AJP - Endo Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 287: E446-E453, 2004. First published May 4, 2004; doi:10.1152/ajpendo.00488.2003
0193-1849/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/3/E446    most recent
00488.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delporte, M.-L.
Right arrow Articles by Brichard, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delporte, M.-L.
Right arrow Articles by Brichard, S. M.

Leptin treatment markedly increased plasma adiponectin but barely decreased plasma resistin of ob/ob mice

Marie-Laure Delporte, Samira Ait El Mkadem, Muriel Quisquater, and Sonia M. Brichard

Endocrinology and Metabolism Unit, University of Louvain, Faculty of Medicine, 1200 Brussels, Belgium

Submitted 30 October 2003 ; accepted in final form 30 April 2004


    ABSTRACT
 TOP
 ABSTRACT
 ANIMALS, MATERIALS, AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Adiponectin (ApN) and leptin are two adipocytokines that control fuel homeostasis, body weight, and insulin sensitivity. Their interplay is still poorly studied. These hormones are either undetectable or decreased in obese, diabetic ob/ob mice. We examined the effects of leptin treatment on ApN gene expression, protein production, secretion, and circulating levels of ob/ob mice. We also briefly tackled the influence of this treatment on resistin, another adipocytokine involved in obesity-related insulin resistance. Leptin-treated (T) obese mice (continuous sc infusion for 6 days) were compared with untreated lean (L), untreated obese (O), and untreated pair-fed obese (PF) mice. Blood was collected throughout the study. At day 3 or day 6, fat pads were either directly analyzed (mRNA, ApN content) or cultured for up to 24 h (ApN secretion). The direct effect of leptin was also studied in 3T3-F442A adipocytes. Compared with L mice, ApN content of visceral or subcutaneous fat and ApN secretion by adipose explants were blunted in obese mice. Accordingly, plasma ApN levels of O mice were decreased by 50%. Leptin treatment of ob/ob mice increased ApN mRNAs, ApN content, and secretion from the visceral depot by 50–80%. Leptin also directly stimulated ApN mRNAs and secretion from 3T3-F442A adipocytes. After 6 days of treatment, plasma ApN of ob/ob mice increased 2.5-fold, a rise that did not occur in PF mice. Plasma resistin of T mice was barely decreased. Leptin treatment, but not mere calorie restriction, corrects plasma ApN in obese mice by restoring adipose tissue ApN concentrations and secretion, at least in part, via a direct stimulation of ApN gene expression. Such a treatment only minimally affects circulating resistin. ApN restoration could, in concert with leptin, contribute to the metabolic effects classically observed during leptin administration.

obesity; diabetes; adipocytokines; insulin sensitivity; calorie restriction


ADIPOSE TISSUE SECRETES a large number of physiologically active peptides that often share structural properties of cytokines and are therefore referred to collectively as "adipocytokines." These include leptin, adiponectin, resistin, TNF-{alpha}, plasminogen activator inhibitor-1 (PAI-1), IL-6, and angiotensinogen (20, 24). Two of these, leptin and adiponectin (ApN), expressed almost exclusively in differentiated adipocytes, exert major metabolic properties. Both increase muscle fatty acid oxidation and thermogenesis, and they may cause weight loss in mice (at least when energy intake is controlled in the case of ApN) (3, 18, 27, 28). Both are also potent enhancers of insulin action in mouse models of obesity, lipoatrophy, and/or diabetes (2, 28, 46, 52). Eventually, ApN plays a protective role against atherosclerosis (31, 41).

Plasma levels of leptin are increased (but are poorly active because of a resistance to its action) and plasma levels of ApN are decreased in human obesity and related disorders (1). This altered profile of adipocytokines plays a determinant role in the pathogenesis of the metabolic syndrome.

Although essential for our understanding of this syndrome, the interplay between these adipocytokines and, more particularly, the effects of leptin on ApN are still poorly studied. Acute leptin treatment (≤48 h) did not modify plasma ApN levels in humans (19). Longer administration of leptin (≥1 wk) yielded conflicting results in rodents. On one hand, it also had no effect on plasma ApN levels of severely lipoatrophic A-ZIP/F-1 mice, but this strain of mice is almost devoid of adipose tissue (9). On the other hand, in another study (55), which merely examined gene expression, this treatment increased ApN mRNA abundance in adipose tissue of normal rats compared with pair-fed animals.

In obese and insulin-resistant ob/ob mice, circulating leptin is undetectable (due to a mutation of the ob gene), and plasma ApN is likely to be decreased (52). We used these mice as an animal model to study the interplay between leptin and adiponectin. We treated hypoadiponectinemic ob/ob mice with leptin for 1 wk and examined the influence of this treatment on ApN gene expression, adipose tissue content, secretion, and circulating levels. We also briefly tackled the effects of leptin on resistin, another adipocytokine whose elevated circulating levels may worsen obesity-linked insulin resistance (48).


    ANIMALS, MATERIALS, AND METHODS
 TOP
 ABSTRACT
 ANIMALS, MATERIALS, AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals and experimental design. Three series of female C57BL/6J obese (ob/ob) and lean littermate (+/?) mice were purchased from Jackson Laboratory (Bar Harbor, ME) and used at the age of 12 wk. In the first two series, mice were treated for 6 days; because similar results were obtained, data of these series were pooled for presentation. In the third series, mice were treated for only 3 days and used merely to study adipose tissue gene expression. Animals were housed in individual cages with a fixed 12:12-h light-dark cycle and received a common laboratory chow (A04; UAR, Epinay sur Orge, France).

The animals were divided into four experimental groups: lean mice (L, n = 34), untreated obese mice (O, n = 10; first two series), obese mice treated with leptin (T, n = 17), and obese pair-fed mice (PF, n = 10, second and third series only). Mouse recombinant leptin (Peprotech, London, UK) was dissolved in 5 mM sodium citrate (pH 4) and administered for 6 (or 3) days to T mice as a continuous subcutaneous infusion (20 µg/day) via an osmotic minipump. Although food intake was normalized at constant delivery of the lower amount of the hormone, this dosage was found to be necessary to normalize metabolic parameters, hypothermia, and uncoupling protein expression in ob/ob mice (23). The minipump (Alzet model 2001; Alza, Palo Alto, CA) was implanted in the interscapular region of mice under light anesthesia. Mice from the other groups received pumps filled with vehicle. Unlike other animals fed ad libitum, PF mice received a restricted amount of food similar to that spontaneously ingested by T mice; this amount was adjusted daily and administered in two rations (one-third at 1000 and two-thirds at 2200). At the beginning of the study, the groups of ob/ob mice were matched for body weight and fed blood glucose (see Fig. 1). They were also matched, as seen a posteriori, for fed plasma insulin and adiponectin levels sampled on day 0 (see Figs. 1 and 2).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. Effects of leptin treatment on body wt and food consumption (A) and on blood glucose and plasma insulin levels (B) of ob/ob mice. All measurements or samplings were made between 0800 and 0900. Four groups of mice were studied: untreated lean (L) mice, untreated ob/ob (O) mice, ob/ob mice treated (T) with subcutaneous infusion of leptin, and ob/ob mice pair fed (PF) with T mice. Osmotic minipumps delivering leptin were implanted at day 0; mice from the other 3 groups received vehicle only. Values are means ± SE for 24–30, 10, 13, and 7 mice in the respective groups (animals from the first 2 series). *P ≤ 0.05 for T vs. PF mice [ANOVA or t-test (insulin)]; only significant differences between these 2 groups are shown for sake of clarity.

 


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2. Effects of leptin treatment on plasma adiponectin (ApN) levels of ob/ob mice. Samplings were made between 0800 and 0900 in L, O, T, and PF mice. Plasma ApN levels were quantified by scanning densitometry of autoradiographic signals obtained from Western blots (like that shown in inset) and calculated from a linear standard curve generated by increasing amounts of mouse recombinant (r)ApN. Values are means ± SE for 24, 10, 13, and 7 mice in the respective groups. +P < 0.001 for each group of ob/ob (O, T, or PF) mice vs. L mice; *P ≤ 0.01 for T mice vs. each group of untreated mice (L, O, or PF). Other differences were omitted for sake of clarity.

 
Body weight and food intake were measured daily. On several occasions, tail vein blood was collected from fed mice (between 0800 and 0900). At the end of the experiment, the mice were killed by decapitation (between 0800 and 1000), and larger blood samples were also saved. Pairs of visceral (intraperitoneal-retrovesical) and subcutaneous (inguinal) white fat pads and interscapular brown adipose tissue were immediately removed and either frozen in liquid nitrogen and stored at –70°C or immediately used for ex vivo studies (adipose tissue culture).

The University Animal Care Committee approved all procedures.

Culture of adipose explants and 3T3-F442A adipocytes. Small fragments of mouse visceral and inguinal adipose tissue (2–3 mm3; explants) were prepared and cultured in MEM with Earle's salts, supplemented with 0.5% BSA and antibiotics as described (15). It proved necessary to culture 400-mg adipose tissue for 24 h to obtain detectable amounts of ApN secreted into medium by fat from obese mice. These experimental conditions were therefore extended to all groups of mice. ApN secretion was linear for ≤24 h in each group. Aliquots of medium were saved during the culture and stored at –20°C.

Mouse 3T3-F442A preadipocytes were grown at 37°C in 5% CO2 in basal medium (i.e., DMEM with 1 g/l glucose containing 10% FCS, 8 mg/l biotin, and antibiotics) (38). Two days after confluence, cells were induced to differentiate in induction medium [i.e., basal medium supplemented with 17 nM insulin, 2 nM triiodothyronine (T3), 100 nM dexamethasone, and 100 µM IBMX]. Forty-eight hours later, the induction medium was replaced by a differentiation medium (i.e., basal medium supplemented with 17 nM insulin and 2 nM T3) that was kept until the end of the study. One-half of medium volume was renewed every day from induction onward. At the time of the experiments (day 8 after initiation of differentiation), >90% of the cells had accumulated fat droplets, as evidenced by Oil Red O staining, and leptin was added to the differentiation medium.

Northern blot analysis and real-time PCR. Total RNA from adipose tissue was subjected to Northern blot analysis (21). The cDNA probes for mouse ApN and TNF-{alpha} have been described elsewhere (15, 43). The cDNA probe for mouse resistin was obtained after RT-PCR on total RNA from mouse adipose tissue (sense primer 5' TCCTTGTCCCTGAACTGC 3' and antisense primer 5' TGGAAACCACGCTCACTT 3'). After hybridization with the radiolabeled probes (15), optical densities (OD) of the mRNA bands on the autoradigrams and of 18S rRNA on the membranes were quantified by scanning densitometry. Levels of specific mRNA were expressed relative to those of 18S rRNA.

ApN mRNAs from 3T3-F442A adipocytes were measured by real-time PCR. Total RNA (2 µg) was reverse transcribed using oligo(dT) primers and Superscript II Reverse Transcriptase (Life Technologies, Leek, The Netherlands). Total RNA equivalents (40 ng) were amplified with iQ Syber Green Supermix (Bio-Rad Laboratories, Brussels, Belgium) containing 300 nM of each specific primer by use of the iCycler iQ Real Time PCR Detection System (Bio-Rad). The primers designed for ApN were 5' GCAGAGATGGCACTCCTGGA 3' (sense) and 5' CCCTTCAGCTCCTGTCATTCC 3' (antisense), and those for rat were cyclophilin 5' AACCCCACCGTGTTCTTC 3' (sense) and 5' TGCCTTCTTTCACCTTCCC 3' (antisense). The threshold cycles (Ct) for ApN and cyclophilin were measured in separate tubes and in duplicate. The amount of ApN mRNA, normalized to cyclophilin mRNA, was expressed relative to the respective control culture condition and calculated as 2–{Delta}{Delta}Ct (13).

Quantification of ApN and resistin. ApN concentrations were measured in plasma, culture medium, or homogenized adipose tissue samples (15). Aliquots from plasma (0.5 µl), medium (30 µl, Western blot; 100 µl, RIA), or tissue homogenates (2.5- to 10-µg protein) were analyzed by Western blot, as described (15), or by RIA (Linco Research, St. Charles, MO). There was a close correlation between absolute ApN levels obtained by both methods (P < 0.0001). Two species of ApN were detected on Western blots (15): one that migrates like recombinant ApN as a 30-kDa band (immature form), and the other found in plasma and in culture medium that migrates as a 32-kDa band (mature, posttranslationally modified form) (see Figs. 2 and 3D). In adipose tissue homogenates, both forms of ApN could be detected (see Fig. 3C).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3. Effects of leptin treatment on ApN gene expression (A and B), tissue levels (C), and secretion (D) from fat of ob/ob mice. Visceral and inguinal adipose tissues of L, O, T, and PF mice were sampled after 6 days, except for A (3 days). Tissues were either stored for subsequent measurements of ApN mRNA or ApN content (A-C) or directly cultured to allow determination of ApN secretion (D). A and B: ApN mRNA levels were quantified by scanning densitometry of autoradiographic signals from Northern blots, normalized for 18S rRNA bands. Results were then expressed as % of values obtained in visceral fat of L mice. Representative blots, with 10 µg total RNA loaded on each lane, are shown in insets. C: tissue ApN levels were determined by Western blotting (a representative blot is shown). Aliquots of tissue homogenates (10 µg protein) were loaded on each lane, and density of ApN bands was scanned. Data were calculated as optical density (OD) units normalized for aliquot protein content. ApN levels were then expressed as % of values obtained in visceral fat of L mice. D: ApN secreted by adipose explants was measured in medium after 24 h of culture. Equal volumes (30 µl) of culture medium were loaded on each lane. Only the 32-kDa species of ApN was detected on Western blots (see inset). ApN levels were calculated as ng/mg adipose tissue and then expressed as % of values obtained with visceral explants of L mice. Absolute values of ApN secretion in L controls were 2.2 ± 0.1 ng/mg adipose tissue. Results are means ± SE for 3–4 mice per group (3rd series) in A, for 11 L, 9 O, 13 T, and 7 PF mice in B (animals selected at random from the first 2 series), 6–7 mice per group in C (animals from the 1st series), and 3, 4, 6, and 7 mice in D (second series). +P < 0.05 for T vs. PF mice, *P < 0.05 for T vs. O mice. Each parameter of O, T, or PF mice was significantly different from the respective value of L mice (except for visceral depot in A). Depot-specific differences (visceral vs. inguinal) were also statistically significant for each parameter of L mice.

 
Resistin levels were measured in duplicate on diluted (1:5) plasma samples using an ELISA kit (Phoenix Pharmaceuticals, Belmont, CA). These results were confirmed by a mouse resistin RIA kit (Linco).

Other analytical procedures. Blood glucose was measured using a glucometer (Elite, Bayer, Brussels, Belgium). Plasma insulin, corticosterone, total cholesterol, and triglyceride levels were determined as described (5, 44). Protein concentrations in tissue homogenates were measured by the Bradford method.

Statistical analysis. Results are given as means ± SE for the indicated number of mice. Multiple comparisons were carried out by ANOVA or by repeated-measures ANOVA followed by the Newman-Keuls test, and comparisons between two conditions were by unpaired or paired Student's t-test or by a nonparametric test when appropriate. Differences were considered statistically significant at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 ANIMALS, MATERIALS, AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Initial body weights and daily food consumption of ob/ob mice were about twofold higher than those of L mice (Fig. 1A). Except for a decrease in food consumption that occurred immediately after surgery in all groups of mice, these parameters remained rather stable in L and O mice throughout the study. In contrast, leptin-treated mice presented a progressive decrease in body weight (about –15% at day 6) and a persistent and marked reduction in food intake. PF mice behaved similarly: their body weight and food intake paralleled those of T mice.

Weights of brown adipose tissue from the interscapular region and white fat pads from two depots were heavier in O than in L mice (on the average ~4-fold for brown fat and ~13-fold for white fat; Table 1). As described (23), leptin treatment caused a marked decrease in brown adipose tissue weight, likely as a result of enhanced sympathetic tone (45). Both leptin and calorie restriction reduced inguinal (34), but not retrovesical, fat mass of obese mice (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of leptin treatment on weight of several fat depots and on plasma lipid levels in ob/ob mice

 
Obese mice were hyperglycemic and hyperinsulinemic compared with lean mice (Fig. 1B). Leptin treatment resulted in a normalization of plasma glucose and insulin levels, which decreased to values similar to those of L mice from the 6th or the 3rd day onward. Mere calorie restriction in PF mice also improved these parameters of glucose homeostasis, but to a lesser extent than leptin treatment (Fig. 1B). Morning plasma corticosterone levels of O mice (273 ± 41 nmol/l, n = 7; average values obtained at days 3 and 6) were higher than those of L mice (153 ± 32 nmol/l, n = 7; P < 0.05). Hypercorticosteronemia was fully corrected by leptin (153 ± 37 nmol/l, n = 7) but not by pair-feeding (275 ± 42 nmol/l, n = 7). This correction was observed from day 3 onward. Likewise, leptin, but not pair-feeding, normalized the hypercholesterolemia that otherwise occurred in O mice. Treatment with the adipocytokine also attenuated plasma triglycerides (Table 1).

ApN circulates as a 32-kDa isoform in plasma of the four groups of mice (Fig. 2). Initial plasma ApN concentrations were 50% lower in ob/ob mice than in lean mice. These levels remained fairly stable in O and L mice during the experiment. Leptin treatment for 6 days induced a 2.5-fold rise in circulating ApN that actually exceeded L values, whereas no changes occurred in PF mice.

ApN mRNA levels were measured in several adipose tissue sites. In brown adipose tissue, the ApN gene was not affected by the ob/ob genotype or by leptin treatment (not shown). In white fat, ApN mRNAs were expressed more strongly in the visceral than in the inguinal depot of L mice (P < 0.01; Fig. 3, A and B), as described (15). Compared with respective values of L mice, ApN mRNAs of O mice were decreased in visceral fat but increased in inguinal fat (P ≤ 0.01 for each depot, Fig. 3B). However, because total RNA concentrations were lower in obese than in lean fat, when data were expressed as OD per milligram of adipose tissue, ApN gene expression fell by 60–80% in both depots of O mice (P < 0.0001, not shown). Leptin or calorie restriction did not affect ApN mRNAs in either of these two depots at day 6 (Fig. 3B). However, in additional experiments in which adipose tissue was sampled earlier in the course of the study (i.e., at day 3), leptin induced an ~50% rise of ApN mRNA in the visceral depot compared with PF values (Fig. 3A).

Both 30-kDa and 32-kDa species of ApN were recovered in adipose tissue homogenates of L mice. In ob/ob homogenates, the 30-kDa species was either undetectable (visceral fat) or detected as a faint signal (inguinal fat). Leptin treatment did not seem to affect the 30-kDa/32-kDa distributions. In agreement with the depot-specific pattern of mRNA expression, overall tissue ApN levels of L mice were higher in visceral than in inguinal fat (Fig. 3C). Tissue ApN levels of ob/ob mice were markedly decreased in both depots. Compared with O values, leptin treatment increased ApN concentrations by 80% in the visceral, but not in the inguinal, depot (Fig. 3C). Qualitatively similar data were obtained for every group when ApN concentrations were expressed as OD per milligram of tissue (not shown).

ApN secreted in medium by adipose explants from mice of the four groups was measured after 24 h of culture (Fig. 3D). Only the 32-kDa species (mature isoform) was secreted by either lean or ob/ob explants. The pattern of ApN secretion paralleled that of overall tissue ApN. Depot-specific differences in secretion were observed in L mice (P < 0.05 between regions). In addition, ApN secretion was markedly suppressed in both depots of O mice (by 70 and 50% in visceral and inguinal fat, respectively; P < 0.05 or less). Eventually, leptin treatment partially restored ApN secretion in visceral fat (65% increase compared with O values), whereas calorie restriction was without effect.

Because TNF-{alpha} is involved in obesity-related insulin resistance and is known to downregulate ApN secretion (17, 36), we examined whether the correction of circulating ApN levels brought about by leptin was explained by changes in TNF-{alpha}. TNF-{alpha} mRNA levels were measured in visceral and inguinal fat of the four groups of mice (Table 2). In lean mice, TNF-{alpha} mRNA levels were expressed more in visceral than in inguinal fat. Compared with L mice, the TNF-{alpha} gene was overexpressed in inguinal fat of O mice (4.5-fold). However, leptin treatment or calorie restriction did not modify TNF-{alpha} mRNA abundance (whether expressed per 18S rRNA or mg tissue) in any depots at any time [data not shown (day 3) and Table 2 (day 6)].


View this table:
[in this window]
[in a new window]
 
Table 2. Effects of leptin treatment on TNF-{alpha} and resistin mRNAs in visceral and inguinal fat and on plasma resistin levels in ob/ob mice

 
To assess whether leptin directly affected ApN gene expression, this adipocytokine was added to the culture medium of fully differentiated 3T3-F442A adipocytes for 6 days. After 24 h of culture, leptin increased ApN gene expression and secretion by 200 and 50%, respectively (Fig. 4).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. Stimulatory effect of leptin on ApN gene expression and secretion from 3T3-F442A adipocytes. Fully differentiated cells were cultured without ({square}, control medium) or with 10 nM leptin ({bullet}) for 6 days. Left: ApN gene expression was measured by real-time PCR. ApN mRNA levels normalized to cyclophilin mRNA levels were expressed as % of respective control conditions. Right: ApN secreted in medium after 24 h of culture was measured by RIA and expressed as % of control values (84.2 ± 1.7 ng/ml). Results are means ± SE for 3 (left) or 6 (right) independent experiments. *P < 0.05, +P = 0.06 for effect of leptin.

 
Besides ApN, we examined whether leptin treatment of obese mice could also influence resistin, another adipocytokine, which is believed to play a role in the pathogenesis of the obese insulin-resistant syndrome (Table 2). In lean mice, resistin mRNA levels exhibited a depot-specific pattern of expression similar to that of ApN and TNF-{alpha}. As reported (32, 39, 51), resistin mRNA levels were decreased in visceral fat of O mice. Leptin treatment for 6 days markedly suppressed resistin gene expression in both depots of ob/ob mice (60–70% compared with O values), whereas mere calorie restriction induced a smaller decrease (~25%) in the visceral depot only (Table 2). Differences between all groups were amplified further when data were expressed per milligram of adipose tissue (not shown). The effect of leptin on resistin mRNA levels was not detected at day 3 (not shown). As expected for a cytokine inducing insulin resistance, plasma resistin levels were ~25% higher in O mice than in L mice. Leptin treatment for 6 days tended to slightly decrease plasma resistin levels (11% compared with O values; P = 0.099), whereas pair-feeding was ineffective.


    DISCUSSION
 TOP
 ABSTRACT
 ANIMALS, MATERIALS, AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Leptin treatment, but not mere calorie restriction, reverses low circulating ApN levels in ob/ob mice, at least in part by restoring ApN concentrations and secretion in the visceral depot.

Plasma ApN levels were reduced in leptin-deficient ob/ob mice, as described in leptin-resistant db/db mutants (36, 52). Concomitantly, ApN mRNA levels were downregulated in visceral fat [Fig. 3B and as previously reported (25, 37)] but were upregulated in subcutaneous fat. However, when data were expressed per milligram of adipose tissue, ApN mRNAs dropped in both depots of ob/ob mice and were closely related to low tissue ApN content and ApN secretion. Although attenuated by enlarged fat mass, these reductions, together with other variables such as expanded circulating volume (54), could contribute to low circulating ApN levels in ob/ob mice. As far as the relative contribution of tissue ApN to systemic levels is concerned, comparisons within the different groups of obese mice may be more straightforward because more variables are controlled (fat mass, plasma volume, and the like).

In agreement with acute (48-h) fasting (19, 55), calorie restriction imposed on ob/ob mice for 6 days did not alter circulating ApN levels. By contrast, chronic dietary restriction for 4–8 mo resulted in elevated plasma ApN in normal mice (2) and obese humans (53).

Unlike mere calorie restriction, leptin treatment for 6 days strikingly increased plasma ApN levels of ob/ob mice. This was accompanied by a partial restoration of tissue ApN concentrations and secretion that occurred in a depot-specific manner, as reported for thiazolidinediones (10). This restoration was preceded by a rise in ApN mRNA levels. Although the increases in adipose tissue ApN mRNA, content, and secretion were substantial (~50–80% of untreated O or PF values), these changes (per g tissue) may appear relatively small compared with values of L mice. However, they could be involved in the correction of plasma ApN, as obese T mice still preserved a large excess of ApN-producing white fat mass (see Table 1). The rise in ApN mRNA triggered by leptin was transient: detected at day 3, but no longer at day 6 of treatment. One may raise the possibility that the (over)correction of plasma ApN observed in T mice had exerted a negative feedback on its own mRNA levels at day 6. Alternatively, pulsatile, rather than continuous, administration of leptin (7) could be required to produce a sustained rise in the mRNA levels. As in humans (19), in our mice, acute leptin treatment (≤48 h) did not affect plasma ApN levels. Yet, changes in ApN mRNA levels may already have occurred, as shown in our study.

Several mechanisms could theoretically contribute to leptin-induced stimulation of ApN mRNA levels. First, reduced fat mass per se could contribute. Fat mass exerts a negative feedback on its own ApN production (22). However, only T, but not PF, mice exhibited a rise in ApN levels despite similar body weight loss. Moreover, the effect of leptin occurred specifically in the visceral-retrovesical depot, whose weight did not change. Second, enhanced insulin sensitivity could be involved. Several pieces of evidence suggest that, besides being a potential effect (2, 52), increased insulin action could also be a causative factor of elevated plasma ApN (14). However, plasma ApN levels were unchanged in PF mice (this study) or in type 2 diabetic mice receiving metformin (10) despite improved glucose homeostasis. Third, changes in TNF-{alpha} might play a role. TNF-{alpha} has been found to inhibit ApN mRNA and secretion (17, 36), but this mechanism may also be excluded. Unlike thiazolidinediones (36), leptin did not suppress TNF-{alpha} mRNA in any adipose depots of obese mice. Fourth, enhanced sympathetic tone could be a potential factor. Many effects of leptin on adipocyte gene expression are centrally mediated through stimulation of the adrenergic sympathetic pathway (11, 12). Although acute exposure to {beta}-adrenergic agonists decreased ApN mRNA levels (15, 16), longer treatment of rats (6 days) increased ApN mRNAs while exerting its expected regulation on other fat genes (55). Moreover, ApN mRNAs were decreased in denervated fat pads of rats (our unpublished data). Fifth, reversal of hypercorticosteronemia might play a part. Leptin, but not mere calorie restriction, suppresses the release of glucocorticoids (this study, and Refs. 4 and 47). Dexamethasone has been found to downregulate ApN mRNA in vitro (17, 22). Conversely, adrenalectomy increased ApN mRNA and plasma ApN in ob/ob mice (37). Thus indirect sympathetic or hormonal changes, such as attenuation of hypercorticosteronemia, may contribute to raise ApN mRNA in leptin-treated ob/ob mice. Additional mechanisms may also participate. Sixth, a direct action of leptin on adipocytes and ApN gene expression is likely to be involved. Convincing evidence that leptin acts directly on peripheral targets, including adipocytes, where it may modulate the expression of several genes, has been provided. Leptin induced gene expression of the angiogenic factor (angiopoietin-2), peroxisome proliferator-activated receptor-{alpha}, and enzymes involved in energy dissipation in cultured adipocytes (6, 8, 50). Such a direct action of leptin is further supported by our in vitro experiments in 3T3-F442A adipocytes. Thus leptin added to the medium increased ApN mRNA and secretion after 24 h of culture. Conversely, it has been recently reported that adipocyte-selective reduction of leptin receptors by antisense RNA resulted in diminished ApN gene expression (26).

Besides quantitative changes in ApN levels, qualitative changes may also occur in our obese mice. The distribution of circulating oligomeric complexes of ApN may be altered in obesity, resulting in impaired protein activity. This altered distribution has been corrected after weight loss in obese patients or thiazolidinedione treatment in db/db mice (30, 42). Further work will be necessary to assess whether such a correction also takes place in our study and could participate in the improved insulin sensitivity of PF or T mice.

Although leptin markedly increased absolute levels of plasma ApN, it did not decrease, or only marginally decreased, circulating resistin levels. Despite halved mRNA levels in one fat depot, plasma levels of resistin were elevated in ob/ob mice. This may result from enlarged resistin-producing adipose tissue mass (49) and additional resistin production by nonadipose tissue (mainly white blood and mononuclear cells, splenocytes, and pituitary gland) (35, 39, 40). Resistin is indeed involved in insulin resistance and in other inflammatory processes (35). Unlike acute fasting (29, 48), calorie restriction for 6 days barely affected resistin parameters. In contrast, leptin treatment for the same period blunted resistin mRNA levels in both depots of obese mice. Accordingly, plasma resistin levels tended to be slightly decreased in leptin-treated mice. In humans, acute administration of leptin did not alter plasma resistin (33). In our study, the decrease of circulating resistin, if any, was tiny compared with the drop in mRNA levels. This could be explained by the contribution of nonadipose tissues to systemic resistin levels and/or by compensatory mechanisms acting at a step distal to the mRNA in adipose tissue of obese T mice. Both processes could ultimately limit the profound negative effect of leptin on resistin mRNA in fat tissues.

The decrease in plasma adiponectin associated with obesity suggests that an obesity-related factor or process participates in the downregulation of ApN synthesis. Our study proposes that leptin deficiency or resistance to its action (as seen in the common forms of human obesity) may contribute. On the other hand, our work underscores the potential confounding role of ApN during leptin treatment. Because leptin and ApN share several metabolic properties (enhanced insulin sensitivity, fatty acid oxidation, thermogenesis, and weight loss), some of the effects classically attributed to leptin may be indirectly mediated or amplified by a rise in ApN levels. The slight decrease in resistin levels could enhance insulin sensitivity further.

Conclusions.

Leptin treatment, but not mere calorie restriction, corrects plasma ApN in obese mice by restoring adipose tissue ApN concentrations and secretion, at least in part via a direct stimulation of ApN gene expression. Such a treatment only minimally affects circulating resistin. ApN restoration could, in concert with leptin, contribute to the metabolic effects classically observed during leptin administration.


    GRANTS
 TOP
 ABSTRACT
 ANIMALS, MATERIALS, AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by grants from the Foundation of Scientific and Medical Research (3.4592.99), the Fonds National de la Recherche Scientifique (1.5.176.01 [EC] ), and the Fund for Scientific Development (University of Louvain). M.-L. Delporte is supported by a fellowship from the Fonds pour la Recherche dans l’Industrie et l’Agriculture.


    ACKNOWLEDGMENTS
 
We thank Dr. T. Funahashi (Osaka University) for the adiponectin antibody, and Dr. H. R. Lijnen and Dr. E. Maquoi for the 3T3-F442A cells. We are also grateful to P. De Nayer and Dr. J. P. Desager for corticosterone and lipid measurements, to Dr. J. C. Jonas for real-time PCR facilities and advice, and to A. M. Pottier for skillful assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. M. Brichard, Unité d'Endocrinologie et Métabolisme, UCL/ENDO 5530, Av. Hippocrate, 55, B-1200 Brussels, Belgium (E-mail: brichard{at}endo.ucl.ac.be).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 ANIMALS, MATERIALS, AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, Hotta K, Shimomura I, Nakamura T, Miyaoka K, Kuriyama H, Nishida M, Yamashita S, Okubo K, Matsubara K, Muraguchi M, Ohmoto Y, Funahashi T, and Matsuzawa Y. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun 257: 79–83, 1999.
  2. Berg AH, Combs TP, Du X, Brownlee M, and Scherer PE. The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med 7: 947–953, 2001.
  3. Berg AH, Combs TP, and Scherer PE. ACRP30/adiponectin: an adipokine regulating glucose and lipid metabolism. Trends Endocrinol Metab 13: 84–89, 2002.
  4. Bornstein SR, Uhlmann K, Haidan A, Ehrhart-Bornstein M, and Scherbaum WA. Evidence for a novel peripheral action of leptin as a metabolic signal to the adrenal gland: leptin inhibits cortisol release directly. Diabetes 46: 1235–1238, 1997.
  5. Brichard SM, Ongemba LN, Kolanowski J, and Henquin JC. The influence of vanadate on insulin counter-regulatory hormones in obese fa/fa rats. J Endocrinol 131: 185–191, 1991.
  6. Ceddia RB, William WN Jr, Lima FB, Flandin P, Curi R, and Giacobino JP. Leptin stimulates uncoupling protein-2 mRNA expression and Krebs cycle activity and inhibits lipid synthesis in isolated rat white adipocytes. Eur J Biochem 267: 5952–5958, 2000.
  7. Chan JL, Heist K, DePaoli AM, Veldhuis JD, and Mantzoros CS. The role of falling leptin levels in the neuroendocrine and metabolic adaptation to short-term starvation in healthy men. J Clin Invest 111: 1409–1421, 2003.
  8. Cohen B, Barkan D, Levy Y, Goldberg I, Fridman E, Kopolovic J, and Rubinstein M. Leptin induces angiopoietin-2 expression in adipose tissues. J Biol Chem 276: 7697–7700, 2001.
  9. Colombo C, Cutson JJ, Yamauchi T, Vinson C, Kadowaki T, Gavrilova O, and Reitman ML. Transplantation of adipose tissue lacking leptin is unable to reverse the metabolic abnormalities associated with lipoatrophy. Diabetes 51: 2727–2733, 2002.
  10. Combs TP, Wagner JA, Berger J, Doebber T, Wang WJ, Zhang BB, Tanen M, Berg AH, O'Rahilly S, Savage DB, Chatterjee K, Weiss S, Larson PJ, Gottesdiener KM, Gertz BJ, Charron MJ, Scherer PE, and Moller DE. Induction of adipocyte complement-related protein of 30 kilodaltons by PPARgamma agonists: a potential mechanism of insulin sensitization. Endocrinology 143: 998–1007, 2002.
  11. Commins SP, Watson PM, Levin N, Beiler RJ, and Gettys TW. Central leptin regulates the UCP1 and ob genes in brown and white adipose tissue via different beta-adrenoceptor subtypes. J Biol Chem 275: 33059–33067, 2000.
  12. Cusin I, Zakrzewska KE, Boss O, Muzzin P, Giacobino JP, Ricquier D, Jeanrenaud B, and Rohner-Jeanrenaud F. Chronic central leptin infusion enhances insulin-stimulated glucose metabolism and favors the expression of uncoupling proteins. Diabetes 47: 1014–1019, 1998.
  13. Dehoux MJ, van Beneden RP, Fernandez-Celemin L, Lause PL, and Thissen JP. Induction of MafBx and Murf ubiquitin ligase mRNAs in rat skeletal muscle after LPS injection. FEBS Lett 544: 214–217, 2003.
  14. Delporte ML, Brichard SM, Hermans MP, Beguin C, and Lambert M. Hyperadiponectinaemia in anorexia nervosa. Clin Endocrinol (Oxf) 58: 22–29, 2003.
  15. Delporte ML, Funahashi T, Takahashi M, Matsuzawa Y, and Brichard SM. Pre- and post-translational negative effect of beta-adrenoceptor agonists on adiponectin secretion: in vitro and in vivo studies. Biochem J 367: 677–685, 2002.
  16. Fasshauer M, Klein J, Neumann S, Eszlinger M, and Paschke R. Adiponectin gene expression is inhibited by beta-adrenergic stimulation via protein kinase A in 3T3-L1 adipocytes. FEBS Lett 507: 142–146, 2001.
  17. Fasshauer M, Klein J, Neumann S, Eszlinger M, and Paschke R. Hormonal regulation of adiponectin gene expression in 3T3-L1 adipocytes. Biochem Biophys Res Commun 290: 1084–1089, 2002.
  18. Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, Bihain BE, and Lodish HF. Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci USA 98: 2005–2010, 2001.
  19. Gavrila A, Chan JL, Yiannakouris N, Kontogianni M, Miller LC, Orlova C, and Mantzoros CS. Serum adiponectin levels are inversely associated with overall and central fat distribution but are not directly regulated by acute fasting or leptin administration in humans: cross-sectional and interventional studies. J Clin Endocrinol Metab 88: 4823–4831, 2003.
  20. Guerre-Millo M. Adipose tissue hormones. J Endocrinol Invest 25: 855–861, 2002.
  21. Halleux CM, Servais I, Reul BA, Detry R, and Brichard SM. Multihormonal control of ob gene expression and leptin secretion from cultured human visceral adipose tissue: increased responsiveness to glucocorticoids in obesity. J Clin Endocrinol Metab 83: 902–910, 1998.
  22. Halleux CM, Takahashi M, Delporte ML, Detry R, Funahashi T, Matsuzawa Y, and Brichard SM. Secretion of adiponectin and regulation of apM1 gene expression in human visceral adipose tissue. Biochem Biophys Res Commun 288: 1102–1107, 2001.
  23. Harris RB, Zhou J, Redmann SM Jr, Smagin GN, Smith SR, Rodgers E, and Zachwieja JJ. A leptin dose-response study in obese (ob/ob) and lean (+/?) mice. Endocrinology 139: 8–19, 1998.
  24. Havel PJ. Control of energy homeostasis and insulin action by adipocyte hormones: leptin, acylation stimulating protein, and adiponectin. Curr Opin Lipidol 13: 51–59, 2002.
  25. Hu E, Liang P, and Spiegelman BM. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 271: 10697–10703, 1996.
  26. Huan JN, Li J, Han Y, Chen K, Wu N, and Zhao AZ. Adipocyte-selective reduction of the leptin receptors induced by antisense-RNA leads to increased adiposity, dyslipidemia and insulin resistance. J Biol Chem 278: 45638–45650, 2003.
  27. Jequier E. Leptin signaling, adiposity, and energy balance. Ann NY Acad Sci 967: 379–388, 2002.
  28. Kahn BB and Flier JS. Obesity and insulin resistance. J Clin Invest 106: 473–481, 2000.
  29. Kim KH, Lee K, Moon YS, and Sul HS. A cysteine-rich adipose tissue-specific secretory factor inhibits adipocyte differentiation. J Biol Chem 276: 11252–11256, 2001.
  30. Kobayashi H, Ouchi N, Kihara S, Walsh K, Kumada M, Abe Y, Funahashi T, and Matsuzawa Y. Selective suppression of endothelial cell apoptosis by the high molecular weight form of adiponectin. Circ Res 94: E27–E31, 2004.
  31. Kubota N, Terauchi Y, Yamauchi T, Kubota T, Moroi M, Matsui J, Eto K, Yamashita T, Kamon J, Satoh H, Yano W, Froguel P, Nagai R, Kimura S, Kadowaki T, and Noda T. Disruption of adiponectin causes insulin resistance and neointimal formation. J Biol Chem 277: 25863–25866, 2002.
  32. Le Lay S, Boucher J, Rey A, Castan-Laurell I, Krief S, Ferre P, Valet P, and Dugail I. Decreased resistin expression in mice with different sensitivities to a high-fat diet. Biochem Biophys Res Commun 289: 564–567, 2001.
  33. Lee JH, Chan JL, Yiannakouris N, Kontogianni M, Estrada E, Seip R, Orlova C, and Mantzoros CS. Circulating resistin levels are not associated with obesity or insulin resistance in humans and are not regulated by fasting or leptin administration: cross-sectional and interventional studies in normal, insulin-resistant, and diabetic subjects. J Clin Endocrinol Metab 88: 4848–4856, 2003.
  34. Levin N, Nelson C, Gurney A, Vandlen R, and de Sauvage F. Decreased food intake does not completely account for adiposity reduction after ob protein infusion. Proc Natl Acad Sci USA 93: 1726–1730, 1996.
  35. Lu SC, Shieh WY, Chen CY, Hsu SC, and Chen HL. Lipopolysaccharide increases resistin gene expression in vivo and in vitro. FEBS Lett 530: 158–162, 2002.
  36. Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K, Nagaretani H, Matsuda M, Komuro R, Ouchi N, Kuriyama H, Hotta K, Nakamura T, Shimomura I, and Matsuzawa Y. PPARgamma ligands increase expression and plasma concentrations of adiponectin, an adipose-derived protein. Diabetes 50: 2094–2099, 2001.
  37. Makimura H, Mizuno TM, Bergen H, and Mobbs CV. Adiponectin is stimulated by adrenalectomy in ob/ob mice and is highly correlated with resistin mRNA. Am J Physiol Endocrinol Metab 283: E1266–E1271, 2002.
  38. Maquoi E, Munaut C, Colige A, Collen D, and Lijnen HR. Modulation of adipose tissue expression of murine matrix metalloproteinases and their tissue inhibitors with obesity. Diabetes 51: 1093–1101, 2002.
  39. Milan G, Granzotto M, Scarda A, Calcagno A, Pagano C, Federspil G, and Vettor R. Resistin and adiponectin expression in visceral fat of obese rats: effect of weight loss. Obes Res 10: 1095–1103, 2002.
  40. Morash BA, Willkinson D, Ur E, and Wilkinson M. Resistin expression and regulation in mouse pituitary. FEBS Lett 526: 26–30, 2002.
  41. Ouchi N, Kihara S, Arita Y, Maeda K, Kuriyama H, Okamoto Y, Hotta K, Nishida M, Takahashi M, Nakamura T, Yamashita S, Funahashi T, and Matsuzawa Y. Novel modulator for endothelial adhesion molecules: adipocyte-derived plasma protein adiponectin. Circulation 100: 2473–2476, 1999.
  42. Pajvani UB, Hawkins M, Combs TP, Rajala MW, Doebber T, Berger JP, Wagner JA, Wu M, Knopps A, Xiang AH, Utzschneider KM, Kahn SE, Olefsky JM, Buchanan TA, and Scherer PE. Complex distribution, not absolute amount of adiponectin, correlates with thiazolidinedione-mediated improvement in insulin sensitivity. J Biol Chem 279: 12152–12162, 2004.
  43. Pampfer S, Vanderheyden I, Wuu YD, Baufays L, Maillet O, and De Hertogh R. Possible role for TNF-alpha in early embryopathy associated with maternal diabetes in the rat. Diabetes 44: 531–536, 1995.
  44. Reul BA, Becker DJ, Ongemba LN, Bailey CJ, Henquin JC, and Brichard SM. Improvement of glucose homeostasis and hepatic insulin resistance in ob/ob mice given oral molybdate. J Endocrinol 155: 55–64, 1997.
  45. Scarpace PJ and Matheny M. Leptin induction of UCP1 gene expression is dependent on sympathetic innervation. Am J Physiol Endocrinol Metab 275: E259–E264, 1998.
  46. Shimomura I, Hammer RE, Ikemoto S, Brown MS, and Goldstein JL. Leptin reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature 401: 73–76, 1999.
  47. Stephens TW, Basinski M, Bristow PK, Bue-Valleskey JM, Burgett SG, Craft L, Hale J, Hoffmann J, Hsiung HM, and Kriauciunas A. The role of neuropeptide Y in the antiobesity action of the obese gene product. Nature 377: 530–532, 1995.
  48. Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR, Wright CM, Patel HR, Ahima RS, and Lazar MA. The hormone resistin links obesity to diabetes. Nature 409: 307–312, 2001.
  49. Steppan CM and Lazar MA. Resistin and obesity-associated insulin resistance. Trends Endocrinol Metab 13: 18–23, 2002.
  50. Wang MY, Lee Y, and Unger RH. Novel form of lipolysis induced by leptin. J Biol Chem 274: 17541–17544, 1999.
  51. Way JM, Gorgun CZ, Tong Q, Uysal KT, Brown KK, Harrington WW, Oliver WR Jr, Willson TM, Kliewer SA, and Hotamisligil GS. Adipose tissue resistin expression is severely suppressed in obesity and stimulated by peroxisome proliferator-activated receptor gamma agonists. J Biol Chem 276: 25651–25653, 2001.
  52. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T, Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel P, and Kadowaki T. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 7: 941–946, 2001.
  53. Yang WS, Lee WJ, Funahashi T, Tanaka S, Matsuzawa Y, Chao CL, Chen CL, Tai TY, and Chuang LM. Weight reduction increases plasma levels of an adipose-derived anti-inflammatory protein, adiponectin. J Clin Endocrinol Metab 86: 3815–3819, 2001.
  54. Yen TTT, Stienmetz J, and Simpson PJ. Blood volume of obese (ob/ob) and diabetic (db/db) mice. Proc Soc Exp Biol Med 133: 307–308, 1970.
  55. Zhang Y, Matheny M, Zolotukhin S, Tumer N, and Scarpace PJ. Regulation of adiponectin and leptin gene expression in white and brown adipose tissues: influence of beta3-adrenergic agonists, retinoic acid, leptin and fasting. Biochim Biophys Acta 1584: 115–122, 2002.



This article has been cited by other articles:


Home page
J. Nutr.Home page
R. S. Bruno, C. E. Dugan, J. A. Smyth, D. A. DiNatale, and S. I. Koo
Green Tea Extract Protects Leptin-Deficient, Spontaneously Obese Mice from Hepatic Steatosis and Injury
J. Nutr., February 1, 2008; 138(2): 323 - 331.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. A. Wendel, A. Purushotham, L.-F. Liu, and M. A. Belury
Conjugated linoleic acid fails to worsen insulin resistance but induces hepatic steatosis in the presence of leptin in ob/ob mice
J. Lipid Res., January 1, 2008; 49(1): 98 - 106.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Itoh, T. Suganami, N. Satoh, K. Tanimoto-Koyama, X. Yuan, M. Tanaka, H. Kawano, T. Yano, S. Aoe, M. Takeya, et al.
Increased Adiponectin Secretion by Highly Purified Eicosapentaenoic Acid in Rodent Models of Obesity and Human Obese Subjects
Arterioscler. Thromb. Vasc. Biol., September 1, 2007; 27(9): 1918 - 1925.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. D. Javor, E. K. Cochran, C. Musso, J. R. Young, A. M. DePaoli, and P. Gorden
Long-Term Efficacy of Leptin Replacement in Patients With Generalized Lipodystrophy
Diabetes, July 1, 2005; 54(7): 1994 - 2002.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
E. Lord, S. Ledoux, B. D. Murphy, D. Beaudry, and M. F. Palin
Expression of adiponectin and its receptors in swine
J Anim Sci, March 1, 2005; 83(3): 565 - 578.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/3/E446    most recent
00488.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delporte, M.-L.
Right arrow Articles by Brichard, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delporte, M.-L.
Right arrow Articles by Brichard, S. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.