are means ± SE; n = 8. *Activities from PEG precipitates were significantly higher than activities from homogenates, indicating that the PEG precipitation resulted in an enrichment of AMPKK activity (P < 0.05). No differences were found between trained and untrained samples.

 
Figure 8 shows that resuspended PEG precipitates from trained and control RQ did not differ in LKB1 protein content (n = 8). Note that although LKB1 protein levels were not different, the thin top LKB1 band present in trained RQ and HT persisted through the PEG precipitation.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 8. Relative LKB1 protein abundance in resuspended PEG precipitates from trained and control RQ determined by Western blotting. Values are means ± SE; n = 8. No significant difference was found between resuspended PEG precipitates from trained and control RQ for LKB1 protein levels (P < 0.05).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
To our knowledge, this is the first study investigating the effects of endurance training on LKB1 and MO25 protein abundance, the distribution of LKB1 between different types of skeletal muscle, and the AMPKK activities found in different types of skeletal muscle. A previous study examined AMPKK activity in human skeletal muscle and reported that AMPKK activity increased with increasing exercise intensity and duration (10). The increase in AMPKK activity paralleled the increase in AMPK{alpha}1 activity but was much less than the increase in AMPK{alpha}2 activity. A recent study found that LKB1 in skeletal muscle was not activated by electrical stimulation-induced in situ contraction, 5-aminoimidizole-4-carboxamide 1-{beta}-D-riboside (AICAR), or phenformin (39).

In the present study, we found that endurance training did not affect AMPKK activity, but AMPKK activity is different across tissues (Table 1). LV, HT, and skeletal muscle had distinct activity levels, indicating that AMPK signaling may be regulated differently in these tissues. There was a tendency for AMPKK activity in different types of skeletal muscle to positively correlate with the contractile speed of the dominant fiber type. WQ, which is composed mostly of type IIb fibers, had the greatest AMPKK activity, whereas SO, which is composed mostly of type I fibers, had the lowest AMPKK activity. Although RQ AMPKK activity was not significantly different from WQ or SO AMPKK activity, it was intermediate between them. This relationship held both before and after training. A previous study demonstrated that treatment of rats with AICAR resulted in an increase in phospho-AMPK{alpha} that was positively related to the contractile speed of the fibers composing them. Phospho-AMPK{alpha} increased the most in epitrochlearis (65% IIb, 20% IIa, and 15% I), followed by extensor digitorum longus (59% IIa, 38% IIb, and 3% type I) and then SO (84% type I and 16% IIa) (21). Previous work in our lab showed a greater AICAR-induced AMPK activation in WQ compared with SO muscle (48). In HeLa and mouse embryo fibroblast cells, LKB1 is necessary for the AICAR-induced activation of AMPK (16). Thus the greater phospho-AMPK{alpha} response in faster muscle to AICAR may be related to the greater basal activity of AMPKK we observed in WQ compared with SO. Because basal AMPKK activity did not change with training, this may indicate that muscles composed of faster fibers are more sensitive to an energy challenge independent of their oxidative capacity.

Endurance training had a pronounced effect on LKB1 protein levels in the three types of skeletal muscle studied. A marked change occurred in RQ muscle, where LKB1 protein content was more than three times as high compared with controls. Interestingly, relative LKB1 protein content was strongly and positively correlated with citrate synthase activities in skeletal muscle before and after training. The blots for LBK1 (Fig. 3) in HT, which is extremely rich in mitochondria, show a thinner LKB1 band immediately above the dominant LKB1 band. Training induced the appearance of a thin higher band in RQ (Fig. 3). This top band is present in untrained RQ but requires very long exposure times to visualize.

The distinguishing characteristic between the top and bottom bands is presently unknown but may be associated with the high oxidative capacity of trained RQ and HT. LKB1 is subject to many posttranslational modifications that could induce a band shift, including phosphorylation and farnesylation (11, 40, 41). LV, which had the highest AMPKK activity, had LKB1 levels intermediate between HT and skeletal muscle, but no doublet could be detected. Higher and lower LKB1 bands have previously been observed in crude AMPKK purifications from rat LV, but the separating characteristics for these two bands have not been reported (16). In our study, the bottom LKB1 band also increased with training and was the greatest in HT. Thus total LKB1 protein content in muscle is strongly associated with mitochondrial content rather than AMPKK activity.

We also compared trained and control RQ for relative abundance of MO25 and found an even greater increase in MO25 than in LKB1 with training. MO25 levels in trained RQ were nearly 600% of control values (Fig. 5). Although basal AMPKK activity did not change with training, the increases in LKB1 and MO25 may still be modulating AMPK signaling but not under resting conditions. The previously described activation of AMPKK with exercise did not occur early during the exercise bout at a low intensity but later, at a higher intensity (10).

We measured LKB1 mRNA in RQ to see whether the increase in LKB1 protein was related to an increase in LKB1 mRNA abundance. We found no difference in LKB1 mRNA between trained and control RQ. However, rats were killed 18–24 h after their last exercise bout. Training could have induced transient postexercise increases in LKB1 mRNA sufficient to increase LKB1 protein levels. Thus endurance training does not induce a stable increase in LKB1 mRNA.

Alternatively, endurance training may be increasing the stability of LKB1 protein. A previous study found that the chaperone protein HSP90, along with the cell division cycle (Cdc)37 kinase-specific targeting subunit for HSP90, stabilizes LKB1 by preventing its degradation by the proteasome (6). Later it was shown that treating cells with the HSP90-inhibiting antibiotics geldanamycin and novobiocin destabilized LKB1. Geldanamycin treatment resulted in the ubiquitination of LKB1 and its rapid degradation (35). One possible mechanism for the higher LKB1 in trained rat muscle could be an increase in HSP90 protein. Western blots showed that the mean value for HSP90 in trained RQ was almost double the control value, but the difference fell slightly short of statistical significance (P = 0.09) because of high variation. In principle, the studies on the stabilization of LKB1 by HSP90 (6, 35) demonstrate that LKB1 protein abundance can be regulated by protein-to-protein interactions. An increase in LKB1 protein is therefore not dependent on an increase in LKB1 mRNA. Training may induce an increase in HSP90 or another protein(s) that contributes to the increase in LKB1 with training.

We also measured RQ STRAD (LYK5) and MO25 mRNA. Like LKB1, we found no stable increase in STRAD mRNA. However, consistent with the increase in MO25 protein, we did find a 64% increase in MO25 mRNA, indicating that endurance training induces a stable increase in MO25 mRNA. The increase in MO25 mRNA may be part of the mechanism responsible for increasing MO25 protein. If MO25 and LKB1 are increasing, but STRAD is not, AMPKK activity might remain the same because LKB1 absolutely requires association with STRAD for AMPKK activity (16).

Resuspended PEG precipitates from trained and control RQ did not have different AMPKK activity levels and, in contrast to muscle homogenates, did not have different levels of LKB1 protein. This indicates that the PEG precipitation process, which enriched AMPKK activity 5.8-fold, had a differential effect on LKB1 between trained and control tissues. For this to occur, the state of the LKB1 in the trained and control tissues must somehow be different. Perhaps the strong doublet on the blots from the trained tissue reflects this difference. LKB1 could also be complexed to different binding partners in trained tissue compared with controls, thereby affecting its precipitation properties. LKB1 has been found to bind to many proteins, including Brg-1, SMARCC1, STRAD, polyploidy-associated protein kinase (PAPK), FK506-binding protein (FKBP)51, particularly interesting new cysteine-histidine rich protein (PINCH), ubiquitin-specific protease (USP)11, Cdc37, HSP90-{alpha}, HSP90-{beta}, and KIF23 (5, 8, 27). However, LKB1 interaction with binding partners in skeletal muscle has not been specifically studied.

The functional significance of the increase in LKB1 and MO25 with training is unknown but may have potentially profound consequences on cell function. Most recently, the LKB1-STRAD-MO25 complex was found to phosphorylate eleven of the twelve AMPK-related kinases (42). NUAK1, NUAK2, BRSK1, BRSK2, quiescence-induced kinase (QIK), QSK, salt-inducible kinase (SIK), microtubule affinity-regulating kinase (MARK)1, MARK2, MARK3, and MARK4 were all phosphorylated and activated, whereas maternal embryonic leucine zipper kinase (MELK) was not. Phosphorylation of the AMPK-related kinases resulted in a >50-fold increase in their activity. The authors of that study propose that these kinases may mediate many of the physiological effects of LKB1, including its tumor-suppressive effects. An increase in LKB1 could affect any or all of the signaling pathways mediated by these AMPK-related kinases. Contraction, phenformin, and AICAR were found not to activate the AMPK-related kinases QSK, QIK, MARK2/3, and MARK4 in skeletal muscle (39). However, chronic contraction may regulate these proteins over time through an increase in LKB1 and/or MO25.

It is unlikely that the major role for the increase in LKB1 with training is one of tumor suppression, because Peutz-Jeghers patients are not characterized by skeletal muscle tumors. However, the same mechanism that induces an increase in skeletal muscle LKB1 with endurance training may induce an increase in LKB1 in metabolically stressed growing tumors. LKB1 has been shown to be elevated in some tumors; this increase in LKB1 may serve as a check against uncontrolled proliferation (36).

In conclusion, we found that endurance training markedly increased LKB1 and MO25 protein abundance in skeletal muscle but had no effect on AMPKK activity. Additionally, among different types of skeletal muscle, WQ had the highest AMPKK activity but the lowest LKB1 protein level. These results indicate that factors other than LKB1 protein abundance are important for AMPKK activity, and LKB1 may be playing an additional role(s) in the adaptation to metabolic stress. Because LKB1 is a master kinase for AMPK and the AMPK-related kinases and a tumor suppressor, the increase in LKB1 could have implications for glucose homeostasis, control of cell growth, and other unidentified cellular functions. Identification of the mechanism and effect of endurance training-induced increases in LKB1 may yield insight useful for the treatment of type 2 diabetes and certain cancers.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was funded by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant AR-41438.


    ACKNOWLEDGMENTS
 
We thank Richard Burgon for technical assistance with real-time RT-PCR.


    FOOTNOTES
 

Address for reprint requests and other correspondence: W. W. Winder, 545 WIDB, Brigham Young Univ., Provo, Utah 84602 (E-mail: william_winder{at}byu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Baas AF, Boudeau J, Sapkota GP, Smit L, Medema R, Morrice NA, Alessi DR, and Clevers HC. Activation of the tumour suppressor kinase LKB1 by the STE20-like pseudokinase STRAD. EMBO J 22: 3062–3072, 2003.[CrossRef][Web of Science][Medline]
  2. Bergeron R, Ren JM, Cadman KS, Moore IK, Perret P, Pypaert M, Young LH, Semenkovich CF, and Shulman GI. Chronic activation of AMP kinase results in NRF-1 activation and mitochondrial biogenesis. Am J Physiol Endocrinol Metab 281: E1340–E1346, 2001.[Abstract/Free Full Text]
  3. Bergeron R, Russell RR 3rd, Young LH, Ren JM, Marcucci M, Lee A, and Shulman GI. Effect of AMPK activation on muscle glucose metabolism in conscious rats. Am J Physiol Endocrinol Metab 276: E938–E944, 1999.[Abstract/Free Full Text]
  4. Bolster DR, Crozier SJ, Kimball SR, and Jefferson LS. AMP-activated protein kinase suppresses protein synthesis in rat skeletal muscle through down-regulated mammalian target of rapamycin (mTOR) signaling. J Biol Chem 277: 23977–23980, 2002.[Abstract/Free Full Text]
  5. Boudeau J, Baas AF, Deak M, Morrice NA, Kieloch A, Schutkowski M, Prescott AR, Clevers HC, and Alessi DR. MO25{alpha}/{beta} interact with STRAD{alpha}/{beta} enhancing their ability to bind, activate and localize LKB1 in the cytoplasm. EMBO J 22: 5102–5114, 2003.[CrossRef][Web of Science][Medline]
  6. Boudeau J, Deak M, Lawlor MA, Morrice NA, and Alessi DR. Heat-shock protein 90 and Cdc37 interact with LKB1 and regulate its stability. Biochem J 370: 849–857, 2003.[CrossRef][Web of Science][Medline]
  7. Boudeau J, Sapkota G, and Alessi DR. LKB1, a protein kinase regulating cell proliferation and polarity. FEBS Lett 546: 159–165, 2003.[CrossRef][Web of Science][Medline]
  8. Brajenovic M, Joberty G, Kuster B, Bouwmeester T, and Drewes G. Comprehensive proteomic analysis of human Par protein complexes reveals an interconnected protein network. J Biol Chem 279: 12804–12811, 2004.[Abstract/Free Full Text]
  9. Browne GJ, Finn SG, and Proud CG. Stimulation of the AMP-activated protein kinase leads to activation of eukaryotic elongation factor 2 kinase and to its phosphorylation at a novel site, serine 398. J Biol Chem 279: 12220–12231, 2004.[Abstract/Free Full Text]
  10. Chen ZP, Stephens TJ, Murthy S, Canny BJ, Hargreaves M, Witters LA, Kemp BE, and McConell GK. Effect of exercise intensity on skeletal muscle AMPK signaling in humans. Diabetes 52: 2205–2212, 2003.[Abstract/Free Full Text]
  11. Collins SP, Reoma JL, Gamm DM, and Uhler MD. LKB1, a novel serine/threonine protein kinase and potential tumour suppressor, is phosphorylated by cAMP-dependent protein kinase (PKA) and prenylated in vivo. Biochem J 345: 673–680, 2000.[CrossRef][Web of Science][Medline]
  12. Durante PE, Mustard KJ, Park SH, Winder WW, and Hardie DG. Effects of endurance training on activity and expression of AMP-activated protein kinase isoforms in rat muscles. Am J Physiol Endocrinol Metab 283: E178–E186, 2002.[Abstract/Free Full Text]
  13. Frosig C, Jorgensen SB, Hardie DG, Richter EA, and Wojtaszewski JF. 5'-AMP-activated protein kinase activity and protein expression are regulated by endurance training in human skeletal muscle. Am J Physiol Endocrinol Metab 286: E411–E417, 2004.[Abstract/Free Full Text]
  14. Hamilton SR, O'Donnell JB Jr, Hammet A, Stapleton D, Habinowski SA, Means AR, Kemp BE, and Witters LA. AMP-activated protein kinase kinase: detection with recombinant AMPK {alpha}1 subunit. Biochem Biophys Res Commun 293: 892–898, 2002.[CrossRef][Web of Science][Medline]
  15. Hardie DG. AMP-activated protein kinase: a key system mediating metabolic responses to exercise. Med Sci Sports Exerc 36: 28–34, 2004.
  16. Hawley SA, Boudeau J, Reid JL, Mustard KJ, Udd L, Makela TP, Alessi DR, and Hardie DG. Complexes between the LKB1 tumor suppressor, STRAD{alpha}/{beta} and MO25{alpha}/{beta} are upstream kinases in the AMP-activated protein kinase cascade. J Biol 2: 28, 2003.[CrossRef][Medline]
  17. Hawley SA, Davison M, Woods A, Davies SP, Beri RK, Carling D, and Hardie DG. Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase. J Biol Chem 271: 27879–27887, 1996.[Abstract/Free Full Text]
  18. Hayashi T, Hirshman MF, Kurth EJ, Winder WW, and Goodyear LJ. Evidence for 5' AMP-activated protein kinase mediation of the effect of muscle contraction on glucose transport. Diabetes 47: 1369–1373, 1998.[Abstract]
  19. Hemminki A, Markie D, Tomlinson I, Avizienyte E, Roth S, Loukola A, Bignell G, Warren W, Aminoff M, Hoglund P, Jarvinen H, Kristo P, Pelin K, Ridanpaa M, Salovaara R, Toro T, Bodmer W, Olschwang S, Olsen AS, Stratton MR, de la Chapelle A, and Aaltonen LA. A serine/threonine kinase gene defective in Peutz-Jeghers syndrome. Nature 391: 184–187, 1998.[CrossRef][Medline]
  20. Horman S, Browne G, Krause U, Patel J, Vertommen D, Bertrand L, Lavoinne A, Hue L, Proud C, and Rider M. Activation of AMP-activated protein kinase leads to the phosphorylation of elongation factor 2 and an inhibition of protein synthesis. Curr Biol 12: 1419–1423, 2002.[CrossRef][Web of Science][Medline]
  21. Jessen N, Pold R, Buhl ES, Jensen LS, Schmitz O, and Lund S. Effects of AICAR and exercise on insulin-stimulated glucose uptake, signaling, and GLUT-4 content in rat muscles. J Appl Physiol 94: 1373–1379, 2003.[Abstract/Free Full Text]
  22. Kurth-Kraczek EJ, Hirshman MF, Goodyear LJ, and Winder WW. 5' AMP-activated protein kinase activation causes GLUT4 translocation in skeletal muscle. Diabetes 48: 1667–1671, 1999.[Abstract]
  23. Kyriakis JM. At the crossroads: AMP-activated kinase and the LKB1 tumor suppressor link cell proliferation to metabolic regulation. J Biol 2: 26, 2003.[CrossRef][Medline]
  24. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685, 1970.[CrossRef][Medline]
  25. Leverve XM, Guigas B, Detaille D, Batandier C, Koceir EA, Chauvin C, Fontaine E, and Wiernsperger NF. Mitochondrial metabolism and type-2 diabetes: a specific target of metformin. Diabetes Metab 29: 6S88–6S94, 2003.[Medline]
  26. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–Delta Delta C(T)) Method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
  27. Marignani PA, Kanai F, and Carpenter CL. LKB1 associates with Brg1 and is necessary for Brg1-induced growth arrest. J Biol Chem 276: 32415–32418, 2001.[Abstract/Free Full Text]
  28. Marugame T, Lee K, Eguchi H, Oda T, Shinchi K, and Kono S. Relation of impaired glucose tolerance and diabetes mellitus to colorectal adenomas in Japan. Cancer Causes Control 13: 917–921, 2002.[CrossRef][Web of Science][Medline]
  29. Merrill GF, Kurth EJ, Hardie DG, and Winder WW. AICA riboside increases AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle. Am J Physiol Endocrinol Metab 273: E1107–E1112, 1997.[Abstract/Free Full Text]
  30. Milburn CC, Boudeau J, Deak M, Alessi DR, and van Aalten DM. Crystal structure of MO25 alpha in complex with the C terminus of the pseudo kinase STE20-related adaptor. Nat Struct Mol Biol 11: 193–200, 2004.[CrossRef][Web of Science][Medline]
  31. Moore P. Connecting LKB1 and AMPK links metabolism with cancer. J Biol 2: 24, 2003.[CrossRef][Medline]
  32. Musi N and Goodyear LJ. AMP-activated protein kinase and muscle glucose uptake. Acta Physiol Scand 178: 337–345, 2003.[CrossRef][Web of Science][Medline]
  33. Nielsen JN, Mustard KJ, Graham DA, Yu H, MacDonald CS, Pilegaard H, Goodyear LJ, Hardie DG, Richter EA, and Wojtaszewski JF. 5'-AMP-activated protein kinase activity and subunit expression in exercise-trained human skeletal muscle. J Appl Physiol 94: 631–641, 2003.[Abstract/Free Full Text]
  34. Nilsen TI and Vatten LJ. Prospective study of colorectal cancer risk and physical activity, diabetes, blood glucose and BMI: exploring the hyperinsulinaemia hypothesis. Br J Cancer 84: 417–422, 2001.[CrossRef][Web of Science][Medline]
  35. Nony P, Gaude H, Rossel M, Fournier L, Rouault JP, and Billaud M. Stability of the Peutz-Jeghers syndrome kinase LKB1 requires its binding to the molecular chaperones Hsp90/Cdc37. Oncogene 22: 9165–9175, 2003.[CrossRef][Web of Science][Medline]
  36. Rowan A, Churchman M, Jefferey R, Hanby A, Poulsom R, and Tomlinson I. In situ analysis of LKB1/STK11 mRNA expression in human normal tissues and tumours. J Pathol 192: 203–206, 2000.[CrossRef][Web of Science][Medline]
  37. Ruderman N and Prentki M. AMP kinase and malonyl-CoA: targets for therapy of the metabolic syndrome. Nat Rev Drug Discov 3: 340–351, 2004.[CrossRef][Web of Science][Medline]
  38. Ruderman NB, Park H, Kaushik VK, Dean D, Constant S, Prentki M, and Saha AK. AMPK as a metabolic switch in rat muscle, liver and adipose tissue after exercise. Acta Physiol Scand 178: 435–442, 2003.[CrossRef][Web of Science][Medline]
  39. Sakamoto K, Goransson O, Hardie DG, and Alessi DR. Activity of LKB1 and AMPK-related kinases in skeletal muscle: effects of contraction, phenformin, and AICAR. Am J Physiol Endocrinol Metab 287: E310–E317, 2004.[Abstract/Free Full Text]
  40. Sapkota GP, Boudeau J, Deak M, Kieloch A, Morrice N, and Alessi DR. Identification and characterization of four novel phosphorylation sites (Ser31, Ser325, Thr336 and Thr366) on LKB1/STK11, the protein kinase mutated in Peutz-Jeghers cancer syndrome. Biochem J 362: 481–490, 2002.[CrossRef][Web of Science][Medline]
  41. Sapkota GP, Kieloch A, Lizcano JM, Lain S, Arthur JS, Williams MR, Morrice N, Deak M, and Alessi DR. Phosphorylation of the protein kinase mutated in Peutz-Jeghers cancer syndrome, LKB1/STK11, at Ser431 by p90(RSK) and cAMP-dependent protein kinase, but not its farnesylation at Cys(433), is essential for LKB1 to suppress cell growth. J Biol Chem 276: 19469–19482, 2001.[Abstract/Free Full Text]
  42. Shaw RJ, Kosmatka M, Bardeesy N, Hurley RL, Witters LA, DePinho RA, and Cantley LC. The tumor suppressor LKB1 kinase directly activates AMP-activated kinase and regulates apoptosis in response to energy stress. Proc Natl Acad Sci USA 101: 3329–3335, 2004.[Abstract/Free Full Text]
  43. Srere PA. Citrate synthase. Methods Enzymol 13: 3–6, 1969.[CrossRef]
  44. Stein SC, Woods A, Jones NA, Davison MD, and Carling D. The regulation of AMP-activated protein kinase by phosphorylation. Biochem J 345: 437–443, 2000.[CrossRef][Web of Science][Medline]
  45. Tiainen M, Ylikorkala A, and Makela TP. Growth suppression by Lkb1 is mediated by a G(1) cell cycle arrest. Proc Natl Acad Sci USA 96: 9248–9251, 1999.[Abstract/Free Full Text]
  46. Vavvas D, Apazidis A, Saha AK, Gamble J, Patel A, Kemp BE, Witters LA, and Ruderman NB. Contraction-induced changes in acetyl-CoA carboxylase and 5'-AMP-activated kinase in skeletal muscle. J Biol Chem 272: 13255–13261, 1997.[Abstract/Free Full Text]
  47. Winder WW and Hardie DG. AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes. Am J Physiol Endocrinol Metab 277: E1–E10, 1999.[Abstract/Free Full Text]
  48. Winder WW, Holmes BF, Rubink DS, Jensen EB, Chen M, and Holloszy JO. Activation of AMP-activated protein kinase increases mitochondrial enzymes in skeletal muscle. J Appl Physiol 88: 2219–2226, 2000.[Abstract/Free Full Text]
  49. Woods A, Johnstone SR, Dickerson K, Leiper FC, Fryer LG, Neumann D, Schlattner U, Wallimann T, Carlson M, and Carling D. LKB1 is the upstream kinase in the AMP-activated protein kinase cascade. Curr Biol 13: 2004–2008, 2003.[CrossRef][Web of Science][Medline]
  50. Yu M, Stepto NK, Chibalin AV, Fryer LG, Carling D, Krook A, Hawley JA, and Zierath JR. Metabolic and mitogenic signal transduction in human skeletal muscle after intense cycling exercise. J Physiol 546: 327–335, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
B. Xue, T. Pulinilkunnil, I. Murano, K. K. Bence, H. He, Y. Minokoshi, K. Asakura, A. Lee, F. Haj, N. Furukawa, et al.
Neuronal Protein Tyrosine Phosphatase 1B Deficiency Results in Inhibition of Hypothalamic AMPK and Isoform-Specific Activation of AMPK in Peripheral Tissues
Mol. Cell. Biol., August 15, 2009; 29(16): 4563 - 4573.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. R. Ussher, J. S. Jaswal, C. S. Wagg, H. E. Armstrong, D. G. Lopaschuk, W. Keung, and G. D. Lopaschuk
Role of the atypical protein kinase C{zeta} in regulation of 5'-AMP-activated protein kinase in cardiac and skeletal muscle
Am J Physiol Endocrinol Metab, August 1, 2009; 297(2): E349 - E357.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
D. J. Branvold, D. R. Allred, D. J. Beckstead, H. J. Kim, N. Fillmore, B. M. Condon, J. D. Brown, S. N. Sudweeks, D. M. Thomson, and W. W. Winder
Thyroid hormone effects on LKB1, MO25, phospho-AMPK, phospho-CREB, and PGC-1{alpha} in rat muscle
J Appl Physiol, October 1, 2008; 105(4): 1218 - 1227.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
W. J. Ellingson, D. G. Chesser, and W. W. Winder
Effects of 3-phosphoglycerate and other metabolites on the activation of AMP-activated protein kinase by LKB1-STRAD-MO25
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E400 - E407.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. B. Birk and J. F. P. Wojtaszewski
Predominant {alpha}2/{beta}2/{gamma}3 AMPK activation during exercise in human skeletal muscle
J. Physiol., December 15, 2006; 577(3): 1021 - 1032.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
B. Xue and B. B. Kahn
AMPK integrates nutrient and hormonal signals to regulate food intake and energy balance through effects in the hypothalamus and peripheral tissues
J. Physiol., July 1, 2006; 574(1): 73 - 83.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Sriwijitkamol, J. L. Ivy, C. Christ-Roberts, R. A. DeFronzo, L. J. Mandarino, and N. Musi
LKB1-AMPK signaling in muscle from obese insulin-resistant Zucker rats and effects of training
Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E925 - E932.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. B. Taylor, W. J. Ellingson, J. D. Lamb, D. G. Chesser, C. L. Compton, and W. W. Winder
Evidence against regulation of AMP-activated protein kinase and LKB1/STRAD/MO25 activity by creatine phosphate
Am J Physiol Endocrinol Metab, April 1, 2006; 290(4): E661 - E669.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. B. Taylor, J. D. Lamb, R. W. Hurst, D. G. Chesser, W. J. Ellingson, L. J. Greenwood, B. B. Porter, S. T. Herway, and W. W. Winder
Endurance training increases skeletal muscle LKB1 and PGC-1{alpha} protein abundance: effects of time and intensity
Am J Physiol Endocrinol Metab, December 1, 2005; 289(6): E960 - E968.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. Hurst, E. B. Taylor, T. D. Cline, L. J. Greenwood, C. L. Compton, J. D. Lamb, and W. W. Winder
AMP-activated protein kinase kinase activity and phosphorylation of AMP-activated protein kinase in contracting muscle of sedentary and endurance-trained rats
Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E710 - E715.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
N. Jessen and L. J. Goodyear
Contraction signaling to glucose transport in skeletal muscle
J Appl Physiol, July 1, 2005; 99(1): 330 - 337.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. B. Taylor, W. J. Ellingson, J. D. Lamb, D. G. Chesser, and W. W. Winder
Long-chain acyl-CoA esters inhibit phosphorylation of AMP-activated protein kinase at threonine-172 by LKB1/STRAD/MO25
Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1055 - E1061.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/6/E1082    most recent
00179.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, E. B.
Right arrow Articles by Winder, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, E. B.
Right arrow Articles by Winder, W. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.