Am J Physiol Endocrinol Metab 286: E1004-E1010, 2004.
First published January 28, 2004; doi:10.1152/ajpendo.00427.2003
0193-1849/04 $5.00
Catabolic action of insulin in rat arcuate nucleus is not enhanced by exogenous "tub" expression
Dianne P. Figlewicz,1,2
Aryana Zavosh,2
Timothy Sexton,3 and
John F. Neumaier3
1Metabolism/Endocrinology, Veterans Affairs Puget Sound Health Care System, Seattle 98108; 2Department of Psychiatry and Behavioral Sciences, University of Washington, Seattle 98195-6560; and 3Department of Psychiatry and Behavioral Sciences, University of Washington, Harborview Medical Center, Seattle, Washington 98104
Submitted 23 September 2003
; accepted in final form 12 January 2004
 |
ABSTRACT
|
|---|
The central nervous system (CNS) protein "tub" has been identified from the genetically obese "tubby" mouse. Although the native function of tub in situ is not understood, cell-based studies suggest that one of its roles may be as an intracellular signaling target for insulin. In normal animals, insulin acts at the hypothalamic arcuate nucleus (ARC) to regulate energy balance. Here we used a Herpes Simplex viral expression system to evaluate whether tub overexpression in the ARC of normal rats enhances this action of insulin. In chow-fed rats, tub overexpression had no effect on insulin action. In rats fed a high-fat diet snack in addition to chow, simulating the diet of Westernized societies, the body weight regulatory action of insulin was impaired, and tub overexpression further impaired insulin action. Thus an excess of tub at the ARC does not enhance the in vivo effectiveness of insulin and is not able to compensate for the "downstream" consequences of a high-fat diet to impair CNS body weight regulatory mechanisms.
food intake; body weight; hypothalamus
OVER THE PAST TWO DECADES, intense investigation from a number of laboratories has focused on the identification of critical peptides and proteins that act in brain pathways to regulate food intake, body weight, and energy balance (1, 27). One such protein that is implicated in the central nervous system (CNS) regulation of energy balance is tub. The "tubby" mouse was described by Coleman and Eicher in 1990 (9) as a spontaneously occurring, autosomal recessive mutant characterized by adult-onset obesity and insulin resistance. The tub protein has been cloned, as have other members of this unique family of proteins (13, 16, 18, 20, 21), and it is now known that a COOH-terminal mutation of this protein is responsible for the tubby mouse phenotype. Kapeller and colleagues (Stubdal et al., Ref. 28) replicated this phenotype by creating a targeted deletion of the tub mouse gene: knockout of the tub gene in normal mice recapitulates the tubby phenotype and demonstrates that the naturally occurring mutation is a loss-of-function mutation. Tub protein is expressed in the CNS in neurons (14, 24) and has been localized in several hypothalamic nuclei that express insulin receptors and are implicated in the control of body weight, metabolism, and energy balance (3). Consistent with a CNS role for tub in body weight regulation, mRNA levels for arcuate nucleus (ARC) proopiomelanocortin (the precursor of the anorectic
-melanocyte-stimulating hormone) are decreased, and mRNA levels for the orexigenic peptide neuropeptide Y in the dorsomedial-ventromedial hypothalamus (DMH/VMH) are increased in mature tubby mice (12). The human homolog of tub has been mapped (7), but the relevance of tub to human obesity requires further study: one report to date has examined a group of 105 morbidly obese Finnish patients and reported no significant linkage in these subjects between obesity and the human tub gene (23). This is perhaps not surprising, considering that the complete knockout of the tub gene results in a less severe, adult-onset obesity. Because retinal degeneration secondary to apoptosis is also observed in tubby mice, it was suggested that localized hypothalamic apoptosis (comparable to a "genetic VMH lesion") might account for the obesity. However, apoptotic markers have not been found in the tubby hypothalamus.
To date, there have been few studies evaluating the cellular functions of tub. One line of study suggests that tub may function in the CNS as a critical molecule in the downstream insulin receptor-signaling path. Kapeller et al. (15) demonstrated in intact cells and in in vitro kinase systems that tub is tyrosine phosphorylated by the activated insulin receptor kinase (as well as by Abl and JAK 2, but not epidermal growth factor receptor or Src kinases). In the phosphorylated state, tub associates with the Src homology 2 (SH2) domains of a number of cell-signaling molecules, including the COOH-terminal SH2 domain of PLC
(15). These findings were interpreted to suggest that tub can be a substrate in the pathway of intracellular insulin action and may function as an adaptor, linking insulin to intracellular signaling cascades. Boggon et al. (4) used functional genomics to further characterize the cellular actions of tub. Their studies suggest that the COOH-terminal, highly conserved portion of the protein is a DNA-binding structure and that the NH2-terminal portion may be a regulator of transcription. This is supported by the observation that tub was highly localized to the nucleus of neurons in primary culture. Tub has also been shown to translocate from the plasma membrane to the nucleus after serotonin activation of 5-HT2c receptors (4); this may bear on control of food intake, since 5-HT2c knockout mice develop mild, adult-onset obesity and insulin resistance (29). Thus tub may serve as a transcription factor as well as an "adaptor" molecule.
We and others have demonstrated that the pancreatic hormone insulin (3, 11, 27) can act in the CNS as an adiposity signal. A particular hypothalamic target for this action is the ARC, where increased expression of anorexic and decreased expression of orexigenic peptides have been reported (3, 22, 27, 30). One component mechanism underlying the obesity of the tubby phenotype might be an impairment of insulin intracellular signaling in the ARC. In the present study, to further evaluate tub function in normal nonobese animals, we asked whether increased expression of tub above normal endogenous levels can enhance behavioral sensitivity to endogenous insulin or to exogenous, locally administered insulin in the rat. The ability of exogenous insulin to decrease body weight is impaired in rats fed a high-fat diet, either independent of, or accompanied by, dietary obesity (2, 6). Thus, with access to a high-fat diet and development of dietary obesity, a model of the mild-to-moderate obesity that is prevalent in "Westernized" societies, insulin resistance occurs in the CNS as well as in peripheral target tissues. We hypothesized that, if tub functions as an adaptor for intracellular insulin signaling, then in a model of CNS insulin resistance (high-fat feeding), the catabolic action of exogenously administered insulin would be impaired but that this might be corrected or reversed by increasing tub expression. Using a Herpes Simplex viral vector system, we targeted the ARC of the hypothalamus as a location of neurons that synthesize insulin receptors, and as a CNS site that is sensitive to the effects of insulin on energy balance.
 |
MATERIALS AND METHODS
|
|---|
Assurances.
All procedures performed in these studies were approved by the VA Puget Sound Health Care System and University of Washington committees for humane use of animals (rat studies) and Biohazard/Biosafety (preparation and use of Herpes Simplex engineered viral vectors).
Materials.
Unless otherwise indicated, reagents were obtained from Sigma (St. Louis MO). Insulin for ARC infusions was Novolin (Novo Nordisk, 100 U/ml) diluted with sterile synthetic cerebrospinal fluid (CSF) solution.
Preparation of HA-tub-GFP viral particles.
Modification of our previously published methodology for the preparation of Herpes Simplex Virus (HSV)-vector particles was utilized to prepare hemagglutinin (HA)-tub-expressing viral particles (8). This vector/amplicon system has been characterized to target neurons, with low toxicity and good efficiency of gene expression (see discussion in Ref. 8). The clone for rat tub was provided by Dr. Rosana Kapeller (Millenium Pharmaceuticals). As there are no available antibodies for rat tub, and available antibodies directed at mouse tub do not detect endogenous tub in rat CNS (Figlewicz Lattemann D and Baskin DG, unpublished observations), an HA tag was introduced into the rat tub construct. The HA tag does not interfere with insulin-stimulated phosphorylation (or other biochemical actions) of the tub protein (16). For ease of visualization within the CNS, the vector system also expressed green fluorescent protein (GFP; see below for validation of the coexpression of these proteins), a standard approach for rapid visualization of successful infection or transfection. To introduce the HA epitope tag into the NH2 terminus of the rat tub gene, pN10-rTub was used as a template to PCR clone the rat tub full-length sequence using a downstream primer (5' AGATCTAGACTACTCGCAGGCCAGCT 3') and an upstream primer (5' AGATCTAGACCCATGGGGTACCCATATGACGTCCCAGACTACGCCACTTCCAAGCCGCATT 3') that introduced an in-frame HA epitope. To enable further manipulation, the resulting product was used as a PCR template with an upstream primer (5' GCGCGGATCCTGGCGGCCGCTCTA 3'), containing a BamHI site and a NotI site, and the downstream primer (5' GCGCGCTAGCAGCCCGGGGGATCC 3') containing BamHI, SmaI, and NheI sites. An HSV amplicon expressing both HA-tub and GFP was then constructed by cutting the second PCR product with BamHI and ligating it into the BamHI/AvrII cut multiple cloning site of the previously constructed p1003 amplicon (8). The p1003 amplicon contains two separate transcriptional units. The first transcriptional unit consists of the HSV IE 4/5 promoter followed by a multiple cloning site and an SV40 polyA signal. The second transcriptional unit consists of the CMV promoter followed by the eGFP gene and an SV40 polyA signal (8). DNA sequencing confirmed the identity and directionality of the HA-tub insert in the resulting amplicon (HA-tub/GFP), which was further studied with standard transfection techniques, or packaged into nonreplicating HSV virion particles, as previously described (19), to produce the viral vector. The construct was sequenced in its entirety to verify complete and accurate identity of the tub open reading frame, compared with the original clone.
Cell culture and transfection.
Before in vivo infection studies, we validated our expression vector system in vitro by transfecting human embryonic kidney (HEK) cells and visualizing GFP and HA. HEK cells were the generous gift of Dr. Randy Blakely (Vanderbilt University). They were cultured as a monolayer in DMEM maintenance media (high glucose-L-glutamine) supplemented with 5% fetal bovine serum (Hyclone, Logan, UT), 5% fetal calf serum (Hyclone), and 0.5% penicillin-streptomycin. Cultures were maintained in 75-cm3 flasks at 37°C in an atmosphere of humidified 95% O2-5% CO2. For the assays described below, cells were studied at 7080% confluence.
Trypsinized cells were aliquotted to 6-well plates (Becton Dickinson, Franklin Lake, NJ) 24 h before transfection. Effectene Transfection Reagent (Qiagen) was used for the efficient transfection of the expression vector containing HA-tub/GFP (1 µg DNA/well). After 3 days of incubation, cells were harvested. Intact cells were visualized for GFP expression with an inverted fluorescence microscope (Nikon, TE 3000) and FITC filter. Additional cells were processed for Western blotting and detection of HA expression.
Immunoblotting.
Cells were immunoprecipitated with 1 µl of monoclonal anti-HA-peroxidase high-affinity (3F10) antibody (Roche Molecular Biochemicals, Mannheim, Germany) overnight and incubated for 2 h with protein A-Sepharose beads (Zymed Lab, San Francisco, CA). The precipitate was washed 3x with high-salt wash buffer (20 mM HEPES, 0.3 M NaCl, 5 mM MgCl2, 0.5% Triton X-100, pH 7.5) and 2x with low-salt wash buffer (20 mM HEPES, 0.05 M NaCl, 5 mM MgCl2, 0.5% Triton X-100, pH 7.5) (15). The washed precipitate was resuspended in 30 ml of 2x Laemmli sample buffer (Bio-Rad, Hercules, CA) and incubated for 20 min at room temperature for dissociation from the Sepharose beads. The mixture was centrifuged for 5 min at 16,000 g, and the supernatant was stored at 20°C for Western blotting. The sample was boiled at 100°C, resolved by 10% SDS-polyacrylamide gel electrophoresis (precast gel, Bio-Rad), and transferred to a polyvinylidene difluoride membrane (Bio-Rad). After overnight blocking with BLOTTO (PBS, 0.01 M NaN3, 0.05% Tween 20, and 5% nonfat dry milk, pH 7.3), membranes were washed 3x with wash buffer (PBS, 0.01 M NaN3, 0.1% Tween 20, pH 7.3) and incubated with primary antibody (monoclonal HA-peroxidase, 1:500) for 60 min, 37°C, in diluent buffer (PBS, 0.01 M NaN3, 0.1% Tween 20, 1% BSA, pH 7.3). Membranes were washed 3x with wash buffer, developed with enhanced chemiluminescence (Amersham), and exposed to film (Kodak).
Immunocytochemistry.
Cannula placement and successful viral vector infection were verified in all rats after in vivo study. An observer blind to the experimental treatment groups evaluated cannula placement and GFP expression in each rat; only in vivo data from rats with adequate GFP expression in the ARC were included for analysis. Initial assays validated the neuronal coexpression of GFP and HA-tub proteins in HA-tub-GFP-infected animals (see Fig. 2). This expression system has been shown to result in maximal gene expression by 35 days. We verified in situ GFP expression in the ARC over a time course of 36 days as further validation of the amplicon system before in vivo studies (data not shown). Rats were deeply anesthetized with pentobarbital sodium (50 mg/ml; 2 ml/kg body wt) and perfused transcardially with 4% paraformaldehyde-PBS for immunocytochemistry, as published and described previously (10), and immunocytochemistry was performed as previously described (8). Brains were removed, and 40-µm vibratome (Leica, Nussloch, Germany) sections that included the entire hypothalamus (AP stereotaxic coordinates, 0.92 to 4.3 mm from bregma) were prepared and frozen for immunocytochemistry to localize HA and GFP expression. Free-floating sections were rinsed and permeabilized in PBS-0.01% sodium azide for 30 min at room temperature. Sections were blocked in PBS-0.01% sodium azide-0.025% Triton X-100-0.3% gelatin for 60 min at room temperature. Mouse monoclonal anti-HA (Babco), diluted 1:1,000 in blocking buffer, was added, and sections were incubated overnight at 4°C. Tissue sections were washed 3x, 10 min/wash, at room temperature in PBS-0.01% sodium azide-0.025% Triton X-100. Cy5-conjugated anti-mouse antibody (Kirkegaard & Perry Laboratories, Gaithersburg, MD), 1:500 in blocking buffer, was added for 45 min at room temperature. Sections were washed 3x at room temperature. They were mounted with a drop of Gel/Mount (Biomeda) and coverslipped for visualization with a Leica TCS SP Confocal Microscope system.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 2. Expression of the HA-tub-GFP construct in vivo in arcuate nucleus (ARC) neurons visualized by confocal microscopy. A: HA immunofluorescence; B: GFP fluorescence; C: merged images showing colocalization of HA and GFP.
|
|
In vivo studies.
Male albino rats (Simonsen Labs, Gilroy, CA and Animal Technology Laboratories, Kent, WA) were studied at the weight of 350400 g (see Table 1 for weights of rats at time of hypothalamic injection). All rats had ad libitum access to Purina rat chow and water throughout the studies. For the final experiments, rats had additional ad libitum access for 60 min/day 5 days/wk to a high-fat diet [Harlan Teklad (31)] for
5 wk. The diet was also available postsurgery and during the minipump infusion period. Both chow and high-fat diet intakes were quantitated. All rats received bilateral acute injections into the ARC, immediately followed by insertion of two Alzet osmotic minipumps (Alza, Palo Alto, CA; 7-day minipumps with infusion rate
0.5 µl/h) subcutaneously into the intrascapular area. For this procedure, rats were previously implanted under ketamine-xylazine-0.9% saline (vol/vol/vol; 10:1.3:5.2) anesthesia with bilateral guide cannulas that terminated immediately dorsal to the ARC (stereotaxic coordinates: AP 2.2 mm, DV 8.9 mm, ML ± 0.4 mm). After complete recovery from guide cannula placement (documented as regain of presurgical body weight and a positive weight gain trajectory), rats were again anesthetized with isoflurane-oxygen (adjusted as needed). Viral particles (HA-tub-GFP or GFP-only) were injected via Hamilton syringe and microprocessor-controlled infusion pump (SP 101i, World Precision Instruments) at a rate of 2 µl over 10 min. The injector was left in place for 2 min. Immediately after the injection, minipumps were implanted and attached to the cannulas with vinyl tubing (Scientific Commodities, Lake Havasu City, AZ). Minipumps delivered either sterilized artificial CSF or a dose of insulin, as indicated in RESULTS. Body weight, food intake, and water intake were measured for the subsequent 6 days. Animals were then euthanized by anesthesia/perfusion, as described above.
 |
RESULTS
|
|---|
Validation of expression of the viral constructs.
We evaluated the coexpression of HA-tub and GFP in infected HEK cells and in the medial hypothalamus. As shown in Fig. 1, HEK cells infected with the HA-tub-GFP viral vector construct express both proteins. GFP fluorescence (Fig. 1A) was observed in whole cells; HA was detected in a Western blot of an HA-immunoprecipitate of the infected HEK cells compared with no detectable HA immunoreactivity in the HEK cells that were noninfected and prepared simultaneously (Fig. 1B). Successful infection and coexpression of HA-tub and GFP in rat hypothalamus were established with fluorescence confocal microscopy, and one example is shown in Fig. 2. We observed colocalization of HA and GFP in ARC neuronal processes (Fig. 2A, HA immunofluorescence; Fig. 2B, GFP fluorescence; Fig. 2C, merged images). Because we observed coexpression of GFP and HA-tub in these initial controls, GFP expression was used subsequently for visual validation of the location of viral injection sites and the success of the infection in all experimental subjects. Figure 3A shows an injection track for the (bilateral) injection dorsal to the medial ARC, and Fig. 3B shows, at higher magnification, GFP expression in individual cells in the ARC. Although we were not able to identify the phenotype of infected neurons in this study, the abundant expression of insulin receptors in the ARC makes it reasonably likely that at least portions of insulin receptor-expressing neurons were successfully infected.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1. Expression of the hemagglutinin (HA)-tub-green fluorescent protein (GFP) construct in infected human embryonic kidney (HEK) cells. A: GFP fluorescence expression in intact cells. B: Western blot of HA immunoprecipitate blotted for HA immunoreactivity. No HA immunoreactivity is observed in HEK cells infected with the control construct (GFP-only).
|
|

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 3. Cannula placement and regional expression of the HA-tub-GFP construct: visual post hoc criterion for successful infection. A: example of bilateral cannula placement immediately dorsal to the ARC; B: GFP expression is abundant and predominantly within the ARC.
|
|
We evaluated the effect of intra-ARC control injection/infusion treatments on body weight and food intake over the subsequent 6 days after minipump implant. Control (GFP) viral infection had a modest but significant effect to suppress body weight, independent of insulin treatment, compared with rats that received either sucrose (Suc; the viral particle vehicle) or CSF injection: average weight change over the six minipump days was GFP/CSF = 13 ± 3 g (n = 12); CSF/CSF = 0.2 ± 2 g (n = 10); Suc/CSF = 3 ± 3 g (n = 5). (Comparisons were GFP/CSF vs. CSF/CSF, P = 0.004, and GFP/CSF vs. Suc/CSF, P = 0.012). GFP vector expression likewise had a modest but significant effect to suppress food intake in the GFP/CSF vs. CSF/CSF groups (P = 0.015). Thus all studies with intra-ARC insulin infusions included GFP-vector injections as controls.
Lack of effect of exogenous tub expression on insulin-induced catabolic effects in chow-fed rats.
ARC infusion of insulin resulted in a dose-related weight loss in rats infected with either GFP or HA-tub vector (Fig. 4). All rats received vector injections followed by infusion of artificial CSF, 10 mU/day insulin, or 20 mU/day insulin directly into the medial ARC. In the GFP-injected rats (solid lines), there was a significant overall dose effect for insulin infusion into the ARC to decrease body weight [F(2,18) = 6.448, P = 0.005]; a significant dose-by-time interaction [F(1,204) = 2.545, P = 0.007]; and significance across days for individual insulin doses to decrease body weight (CSF vs. 10 mU insulin/day, P = 0.001; CSF vs. 20 mU insulin/day, P < 0.0001; 10 vs. 20 mU insulin/day, P < 0.0001). Figure 4 also shows the corresponding dose-response curve for rats receiving HA-tub injections (dashed lines) followed by CSF or 10 or 20 mU/day insulin infusion into the ARC. There was no overall or interactive effect of tub treatment with days, insulin treatment, or day x insulin combination compared with GFP (control) animals. Thus exogenous expression of tub in the ARC had no effect on either baseline body weight or the efficacy of insulin to decrease body weight in normal-weight rats maintained on a diet of normal rat chow.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 4. Lack of effect of tub overexpression on the action of insulin to decrease body wt in chow-fed rats. Data are within-subject change of body wt in g, relative to body wt on day of minipump implant. and , cerebrospinal fluid (CSF) infusion; and , 10 mU/day insulin; and , 20 mU/day insulin; solid lines and filled symbols, GFP injection; dashed line and open symbols, HA-tub injection. GFP/CSF, n = 12; tub/CSF, n = 8; GFP 10 mU/day insulin, n = 11; tub 10 mU/day insulin, n = 15; GFP 20 mU/day insulin, n = 8; tub 20 mU/day insulin, n = 11. See text for statistical analyses.
|
|
Insulin infusion into the ARC significantly decreased food intake. Although intake was comparably suppressed during the first 24 h postinjection/implant (day 1) among the groups, there was a significant overall dose effect for insulin to decrease food intake during days 26 [F(2,62) = 3.828; P = 0.027]. Both doses of insulin were significantly effective in decreasing food intake, as evaluated by post hoc unpaired t-test (520 ± 12 vs. 488 ± 8 kcal, 0 vs. 10 mU insulin, P = 0.038; 520 ± 12 vs. 464 ± 20 kcal, 0 vs. 20 mU insulin, P = 0.021). HA-tub expression had no effect on cumulative chow consumption at any dose of insulin (Fig. 5; GFP vs. tub comparisons). There was no effect of either insulin or tub, and no interactive effect of the two, on cumulative water intake over the 6 days postminipump implant.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 5. Lack of effect of tub overexpression on food intake in chow-fed rats. Data correspond to rats whose body wt data are shown in Fig. 4.
|
|
The efficacy of insulin to decrease body weight is impaired with HFD feeding and is further impaired by exogenous tub expression.
Because previous studies have shown that the efficacy of insulin to decrease body weight is impaired in rats given access to an HFD, even in the absence of significant diet-induced body weight gain (2, 6), we hypothesized that tub, although not effective in enhancing insulin action in chow-fed rats, might act to enhance or restore sensitivity to insulin in the ARC of rats fed an HFD. We gave rats access to HFD for 60 min/day, 5 days/wk for
5 wk before surgery. All rats also had ad libitum access to rat chow. Rats were then tested with intra-ARC injections of GFP or HA-tub-GFP vector and infusions of 20 mU insulin/day. As shown in Fig. 6, rats given access to HFD had a significantly attenuated body weight decrease in response to 20 mU/day insulin relative to the chow-fed cohort, confirming that HFD makes rats resistant to insulin action in the ARC. There was a significant overall effect of the HFD [F(1,18) = 6.679, P = 0.02], and the effect was significant for individual days 15 (P = 0.03, 0.04, 0.002, 0.02, and 0.02 for the respective 5 days). The average change of body weight between the chow- and HFD-fed rats across the infusion period was likewise significant (chow, 32 ± 1 g; HFD, 21 ± 2 g, P < 0.0001).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6. Effectiveness of insulin to decrease body wt is impaired in rats given access to high-fat diet (HFD, 60 min/day; 5 days/wk). All rats received 20 mU/day insulin after 5-wk access to HFD in addition to ad libitum rat chow. Data are within-subject changes of body wt in g relative to body wt on day of minipump implant. *P < 0.05 between groups, unpaired t-test, at individual days. See RESULTS for additional statistical analysis.
|
|
In contrast to its lack of effect on insulin action in chow-fed rats, and in contrast to our predicted effect of tub in HFD-fed rats, HA-tub expression in the ARC further blunted the effect of insulin to decrease body weight in these animals (Fig. 7). Average within-subject body weight decrease across the 6 days postimplant was significantly greater in the GFP vs. the tub rats (21 ± 3 vs. 14 ± 4 g, P = 0.03). There was a significant day x treatment interaction [F(2,18) = 2.621, P = 0.02] and significant individual differences on days 36 (P = 0.05, 0.03, 0.04, and 0.02 for each day, respectively). Average caloric intake for 5 days before minipump implant was comparable for GFP vs. tub rats (103 ± 2 vs. 106 ± 2 kcal/day, respectively). Total caloric intake across the 6 days of insulin infusion was lower in the GFP than in HA-tub-GFP groups (438 ± 28 vs. 507 ± 19 kcal, P = 0.05); this change was a composite of decreases in both HFD intake (159 ± 13 vs. 181 ± 17 kcal, P = 0.33) and chow intake (279 ± 32 vs. 326 ± 29 kcal, P = 0.31). To validate that this effect of HA-tub was not merely an additive effect of the 20 mU/day insulin treatment with an independent effect of tub on its own to increase body weight in rats having access to HFD, we studied a series of rats maintained on the HFD, injected with GFP or HA-tub-GFP vector, but infused with CSF. Comparable to what we observed in the "0 mU insulin" chow-fed rats, there was no difference in body weight across the 6 days of infusion between GFP and tub rats. That is, exogenous tub expression by itself did not cause weight gain in CSF-infused HFD rats (data not shown). Therefore, it appears that exogenous expression of tub in rat ARC, in association with HFD availability, further reduces insulin action.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7. Tub overexpression in the ARC impairs effectiveness of insulin to decrease body wt in rats given access to HFD. All rats were infused with 20 mU insulin/day after injection of GFP vector (identical group to that shown in Fig. 6) or HA-tub vector. Data are within-subject changes of body wt in g, relative to body wt on day of minipump implant. *P < 0.05, significant difference between groups at individual days, by unpaired t-test.
|
|
 |
DISCUSSION
|
|---|
In this study we demonstrated that insulin infusion into the rat ARC has catabolic effects to decrease body weight and food intake and that this effect is blunted in rats fed a high-fat snack in addition to rat chow, thus demonstrating behavioral insulin resistance at the level of the hypothalamus. Additionally, exogenous expression of tub does not result in enhanced efficacy of insulin to decrease food intake and body weight. In rats maintained on normal rat chow, tub did not enhance the action of endogenous insulin (as demonstrated by its ineffectiveness in rats infused with artificial CSF) or of exogenous insulin (10 or 20 mU/day), compared with insulin effects in GFP-expressing animals. Furthermore, in contrast to our originally hypothesized outcome, tub overexpression did not reverse the impairment of insulin's catabolic actions in rats given access to HFD: 20 mU insulin/day was less effective in HFD-fed rats, comparable to what has been previously reported (2, 6), and this impairment was not rescued by exogenous tub expression. To the contrary, exogenous tub expression in HFD-fed rats further impaired the catabolic action of insulin, and this last observation also suggests that the lack of effect of tub in chow-fed rats was not due to lack of expression within insulin-sensitive neurons, because a clear interaction was observed when exogenous insulin infusion was combined with tub infection in the HFD-fed rats.
Our study represents the first in vivo exploration of tub function in energy balance regulation of normal rats. Although we did not quantify tub protein per se in our rats, increased expression of target proteins has been observed by ourselves (8) and by other labs using this HSV amplicon system. Our in vitro and immunocytochemistry controls validated the coexpression of GFP and HA-tub; thus it seems reasonable to conclude that we were successful in expressing or overexpressing rat tub in the ARC. One speculation from our findings is that expression of tub beyond normal endogenous amounts may not enhance insulin signaling, as represented by its actions to decrease food intake and body weight, and in fact excess amounts of tub may impair insulin action. In vitro biochemical studies have suggested the possibility that tub may act as an adaptor for insulin signaling (15). However, tub function is still poorly understood both in vivo and in vitro; thus one can only speculate on mechanisms whereby this might occur. For example, one might speculate that an intracellular overabundance of tub might lead to its serving as an adaptor molecule for signaling pathways that are antagonistic to insulin. Another possibility would be that intracellular distribution of tub in the nucleus vs. cytoplasm might be altered with its overexpression. Shapiro and colleagues (Santagata et al., Ref. 26) have provided evidence that tub release from the plasma membrane occurs in association with activation of G
q-coupled receptors, and they speculate that this release leads to nuclear translocation of tub. One might then hypothesize that enhanced concentrations of tub would be released in association with stimulation of G
q-coupled receptors in the ARC by endogenous ligands whose action opposes the catabolic effects of insulin, for example, melanin-concentrating hormone (MCH). Receptors for MCH are expressed in the ARC (25). Such an effect may have synergized with the relative insulin resistance in the ARC that occurred in the HFD-fed rats. Finally, the impaired insulin action in HFD-fed rats (as reflected in blunted body weight loss) may result in impairment in the tyrosine phosphorylation of tub. Overexpression of tub might result in an imbalance of phosphorylated (insulin-enhancing) vs. nonphosphorylated (nuclear translocating) forms and have a net effect to antagonize insulin action further. These are speculative possibilities but lend themselves to direct testing in cellular in vitro systems.
In conclusion, loss of tub function developmentally results in a mild adult-onset obesity. Overexpression of tub in the mature rat hypothalamus does not yield an opposite phenotype, i.e., a tendency to eat less than normal and to lose weight, but it appears to have a fairly acute effect to impair the catabolic effect of insulin. These findings suggest that the in vivo action(s) of tub are, not surprisingly, more complex than those observed in highly defined cellular systems. Future in vivo studies targeting other specific hypothalamic nuclei, or testing the efficacy of specific G
q-coupled receptor-activating ligands in the hypothalamus, should lead to a more complete understanding of the role of tub protein in the normal regulation of food intake and body weight. Finally, our study highlights again the influence of diet composition on insulin action in the CNS. Although virtually nothing is known about the regulation of tub synthesis in normal animals [to date, one report describes effects of a hypothyroid state to increase, decrease, or not change tub expression in the rat brain, with region-specific effects and little effect on the medial hypothalamus (17)], one might speculate that a propensity for elevated endogenous levels of tub might predispose some populations of individuals to become resistant to adiposity signals such as insulin when combined with dietary exposure to moderate or high fat, making these individuals more vulnerable to diet-induced weight gain.
Perspectives.
Downstream intracellular signaling pathways for insulin in the medial hypothalamus may represent novel targets for therapeutic strategies in the treatment of obesity. To this end, the function, regulation, and potential pathophysiological alterations of key signaling molecules need to be understood at both the cellular and the behavioral levels. In addition to providing specific new insight into the action of one candidate signaling molecule, tub, the current study emphasizes the need for experimental approaches that go beyond knockout mouse technology and cultured cell systems to fully elucidate the function of signaling molecules in circumstances that reflect the human obesity environment.
 |
GRANTS
|
|---|
These studies were funded by an Innovation Award from the American Diabetes Association. D. Figlewicz Lattemann is supported by the Dept. of Veterans Affairs and National Institutes of Health (NIH) Grant DK-RO1-40963. J. F. Neumaier is supported by NIH Grant MH-63303.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Scott Ng-Evans and Al Sipols for helpful discussions, and Marcy Hoen for technical assistance with the histological evaluations. We thank Amber Caracol for assistance in the initial characterization of the HA-tub vector.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: D. Figlewicz Lattemann, VA Puget Sound Health Care System (151), 1660 So. Columbian Way, Seattle, WA 98108 (E-mail: latte{at}u.washington.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Ahima RS, Saper CB, Flier JS, and Elmquist JK. Leptin regulation of neuroendocrine systems. Front Neuroendocrinol 21: 263307, 2000.[CrossRef][ISI][Medline]
- Arase K, Fisler JS, York DA, and Bray GA. Intracerebroventricular infusions of 3-OHB and insulin in a rat model of dietary obesity. Am J Physiol Regul Integr Comp Physiol 255: R974R981, 1988.[Abstract/Free Full Text]
- Baskin DG, Figlewicz Lattemann D, Seeley RJ, Woods SC, Porte D Jr, and Schwartz MW. Insulin and leptin: dual adiposity signals to the brain for the regulation of food intake and body weight. Brain Res 848: 114123, 1999.[CrossRef][ISI][Medline]
- Boggon TJ, Shan WS, Santagata S, Myers SC, and Shapiro L. Implication of tubby proteins as transcription factors by structure-based functional analysis. Science 286: 21192125, 1999.[Abstract/Free Full Text]
- Bolanos CA, Perrotti LI, Edwards S, Eisch AJ, Barrot M, Olson VG, Russell DS, Neve RL, and Nestler EJ. Phospholipase c
in distinct regions of the ventral tegmental area differentially modulates mood-related behaviors. J Neurosci 23: 75697576, 2003.[Abstract/Free Full Text]
- Chavez M, Riedy CA, VanDijk G, and Woods SC. Central insulin and macronutrient intake in the rat. Am J Physiol Regul Integr Comp Physiol 271: R727R731, 1996.[Abstract/Free Full Text]
- Chung WK, Goldberg-Berman J, Power-Kehoe L, and Leibel RL. Molecular mapping of the tubby (tub) mutation on mouse chromosome 7. Genomics 32: 210217, 1996.[CrossRef][ISI][Medline]
- Clark MS, Sexton TJ, McClain M, Root D, Kohen R, and Neumaier JF. Overexpression of 5-HT1B receptor in dorsal raphe nucleus using Herpes Simplex Virus gene transfer increases anxiety behavior after inescapable stress. J Neurosci 22: 45504562, 2002.[Abstract/Free Full Text]
- Coleman DL and Eicher EM. Fat (fat) and Tubby (tub): two autosomal recessive mutations causing obesity syndromes in the mouse. J Hered 81: 424427, 1990.[Abstract/Free Full Text]
- Evans SB, Wilkinson CW, Bentson K, Gronbeck P, Zavosh A, and Figlewicz DP. PVN activation is suppressed by repeated hypoglycemia but not antecedent corticosterone in the rat. Am J Physiol Regul Integr Comp Physiol 281: R1426R1436, 2001.[Abstract/Free Full Text]
- Figlewicz DP. Adiposity signals and food reward: expanding the CNS roles of insulin and leptin. Am J Physiol Regul Integr Comp Physiol 284: R882R892, 2003.[Abstract/Free Full Text]
- Guan XM, Yu H, and Van der Ploeg LHT. Evidence of altered hypothalamic pro-opiomelanocortin/neuropeptide Y mRNA expression in tubby mice. Mol Brain Res 59: 273279, 1998.[Medline]
- Heikenwalder MF, Koritschoner NP, Pajer P, Chaboissier MC, Kurz SM, Briegel KJ, Bartunek P, and Zenke M. Molecular cloning, expression and regulation of the avian tubby-like protein 1 (tulp1) gene. Gene 273: 131139, 2001.[CrossRef][ISI][Medline]
- Ikeda A, Nishina PM, and Naggert JK. The tubby-like proteins, a family with roles in neuronal development and function. J Cell Sci 115: 914, 2002.[Abstract/Free Full Text]
- Kapeller R, Moriarty A, Strauss A, Stubdal H, Theriault K, Siebert E, Chickering T, Morgenstern JP, Tartaglia LA, and Lillie J. Tyrosine phosphorylation of tub and its association with Src homology 2 domain-containing proteins implicate tub in intracellular signaling by insulin. J Biol Chem 274: 2498024986, 1999.[Abstract/Free Full Text]
- Kleyn PW, Fan W, and Kovats SG. Identification and characterization of the mouse gene tubby: a member of a novel gene family. Cell 85: 281290, 1996.[CrossRef][ISI][Medline]
- Koritschoner NP, Alvarez-Dolado M, Kurz SM, Heikenwalder MF, Hacker C, Vogel F, Munoz A, and Zenke M. Thyroid hormone regulates the obesity gene tub. EMBO Rep 2: 499504, 2001.[ISI][Medline]
- Li QZ, Wang CY, Shi JD, Ruan QG, Eckenrode S, Davoodi-Semiromi A, Kukar T, Gu Y, Lian W, Wu D, and She JX. Molecular cloning and characterization of the mouse and human TUSP gene, a novel member of the tubby superfamily. Gene 273: 275284, 2001.[CrossRef][ISI][Medline]
- Neve RL, Howe JR, Hong S, and Kalb RG. Introduction of the glutamate receptor subunit 1 into motor neurons in vitro and in vivo using a recombinant herpes simplex virus. Neuroscience 79: 435447, 1997.[CrossRef][ISI][Medline]
- Noben-Trauth K, Naggert JK, North MA, and Nishina PM. A candidate gene for the mouse mutation tubby. Nature 380: 534538, 1996.[CrossRef][Medline]
- North MA, Naggert JK, Yan Y, Noben-Trauth K, and Nishina PM. Molecular characterization of TUB, TULP1, and TULP2, members of the novel tubby gene family and their possible relation to ocular diseases. Proc Natl Acad Sci USA 94: 31283133, 1997.[Abstract/Free Full Text]
- Obici S, Feng Z, Karkanias G, Baskin DG, and Rossetti L. Decreasing hypothalamic insulin receptors causes hyperphagia and insulin resistance in rats. Nat Neurosci 5: 566572, 2002.[CrossRef][ISI][Medline]
- Ohman M, Oksanen L, Kainulainen K, Janne OA, Kaprio J, Koskenwo M, Mustajoki P, Kontula K, and Peltonen L. Testing of human homologues of murine obesity genes as candidate regions in Finnish obese sib pairs. Eur J Human Genetics 7: 117124, 1999.
- Sahly I, Gogat K, Kobetz A, Marchant D, Menasche M, Castel MN, Revah F, Dufier JL, Guerre-Millo M, and Abitbol MM. Prominent neuronal-specific tub gene expression in cellular targets of tubby mice mutation. Human Mol Genetics 7: 14371447, 1998.[Abstract/Free Full Text]
- Saito Y, Cheng M, Leslie FM, and Civelli O. Expression of the melanin-concentrating hormone (MCH) receptor mRNA in the rat brain. J Comp Neurol 435: 2640, 2001.[CrossRef][ISI][Medline]
- Santagata S, Boggon TJ, Baird CL, Gomez CA, Zhao J, Shan WS, Myszka DG, and Shapiro L. G-protein signaling through tubby proteins. Science 292: 20412050, 2001.[Abstract/Free Full Text]
- Schwartz MW, Woods SC, Porte D Jr, Seeley RJ, and Baskin DG. Central nervous system control of food intake. Nature 404: 661671, 2000.[Medline]
- Stubdal H, Lynch CA, Moriarty A, Fang Q, Chickering T, Deeds JD, Fairchild-Huntress V, Charlat O, Dunmore JH, Kleyn P, Huszar D, and Kapeller R. Targeted deletion of the tub mouse obesity gene reveals that tubby is a loss-of-function mutation. Mol Cell Biol 20: 878882, 2000.[Abstract/Free Full Text]
- Tecott LH, Sun LM, Akana SF, Strack AM, Lowenstein DH, Dallman MF, and Julius D. Eating disorder and epilepsy in mice lacking 5HT2c serotonin receptors. Nature 374: 542546, 1995.[CrossRef][Medline]
- VanDijk G, de Groote C, Chavez M, van der Werf Y, Steffens AB, and Strubbe JH. Insulin in the arcuate nucleus of the hypothalamus reduces fat consumption in rats. Brain Res 777: 147152, 1997.[CrossRef][ISI][Medline]
- Zhang M and Kelley AE. Enhanced intake of high-fat food following striatal mu-opioid stimulation: microinjection mapping and Fos expression. Neuroscience 99: 267277, 2000.[CrossRef][ISI][Medline]
- Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, and Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 372: 425432, 1994.[CrossRef][Medline]
Copyright © 2004 by the American Physiological Society.