AJP - Endo Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Endocrinol Metab 286: E896-E901, 2004. First published January 13, 2004; doi:10.1152/ajpendo.00327.2003
0193-1849/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/E896    most recent
00327.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chisalita, S. I.
Right arrow Articles by Arnqvist, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chisalita, S. I.
Right arrow Articles by Arnqvist, H. J.

Insulin-like growth factor I receptors are more abundant than insulin receptors in human micro- and macrovascular endothelial cells

Simona I. Chisalita1 and Hans J. Arnqvist1,2

1Division of Cell Biology, Department of Biomedicine and Surgery, and 2Division of Internal Medicine, Department of Medicine and Care, Faculty of Health Sciences, Linköping University, S-581 85 Linkoping, Sweden

Submitted 15 July 2003 ; accepted in final form 5 January 2004


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Micro- and macroangiopathy are major causes of morbidity and mortality in patients with diabetes. Our aim was to characterize IGF-I receptor (IGF-IR) and insulin receptor (IR) in human micro- and macrovascular endothelial cells. Cultured human dermal microvascular endothelial cells (HMVEC) and human aortic endothelial cells (HAEC) were used. Gene expression was measured by quantitative real-time RT-PCR and receptor protein by ligand-binding assay. Phosphorylation of IGF-IR {beta}-subunit was analyzed by immunoprecipitation and Western blot. Glucose metabolism and DNA synthesis was assessed using [3H]glucose and [3H]thymidine incorporation, respectively. We detected gene expression of IGF-IR and IR in HAEC and HMVEC. IGF-IR gene expression was severalfold higher than that of IR. The specific binding of 125I-IGF-I was higher than that of 125I-insulin in HAEC and HMVEC. Insulin and the new, long-acting insulin analog glargine interacted with the IGF-IR with thousand- and hundred-fold less potency than IGF-I itself. Phosphorylation of the IGF-IR {beta}-subunit was shown in HAEC for IGF-I (10–8 M) and insulin (10–6 M) and in HMVEC for IGF-I and glargine (10–8 M, 10–6 M). IGF-I 10–7 M stimulated incorporation of [3H]thymidine into DNA, and 10–9–10–7 M also the incorporation of [3H]glucose in HMVEC, whereas glargine and insulin had no significant effects at 10–9–10–7 M. Human micro- and macrovascular endothelial cells express more IGF-IR than IR. IGF-I and high concentrations of glargine and insulin activates the IGF-IR. Glargine has a higher affinity than insulin for the IGF-IR but probably has no effect on DNA synthesis at concentrations reached in vivo.

human endothelial cells; receptor; insulin; glargine

IN PATIENTS WITH DIABETES MELLITUS, micro- and macroangiopathy are major causes of morbidity and mortality (17, 41). Situated at the interface between the blood stream and the vessel wall, the vascular endothelium has a unique position, being involved in regulation of metabolic, hemostatic, and immunologic processes (9). Endothelial dysfunction is considered to play an important role in pathogenesis of diabetic micro- and macroangiopathy, as well as in atherosclerosis (6, 34, 40).

The insulin receptor (IR) and the insulin-like growth factor I receptor (IGF-IR) are homologs sharing >50% of their amino acid sequence, and they have 84% homology in the {beta}-subunit tyrosine kinase domains (42, 43). Binding of insulin and IGF-I to the extracellular {alpha}-subunits and autophosphorylation of the {beta}-subunit are the first steps in the activation of IR and IGF-IR (32). This is followed by activation of a complex cascade of signaling pathways through which metabolic and growth effects are initiated (10, 36). At high concentrations, insulin and IGF-I can cross-react with each other's receptors (31). In tissues coexpressing IR and IGF-IR, hybrid receptors composed of an IR {alpha}{beta}-heterodimer and an IGF-IR {alpha}{beta}-heterodimer have been reported (26, 30). If IR and/or IGF-IR are expressed in human endothelium, a direct effect of insulin and/or IGF-I could have a critical impact on vascular function.

There are few studies regarding IGF-IR and IR in human endothelial cells. In rat and bovine micro- and macrovascular endothelial cells, both IR and IGF-IR have been shown (19, 21, 22). Specific binding of IGF-I and insulin has been demonstrated in human umbilical vein endothelial cells (4, 5, 45). In kidney (29) and retinal endothelial cells (39), IGF-IR have been reported. There is a lack of studies regarding effects of insulin and IGF-I on glucose metabolism and DNA synthesis in human endothelial cells. An effect of IGF-I on [3H]thymidine incorporation into DNA has been reported in human retinal endothelial cells (14). The aim of our study was to characterize IR and IGF-IR in human micro- and macrovascular endothelial cells with regard to gene expression, ligand binding, receptor activation, and the biological effect of insulin, glargine, and IGF-I. We used human dermal microvascular endothelial cells (HMVEC) as microvascular cells, and human aortic endothelial cells (HAEC) as macrovascular endothelial cells.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Culture of cells. HMVEC and HAEC were purchased from Clonetics (San Diego, CA) and grown according to the manufacturer's instructions. The cells were positive for von Willebrand factor VIII and acetylated LDL and negative for smooth muscle {alpha}-actin (Clonetics). In addition to the above staining, HMVEC also tested positive for platelet endothelial cell adhesion molecule. All experiments were performed in triplicate with cells in passages 5–8 in confluent cultures. All experiments were performed three to five times as mentioned in the figure legends.

Quantitative real-time RT-PCR. RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany). From 1 µg of RNA, first-strand complementary DNA (cDNA) was transcribed using a commercial kit (Invitrogen Life Technologies, Stockholm, Sweden). The expression of IR and IGF-IR was estimated by real-time quantitative PCR action assay using the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems, Stockholm, Sweden). The oligonucleotides were purchased from SGS (Scandinavian Gene Synthesis, Koping, Sweden). For human IR (hIR), we used as forward primer 5'-AGGAGCCCAATGGTCTGA-3', as reverse primer 5'-GAGACGCAGAGATGCAGC-3', and as probe 5-(FAM) ACCATATCGCCGATAACTCACTTCATACAGT (TAMRA)-3'. For human IGF-IR (hIGF-IR), we used as forward primer 5'-CGATGTGTGAGAAGACCACCA-3', as reverse primer 5'-ACATTTTCTGGCAGCGGTTT, and as probe 5'-(FAM) CAATGAGTACAACTACCGCTGCTGGACCAT (TAMRA)-3'. The primers and probe for the GAPDH gene were obtained from PE Applied Biosystems, with the sequence for forward primer 5'-GAAGGTGGAGGTCGGAGTC-3', for reverse primer 5'-GAAGATGGTGATGGGATTTC, and probe 5'-(VIC) CAAGCTTCCCGTTCTCAGCC (TAMRA)-3'.

The real-time RT-PCR reaction was run in the 7700 Prism Sequence Detector System. A final volume of 25 µl contained 12 µl of TaqMan Universal PCR Master Mix (PE Applied Biosystems), 3 µl of cDNA of reverse-transcribed RNA, 300 nM primers, a 25 nM probe for hIR, and a 50 nM probe for hIGF-IR, respectively. After 2 min at 50°C and 10 min at 95C, the reaction ran for 40 cycles consisting of a denaturation or melting step at 95C for 15 s followed by an annealing/extension step at 60C for 1 min. The detection of the PCR products was allowed through the combination of 5'-3' nuclease activity of AmpliTaq Gold DNA Polymerase ROX by the release of a fluorescent reporter FAM for hIR and hIGF-IR, respectively, and VIC for GAPDH probe oligonucleotides during the RT-PCR reaction. The fluorescence was measured at each cycle. The data were analyzed using Sequence Detector version 1.7 (PE Applied Biosystems). The relative amount of transcripts, measured during the exponential phase of reaction, was determined by the comparative CT methods (Bulletin 2, PE Applied Biosystems).

Binding studies. A total of 40,000 of either HMVEC or HAEC were seeded and cultured in six-well plates (Clonetics). Confluent cells were incubated for 4 h at 4°C in HEPES binding buffer [pH 7. 8 with the following composition (in mmol/l): 100 HEPES, 120 NaCl, 5 KCl, 1.2 MgS04, and 8 glucose and 0.1% bovine serum albumin] with the addition of 25,000 cpm 125I-IGF-I (5.7 x 10–l2 M) or mono-125I- (Tyr A14)-human insulin (5.7 x 10–l2 M; Amersham Pharmacia Biotechnology, Buckinghamshire, UK), and unlabeled polypeptides at indicated concentration. The cells were washed three times with ice-cold PBS and then solubilized in 0.1% SDS. The radioactivity was measured in a gamma counter (LKB Wallac, Turku, Finland). Nonspecific binding of 125I-insulin or 125I-IGF-I was defined as binding in the presence of 10–5 M unlabeled insulin or 10–6 M IGF-I, respectively, and was subtracted from total binding to yield specific binding. To calculate EC50 values for insulin and glargine, it was assumed that, at a concentration of 10–4 M, 125I-IGF-I was fully displaced by these two polypeptides. Data were analyzed using the Prism program (GraphPad Software, San Diego, CA). To estimate EC50 values, the ligand-binding data for 125I-IGF-I and 125I-insulin were fit to a one-site competition equation and a two-site competition equation by use of a Marquardt-Levenberg nonlinear least squares algorithm.

Immunoprecipitation of the IGF-IR and IR. To determine the tyrosine phosphorylation state of IGF-IR and IR {beta}-subunit, subconfluent HMVEC and HAEC cells were cultured in 75-cm2 flasks. They were serum starved for 24 h before the experiments, and two flasks were used per experimental condition. The cells were then washed in cold F-12-BSA medium (1 mg BSA/ml F-12) and incubated for 30 min on ice with 50 µM Na3VO4 solution diluted in F-12-BSA medium. The cultures were incubated in warm (37°C) F-12-BSA medium (1 mg BSA/ml F-12) at 37C for 10 min with IGF-I, insulin, or glargine added as indicated in Fig. 4. After the incubation, the cells were lysed for 30 min on ice with a lysis buffer [containing 20 mM Tris (pH 7.5), 150 mM NaCl, 5 mM EDTA, 0.5% sodium deoxycholate, 0.5% Triton X-100, 1 mM Na3VO4, 1.5 µg/ml aprotinin, 1.5 µg/ml leupeptin, and 1 mM PMSF]. Cell lysates were centrifuged at 4C for 15 min at 20,000 g. The supernatant was transferred into new tubes and stored at –70C. Total protein content was measured by the bicinchoninic acid method (Pierce, Rockford, IL) to adjust the amount of protein used for subsequent analysis. To immunoprecipitate the IGF-IR or IR, we incubated cell lysates that contained 0.5–1 mg of total proteins with 2.5 µl of anti-IGF-I {beta}-subunit receptor antibody, rabbit polyclonal IgG (C-20), or anti-IR {beta}-subunit receptor antibody, rabbit polyclonal IgG (C-19), respectively (Santa Cruz Biotechnology), and 50 µl of protein A-Sepharose (Pharmacia-Upjohn, Uppsala, Sweden) were added and samples shaken gently at 4°C overnight. The immunoprecipitates were washed three times with ice-cold lysis buffer and diluted in 50 µl of 2x Laemmli sample buffer (0.125 M Trisma base, 4% SDS, 10% glycerol, 0.02% bromphenol, 4% {beta}-mercaptoethanol, pH 6.8).



View larger version (62K):
[in this window]
[in a new window]
  		Fig. 4. Tyrosine phosphorylation of IGF-IR {beta}-subunit in HMVEC and HAEC. Imunoprecipitation and Western blot analysis of IGF-I {beta}-subunit and tyrosine phosphorylation of IGF-I {beta}-subunit after exposure of near-confluent cells HMVEC (A and B) and HAEC (C) to IGF-I (10–8 M, 10–6 M), insulin (10–8 M, 10–6 M), or glargine (10–8 M, 10–6 M) for 10 s. Top: immunoblot with phosphotyrosine antibody PY20. Bottom: immunoblot with anti-IGF-I {beta}-subunit receptor antibody. Representative blots are shown from experiments repeated independently 3 times.

 
Western blot analysis. Immunoprecipited samples were boiled for 2 min. After centrifugation, proteins in the supernatant were separated on a 7.5% SDS-PAGE gel. The separated proteins were electrotransferred onto a polyvinylidene difluoride membrane and blocked overnight with blocking buffer (0.1% Tween 20, TBS). The membrane was immunoblotted using 1:1,000 dilution of the anti-phosphotyrosine antibody (PY20) (Santa Cruz Biotechnology) for 2 h at room temperature. The proteins were visualized using a specific secondary horseradish peroxidase-linked anti-mouse monoclonal IgG antibody (Amersham Life Science, Uppsala, Sweden) followed by an enhanced chemiluminescence detection system (ECL detection). Autoradiographs were obtained by exposure to a Hyperfilm ECL (Amersham Life Science).

The membranes were stripped by heating at 60C for 30 min in stripping buffer (10% SDS, 100 mM {beta}-mercaptoethanol, 62.5 mM Tris·HCl). They were blotted again with the same anti-IGF-IR antibody or anti-IR antibody as was used for immunoprecipitation, and the proteins were visualized as described above.

[3H]thymidine incorporation into DNA. DNA synthesis was quantified by measuring [3H]thymidine incorporation into DNA in HMVEC according to a modified method of Nilsson and Thyberg (27). The cells were grown in 24-wells plates, serum starved for 24 h, and then incubated with 1 µCi/ml [3H]thymidine (Amersham Pharmacia Biotechnology) with and without polypeptides at indicated concentrations. DNA was precipitated with 5% cold trichloroacetic acid and then solubilized in 0.5 ml of 0.1 mol/l KOH. Part of the solution, 0.4 ml, was added to 4 ml of scintillation solution, and the radioactivity was measured in a liquid scintillation counter (Rackbeta 1217, LKB Wallac). The data were expressed as percent increase in [3H]thymidine incorporation of control cells (100%).

[3H]glucose incorporation. Confluent HMVEC were growth in six-well plates and starved in serum-free medium for 24 h before the experiment. The cells were then incubated at 37°C for 2 h with the addition of 1 µCi/ml [3H]glucose (Amersham Pharmacia Biotechnology) and in the absence or presence of insulin, glargine, and IGF-I at indicated concentrations. Cells were rinsed three times with PBS and lysed with 0.5 ml of 0.1% SDS, and 0.4 ml of the solubilized cells was added to 4 ml of scintillation solution, and the radioactivity was measured. The data were expressed as percent increase of control cells (100%).

Statistical analysis. Values are given as means ± SE. Statistical comparisons were made with the SPSS program (SPSS, Chicago, IL) by one-way ANOVA. A P value of <0.05 was considered statistically significant.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Quantitative real-time RT-PCR. Measured by quantitative real-time PCR, gene expression of both IGF-I and IR was demonstrated in HAEC and HMVEC. The relative amount of IGF-IR to IR mRNA expression in cultured HMVEC and HAEC was about five and eight times higher, respectively (P < 0.001; Fig. 1).



View larger version (10K):
[in this window]
[in a new window]
  		Fig. 1. Gene expression of IGF-I receptor (IGF-IR) and insulin receptor (IR) in cultured human dermal microvascular endothelial cells (HMVEC) and human aortic endothelial cells (HAEC). IR and IGF-IR mRNA expression was measured by real-time RT-PCR. ***P < 0.001. Bars are means ± SE of duplicate measurements from 4 experiments.

 
Binding studies. IGF-I and IR protein was assessed by ligand binding using 125I-IGF-I and 125I-insulin (Fig. 2). In HMVEC, the specific binding of 125I-IGF-I was 1.6 ± 0.2% of total 125I-IGF-I added (Fig. 2). Tested in one-site or two-site competition equations, the 125I-IGF-I binding was found to fit a one-site binding model. The concentration needed to give half-maximal displacement (EC50) of labeled 125I-IGF-I was 5.7 x 10–10 M for unlabeled IGF-I, 2.5 x 10–8 M for the insulin analog glargine, and 2.2 x 10–7 M for insulin (Fig. 3A). Glargine and insulin did not fully displace 125I-IGF-I to the same level that IGF-I did. The specific binding of 125I-IGF-I in HAEC was 1.9 ± 0.1% of total 125I-IGF-I added (Fig. 2). EC50 was 4.3 x 10–10 M for unlabeled IGF-I, 9.9 x 10–8 M for glargine, and 5.8 x 10–6 M for insulin (Fig. 3B). The results were similar to those for HMVEC with the same order of potency, insulin < glargine < IGF-I, to displace 125I-IGF-I. Insulin was thus approximately a thousandfold less potent and glargine a hundredfold less potent than IGF-I to displace 125I-IGF-I from its receptor.



View larger version (9K):
[in this window]
[in a new window]
  		Fig. 2. Specific binding of 125I-IGF-I and 125I-insulin in HMVEC and HAEC. Near-confluent cells were incubated for 4 h at 4°C in HEPES binding buffer with 125I-labeled ligands alone (100% binding) or 125I with varying concentration of unlabeled peptides. Results are given as specific bound radioactivity in %total radioactivity added. **P < 0.01, ***P < 0.001. Bars are means ± SE of measurements from 4 experiments.

 


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 3. Displacement of 125I-IGF-I and 125I-insulin in HMVEC and HAEC by unlabeled insulin, glargine, and IGF-I. Near-confluent cells were for 4 h at 4°C in HEPES binding buffer with 125I-labeled ligands alone (100% binding) or 125I with varying concentration of unlabeled peptides. Bars are means ± SE of measurements from 4 (for HMVEC) or 5 (for HAEC) experiments. A: displacement of 125I-IGF-I in HMVEC by unlabeled insulin, glargine, and IGF-I. B: displacement of 125I-IGF-I in HAEC by unlabeled insulin, glargine, and IGF-I. C: displacement of 125I-insulin in HMVEC by unlabeled insulin, glargine, and IGF-I. D: displacement of 125I-insulin in HAEC by unlabeled insulin, glargine, and IGF-I.

 
The specific binding of 125I-insulin was 0.5 ± 0.2% in HMVEC and 0.2 ± 0.04% in HAEC (Fig. 2). The total specific binding of 125I-insulin was thus much lower than the specific binding of 125I-IGF-I for both HAEC and HMVEC (P < 0.001; Fig. 2). Even though the specific binding of 125I-insulin was very low, it was possible to calculate approximate EC50 values. The binding of 125I-insulin to HMVEC and HAEC was tested in one-site and two-site competition equations and was found to fit a two-site binding model (Fig. 3, C and D) with a high-affinity and a low-affinity site. For displacement of 125I-insulin by unlabeled insulin and glargine, the EC50 for the high-affinity site was 10–14 to 10–12 M. For IGF-I, no low-affinity site was found in either HMVEC or HAEC. A low-affinity site, 10–8 to 10–6 M, was obtained for unlabeled insulin and glargine and also for IGF-I (Fig. 3, C and D).

Immunoprecipitation and Western blot analysis. Immunoprecipitation and Western blot analysis were used to estimate the effect of IGF-I, insulin, and glargine on phosphorylation of IGF-IR {beta}-subunit (Fig. 4, A–C). Cells were exposed to IGF-I, insulin, or glargine for 10 s. In both HAEC and HMVEC, we found a band at 97 kDa, a position corresponding to IGF-IR {beta}-subunit (Fig. 4, A–C, bottom). IGF-I at 10–8 M was able to phosphorylate its own receptor in HMVEC and HAEC (Fig. 4, A and C, top). In a very high concentration (10–6 M), insulin was able to phosphorylate the IGF-IR {beta}-subunit in HAEC, whereas no clear effect was obtained at an insulin concentration of 10–8 M (Fig. 4C, top). In separate experiments using HMVEC, we obtained phosphorylation the IGF-IR {beta}-subunit by 10–6 M glargine and 10–6 M IGF-I and also a faint band by 10–8 M glargine (Fig. 4B, top). By immunoprepitation with a polyclonal anti-IR antibody in HAEC, we could demonstrate a band corresponding to the IR {beta}-subunit but no consistent phosphorylation by IGF-I or insulin (data not shown).

[3H]thymidine incorporation into DNA. DNA synthesis was determined by [3H]thymidine incorporation in HMVEC (Fig. 5). The incorporation of [3H]thymidine was stimulated by addition of IGF-I and was highly significant at 10–7 M (P < 0.002). Neither insulin nor glargine had any significant effect.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 5. Effect of insulin, glargine, and IGF-I on [3H]thymidine incorporation in HMVEC. Confluent cultured cells were incubated at 37°C for 24 h in serum-free medium in the presence of [3H]glucose and polypeptides. Bars are means ± SE of measurements from 4 experiments. **P < 0.01.

 
[3H]glucose incorporation. The effect of IGF-I, glargine, and insulin on glucose metabolism in HMVEC cells was studied as [3H]glucose incorporation into the cells (Fig. 6). IGF-I significantly stimulated glucose incorporation at concentrations of 10–7 M (P = 0.008), 10–8 M (P = 0.02), and 10–9 M (P = 0.009), whereas insulin or glargine had no significant effect.



View larger version (16K):
[in this window]
[in a new window]
  		Fig. 6. Effect of insulin, glargine, and IGF-I on [3H]glucose incorporation in HMVEC. Confluent cultured cells were incubated at 37°C for 2 h in serum-free medium in the presence of [3H]glucose and polypeptides. Bars are means ± SE of measurements from 4 experiments. *P < 0.05, **P < 0.01.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
We show here that human micro- and macrovascular endothelial cells both have predominantly IGF-IR and less IR when measured by gene expression and ligand binding. To our knowledge, there are no previous studies addressing the comparison of IGF-IR and IR mRNA gene expression in human endothelial cells. There is only one report, stating that cultured human retinal endothelial cell from diabetic and nondiabetic patients express IGF-IR mRNA (39). The results from our study show that the specific binding of 125I-IGF-I was severalfold higher than the specific binding of 125I-insulin in both HAEC and HMVEC, indicating a higher number of IGF-IR. Both human insulin and the new insulin analog glargine interacted with the IGF-IR with over thousand- and hundredfold less potency than IGF-I itself. By use of ligand binding, a high number of IGF-IR was previously reported in human glomerular endothelial cells (29). In human umbilical vein endothelial cells, which are often used as a model for studies of human endothelium because they are easily available, specific binding of insulin (4, 5) and IGF-I (45) has been reported. The number of IGF-IR was estimated to be higher than the number of IR in this type of cells (45). We found that the specific binding of IGF-I in HMVEC and HAEC fitted a one-site binding model with an affinity corresponding to the binding of IGF-I to isolated IGF-IR (23). Binding of IGF-I to IGF-binding proteins (IGFBPs) produced by endothelial cells (14) could interfere with our results. Our finding of a one-site binding model for IGF-I and the fact that IGF-I was displaced by insulin, which cannot bind to IGFBPs (37), strongly argues against binding of IGF-I to IGFBPs. The specific binding of insulin in HMVEC and HAEC fitted a two-site binding model with affinities of the binding sites corresponding to a binding of insulin to the IR and IGF-IR, respectively (8, 23).

We found that the IGF-IR {beta}-subunit was phosphorylated by both IGF-I and insulin in HAEC and HMVEC. In a previous study of HAEC treated with a high concentration of insulin (5.0 x 10–8 M) no insulin-induced IGF-IR phosphorylation was observed, whereas different concentrations of glucose and glucosamine induced a reduction in insulin-stimulated IR tyrosine phosphorylation (12). The results are difficult to interpret, because the presence of IR or IGF-IR protein in Western blot gel was not shown. IR protein and IR autophosphorylation by insulin at a low concentration in HAEC were reported by Aljada et al. (1). We were able to demonstrate the presence of IR in HAEC by Western blot but did not obtain convincing data regarding phosphorylation of IR {beta}-subunit by insulin or IGF-I (data not shown). The insulin analog glargine at concentrations of 10–8 and 10–6 M was found to phosphorylate the IGF-IR {beta}-subunit when tested in HMVEC, which shows that glargine activates the IGF-IR in these cells. That 10–8 M glargine, but not 10–8 M insulin, phosporylated the IGF-IR is in agreement with the higher affinity of glargine compared with insulin for the IGF-IR. This conclusion must be drawn with caution, because the results were not obtained in the same experiment. It has been shown previously as well as in this study that insulin can phosphorylate the IGF-IR (18). To our knowledge, the effect of glargine on IGF-IR phosphorylation has not been shown previously.

With regard to the IGF-IR, there are two properties that may create confusion when one is interpreting experimental results. First at high, supraphysiological concentrations, insulin binds to and activates the IGF-IR, as shown in this and other studies (3, 25). Many in vitro experiments of insulin action on vascular cells have been performed at very high insulin concentrations, not occurring in vivo, where stimulation of IGF-IR could be interpreted as insulin effects (2, 44). Here, we show that, in HMVEC, only IGF-I significantly stimulates DNA synthesis and glucose metabolism at low concentrations (13), indicating that the effects are elicited by IGF-IR and not by IR. Second, it has been demonstrated that, in tissues coexpressing insulin and IGF-IR, the two receptors form hybrid receptors composed of an IR {alpha}{beta}-heterodimer and an IGF-IR {alpha}{beta}-heterodimer, which functionally behave like IGF-IR (26, 30, 38). Even if gene expression of IR and IR protein can be demonstrated, there need not be any functioning IR. Our result showing a predominance of gene expression of IGF-IR and ligand binding mainly of IGF-I suggests that there was largely IGF-IR or possibly hybrid receptors in the human micro- and macrovascular endothelial cells.

What could be the consequence if the endothelial cells respond to either IR or IGF-IR? With regard to the prevalence of IGF-IR in human endothelial cells, it is of great interest that several conditions with low circulatory IGF-I are associated with vascular disease. IGF-I levels are low in type 1 diabetes mellitus, probably due to insufficient insulinization of the liver (11, 15). In normal aging, IGF-I levels decrease with increasing age throughout adulthood (24, 28). Patients with low IGF-I due to growth hormone deficiency are characterized by increased mortality attributable to cardiovascular disease (7, 33). In epidemiological studies, association between low IGF-I levels and increased prevalence of vascular diseases supports the hypothesis of IGF-I being involved in the pathogenesis of ischemic heart disease (16, 20).

Another aspect of our study is related to safety in using insulin analogs. We show here that glargine clearly behaves differently from human insulin with regard to its affinity for IGF-IR being ~10-fold higher than that of human insulin. There is only one report in human osteosarcoma cells where glargine was 6.5 times more potent than human insulin in binding to the IGF-IR (23). Although in our study 10–8 M glargine had a weak effect on phosphorylation of the IGF-IR, there was no significant effect of glargine on DNA synthesis at a concentrations of 10–9 to 10–7 M. Even if glargine has a higher affinity than insulin for the IGF-IR, it will probably not have any mitogenic effect in vivo, because the concentrations of glargine reached in vivo are not high enough to considerably affect the IGF-IR (35). It cannot be excluded, however, that glargine could have some effect on hybrid receptors (30).

The result of this study clearly demonstrates that human micro- and macrovascular endothelial cells express IR and IGF-IR. As for the IR, we were able to demonstrate specific ligand binding and also IR protein but no significant effect of insulin. IGF-I activates the IGF-IR, and it can be concluded that human micro- and macrovascular cells possess functioning IGF-IR that can have a great impact in the pathogenesis of micro- and macroangiopathy.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
Financial support was obtained from Landstinget Östergotland, the Swedish Medical Research Council (04952), the Swedish Diabetes Association, and Barndiabetes Fonden.


   ACKNOWLEDGMENTS
 
We are grateful to Anna-Kristina Granath and Margareta Karlsson for excellent technical assistance.


   FOOTNOTES
 

Address for reprint requests and other correspondence: H. Arnqvist, Dept. of Biomedicine and Surgery, Division of Cell Biology, Univ. Hospital, S-581 85 Linkoping, Sweden (E-mail: hans.arnqvist{at}ibk.liu.se).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Aljada A, Ghanim H, Assian E, and Dandona P. Tumor necrosis factor-alpha inhibits insulin-induced increase in endothelial nitric oxide synthase and reduces insulin receptor content and phosphorylation in human aortic endothelial cells. Metabolism 51: 487–491, 2002.[CrossRef][Web of Science][Medline]
  2. Arnqvist HJ, Bornfeldt KE, Chen Y, and Lindstrom T. The insulin-like growth factor system in vascular smooth muscle: interaction with insulin and growth factors. Metabolism 44: 58–66, 1995.[CrossRef][Web of Science][Medline]
  3. Bahr M, Kolter T, Seipke G, and Eckel J. Growth promoting and metabolic activity of the human insulin analogue [GlyA21, ArgB31, ArgB32] insulin (HOE 901) in muscle cells. Eur J Pharmacol 320: 259–265, 1996.[CrossRef][Web of Science]
  4. Bar RS, Hoak JC, and Peacock ML. Insulin receptors in human endothelial cells: identification and characterization. J Clin Endocrinol Metab 47: 699–702, 1978.[Abstract/Free Full Text]
  5. Bar RS, Peacock ML, Spanheimer RG, Veenstra R, and Hoak JC. Differential binding of insulin to human arterial and venous endothelial cells in primary culture. Diabetes 29: 991–995, 1980.[Abstract]
  6. Bonetti PO, Lerman LO, and Lerman A. Endothelial dysfunction: a marker of atherosclerotic risk. Arterioscler Thromb Vasc Biol 23: 168–175, 2003.[Abstract/Free Full Text]
  7. Bulow B, Hagmar L, and Eskilsson J. Hypopituitary females have a high incidence of cardiovascular morbidity and an increased prevalence of cardiovascular risk factors. J Clin Endocrinol Metab 85: 574–584, 2000.[Abstract/Free Full Text]
  8. Ciaraldi TP, Carter L, Seipke G, Mudaliar S, and Henry RR. Effects of the long-acting insulin analog insulin glargine on cultured human skeletal muscle cells: comparisons to insulin and IGF-I. J Clin Endocrinol Metab 86: 5838–5847, 2001.[Abstract/Free Full Text]
  9. Cines DB, Pollak ES, Buck CA, Loscalzo J, Zimmerman GA, McEver RP, Pober JS, Wick TM, Konkle BA, Schwartz BS, Barnathan ES, McCrae KR, Hug BA, Schmidt AM, and Stern DM. Endothelial cells in physiology and in the pathophysiology of vascular disorders. Blood 91: 3527–3561, 1998.[Free Full Text]
  10. Dupont J and Le Roith D. Insulin and insulin-like growth factor I receptors: similarities and differences in signal transduction. Horm Res 55, Suppl 2: 22–26, 2001.
  11. Ekman B, Nystrom F, and Arnqvist HJ. Circulating IGF-I concentrations are low and not correlated to glycaemic control in adults with type 1 diabetes. Eur J Endocrinol 143: 505–510, 2000.[Abstract]
  12. Federici M, Menghini R, Mauriello A, Hribal ML, Ferrelli F, Lauro D, Sbraccia P, Spagnoli LG, Sesti G, and Lauro R. Insulin-dependent activation of endothelial nitric oxide synthase is impaired by O-linked glycosylation modification of signaling proteins in human coronary endothelial cells. Circulation 106: 466–472, 2002.[Abstract/Free Full Text]
  13. Frystyk J, Skjaerbaek C, Dinesen B, and Orskov H. Free insulin-like growth factors (IGF-I and IGF-II) in human serum. FEBS Lett 348: 185–191, 1994.[CrossRef][Web of Science][Medline]
  14. Giannini S, Cresci B, Pala L, Ciucci A, Franchini A, Manuelli C, Fujita-Yamaguchi Y, Cappugi P, Zonefrati R, and Rotella CM. IGFBPs modulate IGF-I- and high glucose-controlled growth of human retinal endothelial cells. J Endocrinol 171: 273–284, 2001.[Abstract]
  15. Hanaire-Broutin H, Sallerin-Caute B, Poncet MF, Tauber M, Bastide R, Rosenfeld R, and Tauber JP. Insulin therapy and GH-IGF-I axis disorders in diabetes: impact of glycaemic control and hepatic insulinization. Diabetes Metab 22: 245–250, 1996.[Web of Science][Medline]
  16. Harrela M, Qiao Q, Koistinen R, Tuomilehto J, Nissinen A, Seppala M, and Leinonen P. High serum insulin-like growth factor binding protein-1 is associated with increased cardiovascular mortality in elderly men. Horm Metab Res 34: 144–149, 2002.[Web of Science][Medline]
  17. Hovind P, Tarnow L, Rossing K, Rossing P, Eising S, Larsen N, Binder C, and Parving HH. Decreasing incidence of severe diabetic microangiopathy in type 1 diabetes. Diabetes Care 26: 1258–1264, 2003.[Abstract/Free Full Text]
  18. Jamali R and Arnqvist HJ. IGF-I but not insulin inhibits apoptosis at a low concentration in vascular smooth muscle cells. J Endocrinol 179: 267–274, 2003.[Abstract]
  19. Jialal I, Crettaz M, Hachiya HL, Kahn CR, Moses AC, Buzney SM, and King GL. Characterization of the receptors for insulin and the insulin-like growth factors on micro- and macrovascular tissues. Endocrinology 117: 1222–1229, 1985.[Abstract/Free Full Text]
  20. Juul A, Scheike T, Davidsen M, Gyllenborg J, and Jorgensen T. Low serum insulin-like growth factor I is associated with increased risk of ischemic heart disease: a population-based case-control study. Circulation 106: 939–944, 2002.[Abstract/Free Full Text]
  21. King GL, Buzney SM, Kahn CR, Hetu N, Buchwald S, Macdonald SG, and Rand LI. Differential responsiveness to insulin of endothelial and support cells from micro- and macrovessels. J Clin Invest 71: 974–979, 1983.[Web of Science][Medline]
  22. King GL, Goodman AD, Buzney S, Moses A, and Kahn CR. Receptors and growth-promoting effects of insulin and insulinlike growth factors on cells from bovine retinal capillaries and aorta. J Clin Invest 75: 1028–1036, 1985.[Web of Science][Medline]
  23. Kurtzhals P, Schaffer L, Sorensen A, Kristensen C, Jonassen I, Schmid C, and Trub T. Correlations of receptor binding and metabolic and mitogenic potencies of insulin analogs designed for clinical use. Diabetes 49: 999–1005, 2000.[Abstract]
  24. Landin-Wilhelmsen K, Wilhelmsen L, Lappas G, Rosen T, Lindstedt G, Lundberg PA, and Bengtsson BA. Serum insulin-like growth factor I in a random population sample of men and women: relation to age, sex, smoking habits, coffee consumption and physical activity, blood pressure and concentrations of plasma lipids, fibrinogen, parathyroid hormone and osteocalcin. Clin Endocrinol (Oxf) 41: 351–357, 1994.[Medline]
  25. Le Roith D, Bondy C, Yakar S, Liu JL, and Butler A. The somatomedin hypothesis: 2001. Endocr Rev 22: 53–74, 2001.[Abstract/Free Full Text]
  26. Moxham CP, Duronio V, and Jacobs S. Insulin-like growth factor I receptor beta-subunit heterogeneity. Evidence for hybrid tetramers composed of insulin-like growth factor I and insulin receptor heterodimers. J Biol Chem 264: 13238–13244, 1989.[Abstract/Free Full Text]
  27. Nilsson J and Thyberg J. Fine structure of arterial smooth muscle cells cultured in the presence of whole blood serum or plasma-derived serum. Cell Tissue Res 223: 87–99, 1982.[Web of Science][Medline]
  28. Nystrom FH, Ohman PK, Ekman BA, Osterlund MK, Karlberg BE, and Arnqvist HJ. Population-based reference values for IGF-I and IGF-binding protein-1: relations with metabolic and anthropometric variables. Eur J Endocrinol 136:165–172, 1997.[Abstract/Free Full Text]
  29. Ohashi H, Rosen KM, Smith FE, Villa-Komaroff L, Nayak RC, and King GL. Characterization of type I IGF receptor and IGF-I mRNA expression in cultured human and bovine glomerular cells. Regul Pept 4: 9–20, 1993.
  30. Pandini G, Frasca F, Mineo R, Sciacca L, Vigneri R, and Belfiore A. Insulin/insulin-like growth factor I hybrid receptors have different biological characteristics depending on the insulin receptor isoform involved. J Biol Chem 277: 39684–39695, 2002.[Abstract/Free Full Text]
  31. Rechler MM and Nissley SP. The nature and regulation of the receptors for insulin-like growth factors. Annu Rev Physiol 47: 425–442, 1985.[CrossRef][Web of Science][Medline]
  32. Rosen OM. After insulin binds. Science 237: 1452–1458, 1987.[Abstract/Free Full Text]
  33. Rosen T and Bengtsson BA. Premature mortality due to cardiovascular disease in hypopituitarism. Lancet 336: 285–288B, 1990.[CrossRef][Web of Science][Medline]
  34. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 362: 801–809, 1993.[CrossRef][Medline]
  35. Rossetti P, Pampanelli S, Fanelli C, Porcellati F, Costa E, Torlone E, Scionti L, and Bolli GB. Intensive replacement of basal insulin in patients with type 1 diabetes given rapid-acting insulin analog at mealtime: a 3-mo comparison between administration of NPH insulin four times daily and glargine insulin at dinner or bedtime. Diabetes Care 26: 1490–1496, 2003.[Abstract/Free Full Text]
  36. Saltiel AR and Kahn CR. Insulin signalling and the regulation of glucose and lipid metabolism. Nature 13: 799–806, 2001.
  37. Shimasaki S and Ling N. Identification and molecular characterization of insulin-like growth factor binding proteins (IGFBP-1, -2, -3, -4, -5 and -6). Prog Growth Factor Res 3: 243–66, 1991.[CrossRef][Medline]
  38. Soos MA, Field CE, and Siddle K. Purified hybrid insulin/insulin-like growth factor-I receptors bind insulin-like growth factor-I, but not insulin, with high affinity. Biochem J 290: 419–426, 1993.[Web of Science][Medline]
  39. Spoerri PE, Ellis EA, Tarnuzzer RW, and Grant MB. Insulin-like growth factor: receptor and binding proteins in human retinal endothelial cell cultures of diabetic and non-diabetic origin. Growth Horm IGF Res 8: 125–132, 1998.[CrossRef][Web of Science][Medline]
  40. Stehouwer CD, Lambert J, Donker AJ, and van Hinsbergh VW. Endothelial dysfunction and pathogenesis of diabetic angiopathy. Cardiovasc Res 34: 55–68, 1997.[Abstract/Free Full Text]
  41. UK Prospective Diabetes Study Group. Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). Lancet 12: 837–853, 1998.
  42. Ullrich A, Bell JR, Chen EY, Herrera R, Petruzzelli LM, Dull TJ, Gray A, Coussens L, Liao Y, and Tsubokawa M. Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes. Nature 313: 756–761, 1985.[CrossRef][Medline]
  43. Ullrich A, Gray A, Tam AW, Yang-Feng T, Tsubokawa M, Collins C, Henzel W, Le-Bon T, Kathuria S, and Chen E. Insulin-like growth factor I receptor primary structure: comparison with insulin receptor suggests structural determinants that define functional specificity. EMBO J 5: 2503–2512, 1986.[Web of Science][Medline]
  44. Zeng G, Nystrom F, Ravichandran LV, Cong LN, Kirby MBS, Mostowski HBS, and Quon MJ. Roles for insulin receptor, PI3-kinase, and Akt in insulin-signaling pathways related to production of nitric oxide in human vascular endothelial cells. Circulation 101: 1539–1545, 2000.[Abstract/Free Full Text]
  45. Zeng G and Quon MJ. Insulin-stimulated production of nitric oxide is inhibited by wortmannin, direct measurement in vascular endothelial cells. J Clin Invest 98: 894–898, 1996.[Web of Science][Medline]



This article has been cited by other articles:


Home page
 DiabetesHome page
S. Gogg, U. Smith, and P.-A. Jansson
Increased MAPK Activation and Impaired Insulin Signaling in Subcutaneous Microvascular Endothelial Cells in Type 2 Diabetes: The Role of Endothelin-1
Diabetes, October 1, 2009; 58(10): 2238 - 2245.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
J. Tanaka, L. Qiang, A. S. Banks, C. L. Welch, M. Matsumoto, T. Kitamura, Y. Ido-Kitamura, R. A. DePinho, and D. Accili
Foxo1 Links Hyperglycemia to LDL Oxidation and Endothelial Nitric Oxide Synthase Dysfunction in Vascular Endothelial Cells
Diabetes, October 1, 2009; 58(10): 2344 - 2354.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
M. A. Potenza, F. Addabbo, and M. Montagnani
Vascular actions of insulin with implications for endothelial dysfunction
Am J Physiol Endocrinol Metab, September 1, 2009; 297(3): E568 - E577.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
H. Wang, A. X. Wang, Z. Liu, and E. J. Barrett
Insulin Signaling Stimulates Insulin Transport by Bovine Aortic Endothelial Cells
Diabetes, March 1, 2008; 57(3): 540 - 547.
[Abstract] [Full Text] [PDF]

Home page
 Diabetes CareHome page
M. A. Marini, E. Succurro, S. Frontoni, M. L. Hribal, F. Andreozzi, R. Lauro, F. Perticone, and G. Sesti
Metabolically Healthy but Obese Women Have an Intermediate Cardiovascular Risk Profile Between Healthy Nonobese Women and Obese Insulin-Resistant Women
Diabetes Care, August 1, 2007; 30(8): 2145 - 2147.
[Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
Z. Wang, G. Chakravarty, S. Kim, Y. D. Yazici, M. N. Younes, S. A. Jasser, A. A. Santillan, C. D. Bucana, A. K. El-Naggar, and J. N. Myers
Growth-Inhibitory Effects of Human Anti-Insulin-Like Growth Factor-I Receptor Antibody (A12) in an Orthotopic Nude Mouse Model of Anaplastic Thyroid Carcinoma
Clin. Cancer Res., August 1, 2006; 12(15): 4755 - 4765.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
H. Wang, Z. Liu, G. Li, and E. J. Barrett
The vascular endothelial cell mediates insulin transport into skeletal muscle
Am J Physiol Endocrinol Metab, August 1, 2006; 291(2): E323 - E332.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. M. van Golen, T. S. Schwab, B. Kim, M. E. Soules, S. Su Oh, K. Fung, K. L. van Golen, and E. L. Feldman
Insulin-Like Growth Factor-I Receptor Expression Regulates Neuroblastoma Metastasis to Bone.
Cancer Res., July 1, 2006; 66(13): 6570 - 6578.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
A. R. Gosmanov, F. B. Stentz, and A. E. Kitabchi
De novo emergence of insulin-stimulated glucose uptake in human aortic endothelial cells incubated with high glucose
Am J Physiol Endocrinol Metab, March 1, 2006; 290(3): E516 - E522.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/E896    most recent
00327.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chisalita, S. I.
Right arrow Articles by Arnqvist, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chisalita, S. I.
Right arrow Articles by Arnqvist, H. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.