AJP - Endo Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 286: E795-E808, 2004. First published January 13, 2004; doi:10.1152/ajpendo.00455.2003
0193-1849/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/5/E795    most recent
00455.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hornbuckle, L. A.
Right arrow Articles by O'Brien, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hornbuckle, L. A.
Right arrow Articles by O'Brien, R. M.

Selective stimulation of G-6-Pase catalytic subunit but not G-6-P transporter gene expression by glucagon in vivo and cAMP in situ

Lauri A. Hornbuckle, Carrie A. Everett, Cyrus C. Martin, Stephanie S. Gustavson, Christina A. Svitek, James K. Oeser, Doss W. Neal, Alan D. Cherrington, and Richard M. O'Brien

Department of Molecular Physiology and Biophysics, Vanderbilt University Medical School, Nashville, Tennessee 37232

Submitted 9 October 2003 ; accepted in final form 6 January 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We recently compared the regulation of glucose-6-phosphatase (G-6-Pase) catalytic subunit and glucose 6-phosphate (G-6-P) transporter gene expression by insulin in conscious dogs in vivo (Hornbuckle LA, Edgerton DS, Ayala JE, Svitek CA, Neal DW, Cardin S, Cherrington AD, and O'Brien RM. Am J Physiol Endocrinol Metab 281: E713–E725, 2001). In pancreatic-clamped, euglycemic conscious dogs, a 5-h period of hypoinsulinemia led to a marked increase in hepatic G-6-Pase catalytic subunit mRNA; however, G-6-P transporter mRNA was unchanged. Here, we demonstrate, again using pancreatic-clamped, conscious dogs, that glucagon is a candidate for the factor responsible for this selective induction. Thus glucagon stimulated G-6-Pase catalytic subunit but not G-6-P transporter gene expression in vivo. Furthermore, cAMP stimulated endogenous G-6-Pase catalytic subunit gene expression in HepG2 cells but had no effect on G-6-P transporter gene expression. The cAMP response element (CRE) that mediates this induction was identified through transient transfection of HepG2 cells with G-6-Pase catalytic subunit-chloramphenicol acetyltransferase fusion genes. Gel retardation assays demonstrate that this CRE binds several transcription factors including CRE-binding protein and CCAAT enhancer-binding protein.

insulin; fatty acids; gene transcription; cyclic adenosine monophosphate; glucose-6-phosphatase; glucose 6-phosphate


DURING FASTING CONDITIONS, the liver supplies the body with glucose through the breakdown of glycogen stores and through de novo synthesis from gluconeogenic precursors. Glucose-6-phosphatase (G-6-Pase) catalyzes the final step in both of these pathways, hydrolyzing glucose 6-phosphate (G-6-P) to glucose and inorganic phosphate. In 1975, Arion et al. (6) proposed that G-6-Pase exists as an enzyme system of multiple components, each embedded in the endoplasmic reticulum (ER) membrane. According to this so-called substrate-transport model, G-6-P translocates across the membrane via a specific transporter. Once in the lumen, G-6-P is then hydrolyzed by the system's catalytic subunit, a relatively nonspecific phosphatase. Glucose and inorganic phosphate transporters then shuttle the reaction products, glucose and inorganic phosphate, to the cytoplasm. Although no model of the G-6-Pase system appears to account fully for all the reported kinetic data (22, 55, 76, 77), the validity of the substrate-transport model has been supported by the identification of a G-6-P transporter located in the ER membrane (26, 42).

Pathophysiological conditions arising from aberrant activity of either the G-6-Pase catalytic subunit or the G-6-P transporter have demonstrated the importance of the G-6-Pase system. Inactivating mutations in the G-6-Pase catalytic subunit or G-6-P transporter result in glycogen storage disease types 1a and 1b, respectively; patients with such mutations suffer from severe hypoglycemia in the postabsorbtive state, among other defects (12). Conversely, increased expression of both the G-6-Pase catalytic subunit and G-6-P transporter may contribute to the elevated hepatic glucose production (HGP) characteristic of both poorly controlled type 1 and type 2 diabetes. In the liver of diabetic animal models, mRNA levels of both genes are markedly elevated (4, 29, 40, 44, 50, 56). Furthermore, adenoviral overexpression of either gene in hepatocytes results in enhanced rates of G-6-P hydrolysis and altered glycogen metabolism (1, 70).

We have been interested in investigating whether the expression of the genes encoding the G-6-Pase catalytic subunit and the G-6-P transporter are regulated in parallel in the liver or whether hormones and nutrients differentially regulate their expression. We first addressed this question by examining the effects of insulin and glucose on the expression of these genes in vivo in the liver of conscious dogs. In hyperinsulinemic dogs, the expression of both the G-6-Pase catalytic subunit and G-6-P transporter genes was suppressed (35). This suppression of the expression of both genes by insulin was also apparent in the liver-derived H4IIE cell line (35). In contrast, in hypoinsulinemic dogs, G-6-Pase catalytic subunit mRNA levels were fourfold greater than those of control dogs whereas G-6-P transporter gene expression was unchanged (35). This result indicates that insulin tonically suppresses hepatic G-6-Pase catalytic subunit but not G-6-P transporter gene expression in vivo (35).

Unfortunately, tissue culture studies cannot directly address the question of what factor, or factors, mediate the selective elevation of G-6-Pase catalytic subunit gene expression in the absence of insulin in vivo. Nevertheless, the observation that cAMP selectively stimulated G-6-Pase catalytic subunit gene expression in primary hepatocytes and in H4IIE hepatoma cells suggested that glucagon may contribute to the differential regulation observed in vivo (35). However, fatty acids and glycerol were also candidates to explain this differential regulation because insulin inhibits lipolysis, and therefore the hypoinsulinemia induced in these studies also resulted in an increase in the levels of both nonesterified fatty acids (NEFAs) and glycerol (18). Although the effects of fatty acids and glycerol on G-6-P transporter gene expression have not been reported, both these agents regulate G-6-Pase catalytic subunit gene expression. Thus infusion of conscious rats with triglycerides (51) or treatment of primary hepatocytes with long-chain fatty acids (11) elevates G-6-Pase catalytic subunit mRNA. Additionally, at low concentrations, the gluconeogenic substrate glycerol increases G-6-Pase catalytic subunit mRNA levels in primary hepatocytes (48).

The studies presented here were designed to address the question of what factor, or factors, are candidates to mediate the selective elevation of G-6-Pase catalytic subunit gene expression in the absence of insulin in vivo. This was achieved by using the metabolically clamped, conscious dog model to assess the effects of glucagon, fatty acids, and glycerol on hepatic G-6-Pase catalytic subunit and G-6-P transporter gene expression.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. [{alpha}-32P]dATP (>3,000 Ci/mmol), [{gamma}-32P]ATP (>5,000 Ci/mmol), and [{alpha}-32P]UTP (>3,000 Ci/mmol) were obtained from Amersham. d-[3-3H]glucose (10–20 Ci/mmol) was obtained from Perkin Elmer. Somatostatin was purchased from Bachem. For dog and tissue culture studies, glucagon was obtained from Bedford Laboratories. For dog studies, porcine insulin was purchased from Eli Lilly, whereas for tissue culture studies recombinant human insulin was obtained from Collaborative Bioproducts. Dexamethasone 21-phosphate and 8-(4-chlorophenylthio)adenosine-3':5'-cyclic monophosphate (pCPT-cAMP) were purchased from Sigma Chemical and Boehringer Mannheim, respectively. Human genomic DNA was purchased from Promega. Antisera raised against various CCAAT enhancer-binding protein (C/EBP) isoforms were generously provided by Dr. Steven L. McKnight (8). Antiserum raised against CRE-binding protein (CREB) was purchased from NEB-Cell Signaling Technology (cat. no. 9192).

Animal care. Experiments were conducted on fourteen 18-h-fasted conscious mongrel dogs (19–30 kg) of either sex that had been fed a standard diet of meat (Pedigree canned beef, Vernon, CA) and chow (Laboratory Canine Diet no. 5006; PMI Nutrition International, Brentwood, MO) once daily. The diet totaled 33% protein, 12% fat, 49.5% carbohydrates, and 5% fiber, based on dry weight. Only dogs that had a good appetite, a leukocyte count <18,000/mm3, a hematocrit >35%, and normal stools were used for studies. The animal housing and surgical facilities met American Association for the Accreditation of Laboratory Animal Care standards. Protocols were approved by the Vanderbilt University Medical Center Animal Care Committee.

Animal surgical procedures. Each dog underwent a laporatomy performed under general anesthesia (15 mg/kg pentothal sodium presurgery and 1% isoflurane during surgery) 14–16 days before the experiment to implant catheters into the appropriate vessels. Silastic catheters (0.03 in. ID; Dow-Corning, Midland, MI) were placed into jejunal and splenic veins for the intraportal infusion of pancreatic hormones. Catheters (0.04 in. ID) for blood sampling were placed into the left hepatic vein, the hepatic portal vein, and left femoral artery, as previously described (16). All catheters were filled with heparinized saline (200 U/ml; Abbott Laboratories, North Chicago, IL), and their free ends were knotted before closure of the skin. The catheters were placed in a subcutaneous pocket before closure of the abdominal skin.

On the day of the experiment, the catheters were externalized under local anesthesia (2% lidocaine; Abbott Laboratories). The contents of each catheter were aspirated and the catheters flushed with saline. The intraportal catheters (splenic and jejunal) were used for the infusion of glucagon and insulin. Angiocaths were inserted percutaneously into peripherial veins for the infusion of [3-3H]glucose plus indocyanine green (Becton Dickinson, Cokeysville, MD), as well as the infusion of somatostatin and Intralipid plus heparin infusions. Each animal was allowed to rest quietly in a Pavlov harness for 30 min before the start of the experiment.

Animal experimental procedures. Each experiment consisted of a tracer and dye equilibration period (–140 to –40 min), a basal period (–40 to 0 min), and an experimental period (0 to 195 min). At –140 min, a priming dose of [3-3H]glucose (33.3 µCi) was given and a constant infusion of [3-3H]glucose (0.35 µCi/min) was begun to allow the assessment of HGP. Constant infusions of indocyanine green (0.077 mg/min), to assess hepatic blood flow, and somatostatin (0.8 µg·kg–1·min–1), to inhibit endogenous insulin and glucagon secretion, were also started at –140 min. [3-3H]glucose, indocyanine green, and somatostatin were given via a leg vein. A constant intraportal infusion of glucagon (0.55 ng·kg–1·min–1) was given (t = –140 min) to replace basal endogenous glucagon secretion. Endogenous insulin was replaced at a variable intraportal infusion rate from –140 to –40 min. The plasma glucose level was monitored every 5 min, and euglycemia was maintained by adjusting the rate of insulin infusion. Once the plasma glucose level had been stabilized at euglycemia for 30 min, basal sampling began and the infusion rate of insulin remain unchanged thereafter.

The study included four protocols. In protocol 1, [hyperglycemia (HG); n = 3], a hyperglycemic clamp was performed. At 15 min, 20% dextrose was infused via a leg vein to clamp the arterial glucose levels at the levels seen in the groups receiving three times basal glucagon.

In protocol 2 [HG and elevated glucagon (HG + GGN); n = 4], at 15 min, the intraportal glucagon infusion was increased from 0.55 ng·kg–1·min–1 to three times the basal rate (1.65 ng·kg–1·min–1).

In protocol 3 [HG and elevated fatty acids and glycerol (HG + NEFA); n = 3], a constant Intralipid (0.02 ml·kg–1·min–1) 20% fat emulsion (Baxter Healthcare, Deerfield, IL) plus heparin (0.5 U·kg–1·min–1) infusion was started at 0 min in the presence of a hyperglycemic clamp. At 15 min, 20% dextrose was infused via a leg vein to clamp the arterial glucose levels at the increasing levels seen in the groups receiving three times basal glucagon.

In protocol 4 (HG + GGN + NEFA; n = 4), a constant Intralipid (0.02 ml·kg–1·min–1) plus heparin (0.5 U·kg–1·min–1) infusion was started at 0 min via a leg vein. After a NEFA-glycerol equilibration period (15 min), the intraportal glucagon infusion was increased from 0.55 to 1.65 ng·kg–1·min–1, as seen in protocol 2.

The glucagon infusion rate was increased by 7% every hour to correct for glucagon degradation in the groups receiving three times basal glucagon. Arterial blood samples were taken every 10 min during the control period and every 15 min during the experimental period. In the HG and HG + NEFA groups, arterial blood samples were also taken every 5 min to monitor glucose levels. The total blood volume withdrawn did not exceed 20% of the dog's total blood volume. No significant decrease in hematocrit was observed with this procedure.

Immediately following the final blood sample, each animal was anesthetized with pentobarbital sodium. The animal was then removed from the harness while the hormones, Intralipid-heparin, and/or glucose continued to be infused. A midline laporotomy incision was made, and clamps cooled in liquid nitrogen were used to freeze sections of hepatic lobes two, three, and seven in situ. The hepatic tissue was then cut free, placed in liquid nitrogen, and stored at –70°C. Approximately 2 min elapsed between the time of anesthesia and the time of tissue clamping. All animals were then euthanized.

Animal sample collecting, processing and analysis. Immediately after each blood sample was drawn, the blood was centrifuged to obtain plasma. Four 10-µl aliquots of plasma were immediately analyzed for glucose by the glucose oxidase method with a Beckman glucose analyzer (Beckman Instruments, Fullerton, CA). A 1-ml aliquot of whole blood was lysed with 3 ml of 4% perchloric acid. The solution was centrifuged and the supernatant stored for the future analysis of whole blood glycerol. A second 1-ml aliquot of whole blood was treated with 20 µl of an antioxidant (0.2 M glutathione) and centrifuged. This supernatant was then stored for the future determination of catecholamines, epinephrine and norepinephrine. A 1-ml aliquot of plasma received 50 µl of 100,000 kallikrein inhibitor units/ml (Trasylol; FBA Pharmaceuticals, New York, NY) and was stored for analysis of immunoreactive glucagon. The remainder of the plasma was used for analysis of insulin and NEFA. All samples were kept in an ice bath during the experiment and were then stored at –70°C until the assays were performed. Whole blood glycerol concentrations were determined according to the enzymatic methods of Lloyd et al. (45) for the Technicon Autoanalyzer (Tarrytown, NY) and were modified for the Monarch 2000 centrifugal analyzer (Lexington, MA). The levels of epinephrine and norepinephrine were assessed using high-performance liquid chromatography as previously described (57). Immunoreactive insulin was measured using a double-antibody radioimmunoassay (59). Immunoreactive glucagon was measured using a modification of the double-antibody insulin method (59). Plasma NEFA were determined spectrophotometrically using the Monarch 2000 centrifugal analyzer and a kit obtained from Wako Chemicals (Richmond, VA).

Because the total blood flow entering the liver comes from two sources, 20% from the hepatic artery and 80% from the portal vein, the hepatic sinusoidal concentration of a substance can be calculated as the arterial concentration multiplied by 0.2 plus the portal concentration multiplied by 0.8 ([A]·0.2) + ([P]·0.8).

Cell culture. Human HepG2 hepatoma cells were grown in Dulbecco's modified Eagle's medium containing 2.5% (vol/vol) newborn calf serum, 2.5% (vol/vol) fetal calf serum, and 5% (vol/vol) Nu serum IV (Collaborative Research), as previously described (61, 74).

RNA isolation. After a 16-h period of serum starvation, HepG2 cells were incubated in fresh serum-free Dulbecco's modified Eagle's medium supplemented with various combinations of pCPT-cAMP (100 µM), dexamethasone (500 nM), and insulin (100 nM), as indicated in the figure legends. Total RNA was then isolated at the times indicated in the figure legends by cesium chloride centrifugation (see Fig. 5), as previously described (17). TRI Reagent (Molecular Research Center) was used to isolate total RNA from dog liver samples, according to the manufacturer's instructions.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5. Multihormonal regulation of G-6-Pase catalytic subunit and G-6-P transporter gene expression in the human HepG2 hepatoma cell line. After 16-h serum starvation, HepG2 cells were placed in fresh, serum-free medium in the absence (C) or presence of various combinations of 500 nM dexamethasone (D), 100 µM 8-(4-chlorophenylthio)-cAMP (pCPT-cAMP; A), or 100 nM insulin (I). Three hours later, total RNA was isolated, and G-6-Pase catalytic subunit mRNA and G-6-P transporter mRNAs were then quantified, as described in METHODS, by primer extension or RPA, respectively. A: representative autoradiographs. B: means ± SE of 3 experiments each performed with independent RNA preparations. Data are expressed as the ratio of G-6-Pase catalytic subunit mRNA or G-6-P transporter mRNA to cyclophilin A mRNA relative to that in control cells. *P < 0.05 vs. control.

 
Isolation of genomic DNA fragments for the generation of antisense ribonuclease protection assay probes. With human genomic DNA as the template, a fragment of exon 3 of the human G-6-P transporter gene (26) was generated using PCR in conjunction with the following primers: 5'-GGAATTCCGGAGTCCAACATCAGCAGGTTC-3' and 5'-CCCAAGCTTGCCATCTCAGTTTGGCACTTGGTGG-3' (EcoRI and HindIII cloning sites underlined). The isolated PCR fragment was then digested with EcoRI and HindIII and ligated into the EcoRI- and HindIII-digested pGEM7 vector (Promega) and then sequenced using the USB sequenase kit. The sequence of the human G-6-P transporter fragment was identical to that previously reported (26). The plasmid was linearized with HindIII such that in vitro transcription using T7 polymerase generated a 254-nucleotide antisense RNA probe.

The generation of plasmids containing genomic DNA fragments of the dog genes encoding the G-6-P transporter, the G-6-Pase catalytic subunit, and cyclophilin A has been previously described (35). These plasmids were linearized with HindIII or SacI, as previously described (35), such that in vitro transcription using T7 polymerase generated 254-, 335-, or 121-nucleotide antisense RNA probes, respectively. A linearized plasmid containing a fragment of the human cyclophilin A gene was purchased from Ambion and was used to generate a 165-nucleotide antisense probe.

Ribonuclease protection assay. [{alpha}-32P]UTP-labeled antisense dog G-6-P transporter, G-6-Pase catalytic subunit, and cyclophilin A probes, as well as human G-6-P transporter and cyclophilin A probes, were generated using the linearized plasmids described above and the MAXIscript T7 kit (Ambion) according to the manufacturer's instructions. Ribonuclease protection assays (RPAs)were performed using 10 µg of total dog liver or HepG2 RNA and the RPA III kit (Ambion), again according to the manufacturer's instructions except that the combined RNA and probe precipitate were dissolved in 1 µl of water before the addition of 10 µl of hybridization buffer. After RNase A/T1 digestion, RNA products were resolved on 5% polyacrylamide-urea-TBE gels and sizes estimated by comparison with coelectrophoresed DNA sequencing reactions. The sizes of the human G-6-P transporter and human cyclophilin A products were close to the calculated sizes of 201 and 103 nucleotides, respectively. The human G-6-P transporter product appeared as a doublet (see Fig. 5), probably because the EcoRI site used in the cloning of the PCR product is partially homologous to the gene sequence. The sizes of the dog G-6-Pase catalytic subunit, G-6-P transporter, and cyclophilin A products were close to the calculated sizes of 256, 201, and 68 nucleotides, respectively. Data were quantitated through the use of a Packard Instant Imager.

Primer extension analysis. A 29-nucleotide primer (5'-AACCAGTCCTGGGAGTCTTGGTAATTCAC-3'), complementary to exon 1 of the human G-6-Pase catalytic subunit gene (39), was synthesized for the analysis of G-6-Pase catalytic subunit gene expression in HepG2 cells (Fig. 5). A 30-nucleotide primer (5'-ATGTCGAAGAACACGGTGGGGTTGACCATG-3'), complementary to exon 1 of the mouse, rat, and human cyclophilin A genes (15, 30, 32), was synthesized for use as a nonhormonally responsive internal control. After gel purification, these primers were 5' end-labeled with [{gamma}-32P]ATP to a specific activity of ~2 Ci/µmol (66). The labeled primers (~3 x 105 cpm) were then annealed to 50 µg of total HepG2 RNA for 1 h at 60°C, and then primer extension was performed as previously described (21). Extension products were visualized by electrophoresis on polyacrylamide-urea-TBE gels (21). The sizes of the extension products were calculated by comparison with a DNA sequencing ladder. The human G-6-Pase catalytic subunit primer gave the predicted extension product of 168 nucleotides (39). With HepG2 RNA, the cyclophilin A primer gave a cluster of extension products between 73 and 75 nucleotides (Fig. 5); the published transcription start site predicts a product of 73 nucleotides with this primer (30). Data were quantitated through the use of a Packard Instant Imager.

Fusion gene plasmid construction. The generation of mouse G-6-Pase catalytic subunit-chloramphenicol acetyltransferase (CAT) and G-6-Pase catalytic subunit-luciferase fusion genes, both containing promoter sequence spanning nucleotides –231 to +66 relative to the transcription start site and the site-directed mutants (SDM) of the two putative G-6-Pase CRE motifs (see Fig. 6) in the context of the –231 G-6-Pase catalytic subunit-CAT fusion gene (designated –231 CRE1 SDM and –231 CRE2 SDM) have all been previously described (47, 72, 75).

The generation of the heterologous XMB vector that contains a minimal Xenopus 68-kDa albumin promoter ligated to the CAT reporter gene has previously been described (10), as have the CRE1 WT XMB, CRE1 MUT XMB, and CRE2 WT XMB plasmids, which contain multiple (3–4) copies of double-stranded, complementary oligonucleotides representing the wild-type or mutated G-6-Pase catalytic subunit CRE1 and CRE2 motifs ligated into the XMB vector (75).

Expression vectors encoding the {alpha}- and {beta}-forms of the catalytic subunit of protein kinase A (PKA) were a generous gift from Dr. Richard A. Maurer (53). An empty-vector control was generated by digesting the PKA-{beta} plasmid with XhoI and HindIII to remove the open reading frame, filling in the noncompatible ends with the Klenow fragment of Escherichia coli DNA polymerase I and then religating. An expression vector encoding the glucagon receptor was a generous gift from Dr. Thomas P. Sakmar (9). All plasmid constructs were purified by centrifugation through cesium chloride gradients (66).

Transient transfections, CAT, {beta}-galactosidase, and luciferase assays. HepG2 cells were transiently transfected in suspension with the plasmids indicated in the figure legends by use of the calcium phosphate-DNA coprecipitation method as previously described (61, 74). Where indicated in the figure legends, the CAT or firefly luciferase reporter gene construct (15 µg) was cotransfected with expression vectors encoding either {beta}-galactosidase (2.5 µg), Renilla luciferase (0.15 µg), the glucagon receptor (5 µg), the catalytic subunit of PKA-{alpha} (5.0 µg), or the same vector with the PKA open reading frame deleted (5.0 µg). CAT, {beta}-galactosidase, and luciferase assays were performed exactly as previously described (47, 61, 74). In contrast to previous experiments (73, 75), we observed that PKA slightly stimulated Rous sarcoma virus-{beta}-galactosidase expression in the HepG2 cells used in these experiments. Therefore, CAT activity in control and PKA-cotransfected cells was corrected for {beta}-galactosidase activity or for the protein concentration in the cell lysate, respectively. In experiments using glucagon (see Fig. 4), firefly luciferase activity directed by the –231 G-6-Pase catalytic subunit-luciferase fusion gene construct was corrected for the Renilla luciferase activity in the same samples. Each construct was analyzed in duplicate in multiple transfections, as specified in the figure legends.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Glucagon stimulates G-6-Pase catalytic subunit-luciferase fusion gene transcription in HepG2 cells. A and B: HepG2 cells were transiently cotransfected, as described in METHODS, with a G-6-Pase catalytic subunit-luciferase fusion gene (15 µg), containing promoter sequence from –231 to +66, with an expression vector encoding Renilla luciferase (0.15 µg) and either with (+GREV) or without (–GREV) an expression vector encoding the glucagon receptor (5 µg). After transfection, cells were incubated for 18–20 h in serum-free medium in the presence or absence of 100 nM glucagon. C: HepG2 cells were transiently cotransfected, as described in METHODS, with a G-6-Pase catalytic subunit-luciferase fusion gene (15 µg), containing promoter sequence from –231 to +66, and expression vectors encoding Renilla luciferase (0.15 µg) and the glucagon receptor (5 µg). After transfection, cells were incubated for 18–20 h in serum-free medium in the presence or absence of various concentrations of glucagon. Cells were then harvested, and firefly and Renilla luciferase activity was assayed as described in METHODS. In A and C, results are presented as the ratio of firefly luciferase activity, corrected for Renilla luciferase in the same lysate, in glucagon-treated vs. control cells and are expressed as fold induction. In B, results are presented as the ratio of firefly to Renilla luciferase activity in control cells and are expressed as arbitrary units. Experiments were performed using 3–4 independent preparations of the G-6-Pase catalytic subunit fusion gene construct, and results represent means ± SD.

 
Gel retardation assay. HepG2 nuclear extracts were prepared by a modification of the method of Andrews and Faller (2) using NP-40 to isolate nuclei (69). Briefly, cells were lysed in 10 mM Tris·HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.5% NP-40, 0.5 mM DTT, 0.5 mM PMSF, and 1X protease inhibitor cocktail (Roche), and the isolated nuclei were extracted using 20 mM HEPES (pH 7.9), 0.4 M NaCl, 0.75 mM spermidine, 0.15 mM spermine, 0.2 mM EDTA, 2 mM EGTA, 25% glycerol, 2 mM DTT, and 1 mM PMSF. The protein concentration of the nuclear extract was determined by the Bio-Rad assay and was typically ~5 µg/µl.

Oligonucleotides representing the sense and antisense wild-type mouse G-6-Pase catalytic subunit CRE1 promoter sequence [sense: AG(–175)CTGTTTTGCTATTTTACGTAAATCACCCTGAACA(–142); HindIII compatible end underlined; CRE core in italics] and a consensus CRE (sense: GATCAGATTGCCTGACGTCAAGAGCT; BamHI compatible end underlined; CRE core in italics) were synthesized and subsequently gel purified, annealed, and labeled with [{alpha}-32P]dATP by using the Klenow fragment of E. coli DNA Polymerase I to a specific activity of ~2.5 µCi/pmol (66). The labeled double-stranded oligonucleotide probes (~7 fmol, ~50,000 cpm) were incubated with HepG2 nuclear extract (8 µg) in a final reaction volume of 20 µl containing 20 mM HEPES (pH 7.9), 100 mM NaCl, 0.06 mM spermidine, 0.01 mM spermine, 0.5 mM EDTA, 0.5 mM EGTA, 1 mM DTT, 12.5% glycerol (vol/vol), 0.5 µg of poly(dI-dC)·poly(dI-dC), and 0.5 µg of poly(dA-dT)·poly(dA-dT). After incubation for 20 min at room temperature, the reactants were loaded onto a 6% polyacrylamide gel and electrophoresed for 90 min at 150 V at room temperature in a buffer containing 25 mM Tris (pH 7.8), 190 mM glycine, and 1 mM EDTA. After electrophoresis, the gels were dried and exposed to Kodak XAR5 film, and binding was analyzed by autoradiography.

For competition experiments, a 100-fold molar excess of various unlabeled double-stranded oligonucleotides (see Fig. 8) were incubated with the labeled oligomer before the addition of HepG2 nuclear extract. Gel supershift assays were carried out by incubating HepG2 nuclear extract with the indicated antisera (1 µl) for 10 min on ice before the addition of the labeled oligonucleotide probe and binding buffer and incubation for an additional 20 min at room temperature. Binding was then analyzed by polyacrylamide gel electrophoresis as described above.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 8. CRE1 motif binds CRE-binding protein (CREB), CCAAT enhancer-binding protein-{alpha} (C/EBP{alpha}), C/EBP{beta}, and C/EBP{delta}. A: labeled G-6-Pase catalytic subunit wild-type (WT) CRE1 and consensus WT CRE oligonucleotides probes were incubated in the absence (–) or presence of a 100-fold molar excess of the unlabeled CRE1 WT or mutant oligonucleotide competitors or the consensus CRE WT or an unrelated random (RN) oligonucleotide competitor, respectively, before addition of HepG2 cell nuclear extract. Alternatively, HepG2 cell nuclear extract was incubated in the absence (–) or presence of a CREB antiserum for 10 min on ice before addition of the labeled WT CRE1 or consensus CRE oligonucleotide probes and incubation for an additional 20 min at room temperature. Protein binding was then analyzed as described in METHODS. In the representative autoradiograph shown, only the retarded complexes are visible, not the free probe, which was present in excess. B: HepG2 cell nuclear extract was incubated in the absence (–) or presence of the indicated antisera for 10 min on ice before addition of the labeled WT CRE1 oligonucleotide probe and incubation for an additional 20 min at room temperature. Protein binding was then analyzed as described in METHODS. In the representative autoradiograph shown, only the retarded complexes are visible, not the free probe, which was present in excess. Arrows point to 4 complexes that bind the WT but not the mutant CRE1 oligonucleotide and that contain CREB (complex 1), C/EBP{alpha} (complexes 2 and 3), and C/EBP{beta} (complex 4).

 
Statistical analysis. The animal study data were analyzed for differences between basal period and experimental period values by use of a paired Student's t-test and for differences from the control group values by use of an unpaired Student's t-test. The RNA study and transfection data were analyzed for differences from the control group values using an unpaired Student's t-test. The level of significance was P < 0.05 (two-sided test).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Metabolic parameters of in vivo conscious dog studies. Four protocols were utilized in which glucagon, free fatty acids, and glycerol were selectively manipulated in conscious dogs in vivo (Fig. 1). This was achieved, following an 18-h fast, by the continuous administration of somatostatin throughout the study so as to block endogenous pancreatic hormone secretion. In all four protocols, hyperglycemia was achieved during the experimental period either directly through glucose infusion or as a consequence of elevated glucagon levels (Fig. 1). We have previously shown that the level of hyperglycemia achieved (~200 mg/dl) has no effect on G-6-Pase catalytic subunit or G-6-P transporter gene expression in conscious dogs in vivo (35). Insulin was infused at a rate sufficient to achieve euglycemia during the basal period; this insulin infusion rate was maintained during the experimental period. This strategy was designed to offset variations in insulin sensitivity between animals and so ensure a similar degree of insulin signaling in each animal. Thus the actual basal insulin concentration required to achieve euglycemia varied modestly between animals. Either glucagon was supplied at basal rates during the basal and experimental periods with glucose and then clamped at a hyperglycemic level during the experimental period, or it was supplied at approximately threefold the basal rate during the experimental period, in which case glucose was permitted to respond to the change in glucagon concentration (Fig. 1). The study was designed so that the level of hyperglycemia achieved was similar in each case. Finally, infusions of the triglyceride emulsion Intralipid allowed manipulation of both fatty acid and glycerol concentrations to a level approximately threefold above basal. The actual changes in sinusoidal plasma glucose, insulin, glucagon, NEFA, and glycerol levels in the four experimental groups during the transition between the basal and experimental periods are described in the legend to Fig. 1. The mean levels ± SE during the final 2 h of the experimental period are shown in Fig. 2. The data in Fig. 2 show that these experimental manipulations achieved the desired goals. Thus glucose (Fig. 2A) and insulin (Fig. 2B) levels were statistically no different among the four groups of animals, whereas glucagon levels were selectively increased in protocols 2 and 4 (Fig. 2C). Similarly, glycerol (Fig. 2D) and NEFA levels (Fig. 2E) were selectively increased in protocols 3 and 4.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of the 4 in vivo conscious dog protocols. Protocol 1 (hyperglycemia, HG): beginning at 15 min, the glucose infusion rate was increased to raise arterial plasma glucose levels to ~200 mg/dl. No changes were made in hormone infusion rates after the equilibration period. Sinusoidal plasma glucose levels rose from 104 ± 4 mg/dl during the basal period to 178 ± 22 mg/dl (P = 0.058) during the final 2 h of the study. Sinusoidal insulin, glucagon, nonesterified fatty acids (NEFA), and glycerol concentrations remained at basal levels and relatively unchanged throughout the experimental period. Protocol 2 (HG + elevated glucagon; HG + GGN): beginning at 15 min, the intraportal glucagon infusion rate was increased to 1.65 ng·kg–1·min–1. Glucose and insulin infusion rates were not altered after the equilibration period. Sinusoidal glucagon levels rose from 69 ± 3 pg/ml during the basal period to 168 ± 21 pg/ml (P < 0.05) and sinusoidal glucose levels from 116 ± 8 to 196 ± 10 mg/dl (P < 0.05) during the final 2 h of the study. Sinusoidal insulin remained at basal levels and relatively unchanged throughout the experimental period. However, NEFA levels fell slightly but significantly from 690 ± 113 µmol/l during the basal period to 454 ± 69 µmol/l (P < 0.05) during the final 2 h of the study, and glycerol levels declined from 104 ± 21 to 70 ± 14 µmol/l (P < 0.05). Protocol 3 (HG + elevated fatty acids and glycerol; HG + NEFA): at 0 min, peripheral infusion of Intralipid (20%, 0.2 ml·kg–1·min–1) was begun, accompanied by simultaneous heparin infusion (0.5 U·kg–1·min–1) to stimulate lipolysis. Beginning at 15 min, the arterial plasma glucose level was raised to ~200 mg/dl by an increase in the glucose infusion rate. Hormone infusion rates were not changed after the equilibration period. Sinusoidal glucose levels rose from 94 ± 4 mg/dl during the basal period to 192 ± 10 mg/dl (P < 0.05) during the final 2 h of the study. Sinusoidal NEFA and glycerol levels increased from 496 ± 33 to 1,570 ± 158 µmol/l (P < 0.05) and from 61 ± 8 to 179 ± 9 µmol/l (P < 0.05), respectively, during the final 2 h of the study. Sinusoidal insulin and glucagon concentrations remained at basal levels and relatively unchanged throughout the experimental period. Protocol 4 HG + GGN + NEFA): beginning at 0 min, infusions of Intralipid and heparin were begun as in protocol 3, and beginning at 15 min the glucagon infusion rate was increased to 1.65 ng·kg–1·min–1 as in protocol 2. Sinusoidal glucagon levels increased from 56 ± 4 pg/ml during the basal period to 164 ± 27 pg/ml (P < 0.05) during the final 2 h of the study. Sinusoidal NEFA levels increased from 544 ± 83 to 1,473 ± 150 µmol/l (P < 0.05) and glycerol levels from 64 ± 7 to 189 ± 12 µmol/l (P < 0.05) during the final 2 h of the study. Sinusoidal plasma glucose levels rose from 108 ± 7 to 219 ± 23 mg/dl (P < 0.05) during the final 2 h of the study. Insulin infusion rates were not changed after the equilibration period; however, sinusoidal insulin levels rose slightly from 16 ± 1 to 22 ± 2 µU/ml (P < 0.05) during the final 2 h of the study.

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Quantitation of plasma glucose, insulin, glucagon, fatty acid, and glycerol concentrations in the 4 in vivo conscious dog protocols. Hepatic sinusoidal plasma glucose (A), hepatic sinusoidal plasma insulin (B), hepatic sinusoidal plasma glucagon (C), hepatic sinusoidal plasma glycerol (D), and hepatic sinusoidal plasma NEFA (E) levels in 18-h-fasted conscious dogs during the last 2 h of the 195-min experimental period. Results represent mean values ± SE in samples isolated from 3–4 independent animals in each experimental protocol, with all samples assayed in duplicate. *P < 0.05 vs. control.

 
Selective regulation of G-6-Pase catalytic subunit and G-6-P transporter gene expression in vivo. Freeze-clamped liver samples were removed from anesthetized dogs immediately after the experimental period. Total RNA was then isolated and RPAs were performed to quantify G-6-Pase catalytic subunit, G-6-P transporter, and cyclophilin A mRNA levels. RPA probes representing fragments of the dog G-6-Pase catalytic subunit, G-6-P transporter, and cyclophilin A genes were all generated using PCR in conjunction with primers representing conserved sequences in the mouse, rat, and human genes. Expression of the latter is not responsive to hormones/metabolites so that it serves as an internal control. Therefore, the effects of glucagon, fatty acids, and glycerol on G-6-Pase catalytic subunit and G-6-P transporter mRNA levels are quantitated relative to the level of cyclophilin A mRNA in the same samples.

As shown in Fig. 3, when glucagon levels were elevated above basal, and glucose levels were allowed to rise in response (protocol 2), G-6-Pase catalytic subunit mRNA levels increased ~2.5-fold over those assayed in hyperglycemic animals (protocol 1) (P < 0.05). In contrast, G-6-P transporter gene expression was not significantly changed (Fig. 3). This stimulation of G-6-Pase catalytic subunit gene expression cannot be due to the secondary rise in glucose levels induced by the elevation in glucagon concentration, since the glucose level achieved was identical to that in hyperglycemic animals (Fig. 2). In contrast to the effect of glucagon, infusion of Intralipid failed to stimulate an increase in either G-6-Pase catalytic subunit or G-6-P transporter gene expression (Fig. 3). Moreover, the magnitude of the stimulatory effect of glucagon on G-6-Pase catalytic subunit gene expression in combination with Intralipid was no different from that seen in the presence of glucagon alone (Fig. 3).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Selective regulation of glucose-6-phosphatase (G-6-Pase) catalytic subunit (Cat. Sub.) and glucose 6-phosphate (G-6-P) transporter gene expression by glucagon in dog liver in vivo. After pancreatic clamping, as shown in Fig. 1, liver samples were removed, and total RNA was isolated. G-6-Pase catalytic subunit mRNA, G-6-P transporter mRNA, and cyclophilin A (Cyclo) mRNA were then quantified, as described in METHODS, using the ribonuclease protection assay (RPA). Data are expressed as the ratio of G-6-Pase catalytic subunit mRNA (A) or G-6-P transporter mRNA (B) to cyclophilin A mRNA, and results represent the mean ratio ± SE in RNA preparations isolated from 3–4 independent animals in each experimental protocol, with all samples assayed in duplicate. *P < 0.05 vs. control.

 
G-6-Pase catalytic subunit and G-6-P transporter mRNA levels do not vary with location within the liver. The canine liver can be functionally divided into seven lobes according to the relative contributions of the hepatic artery and portal vein to the blood supply (19). However, the data shown in Fig. 3 were obtained using RNA isolated from only hepatic lobe 7 of each dog. Therefore, we were concerned about the theoretical possibility that the basal and/or hormone-regulated expression of the G-6-Pase catalytic subunit and G-6-P transporter genes might vary between different liver lobes. Indeed, the expression levels of some genes, such as c-fos, do vary between lobes (33), although others, such as collagen, do not (25). We therefore compared the relative expression level of these genes in liver lobes 2, 3, and 7 in eight individual metabolically clamped dogs. Four of these dogs had been subjected to hyperglycemia (28), and four had been subjected to hyperglycemia plus elevated glucagon (protocol 2; Fig. 1). There were no significant differences in the expression level of either gene among the three lobes examined, regardless of the experimental conditions (data not shown). This suggests that the results shown in Fig. 3 are representative of G-6-Pase catalytic subunit and G-6-P transporter mRNA levels throughout the liver.

Glucagon stimulates G-6-Pase catalytic subunit fusion gene expression in HepG2 hepatoma cells. The results from the in vivo dog liver studies described above suggest that elevation of glucagon levels can selectively induce G-6-Pase catalytic subunit gene expression. This stimulation of G-6-Pase catalytic subunit gene expression by glucagon in vivo cannot be due to the secondary rise in glucose levels induced by the elevation in glucagon concentration, since the glucose level achieved was identical to that in the control hyperglycemic animals (Fig. 2). However, this experiment cannot formally rule out the possibility that glucagon alters the abundance of another metabolite/factor that then mediates the induction of G-6-Pase catalytic subunit gene expression.

To address this caveat, a G-6-Pase catalytic subunit-luciferase fusion gene, containing G-6-Pase catalytic subunit promoter sequence from –231 to +66, relative to the transcription start site at +1 (47, 72), was transiently transfected into HepG2 cells, and the effect of glucagon on fusion gene expression was assessed (Fig. 4). Although it has been reported that HepG2 cells respond to glucagon treatment (71), most studies suggest that glucagon receptors are markedly downregulated in hepatoma cells (20, 54). Not surprisingly, therefore, glucagon failed to induce G-6-Pase catalytic subunit-luciferase fusion gene expression in HepG2 cells (Fig. 4A). However, glucagon did stimulate reporter gene expression when the G-6-Pase catalytic subunit-luciferase fusion gene was cotransfected with an expression vector encoding the glucagon receptor (Fig. 4A). In the absence of glucagon, cotransfection with the glucagon receptor alone had little effect on G-6-Pase catalytic subunit-luciferase fusion gene expression, suggesting a low level of signaling through the basal receptor (Fig. 4B). The maximal effect of glucagon on G-6-Pase catalytic subunit-luciferase gene expression was seen at ~100 nM (Fig. 4C). This result suggests that glucagon signaling can directly stimulate G-6-Pase catalytic subunit gene expression.

cAMP stimulates endogenous G-6-Pase catalytic subunit, but not G-6-P transporter, gene expression in HepG2 hepatoma cells. Because HepG2 cells are transfected with a low efficiency, it was not possible to look at the effect of glucagon on endogenous G-6-Pase catalytic subunit gene expression. Therefore, we treated cells with the cAMP analog pCPT-cAMP for 3 h after overnight serum starvation and then harvested total RNA. Primer extension analyses and RPAs were used to quantify G-6-Pase catalytic subunit and G-6-P transporter mRNA levels, respectively, and expression of the cyclophilin A gene was again used as an internal control. As shown in Fig. 5, pCPT-cAMP treatment stimulated endogenous G-6-Pase catalytic subunit mRNA expression approximately threefold but did not affect G-6-P transporter mRNA levels. In addition, insulin repressed the endogenous basal expression of both genes. Both of these observations are consistent with the regulation of the equivalent hepatic dog genes by glucagon (Fig. 3) and insulin (35). Figure 5 also shows that insulin represses the cAMP-induced expression of the endogenous G-6-Pase catalytic subunit gene in HepG2 cells. This observation is also consistent with the regulation of the hepatic dog G-6-Pase catalytic subunit gene in vivo. Thus, because the induction of G-6-Pase catalytic subunit gene expression during hypoinsulinemia (35) may be explained by the unopposed action of glucagon (Fig. 3), this suggests that basal insulin normally suppresses the stimulatory effect of basal glucagon. Although the hormonal regulation of endogenous G-6-Pase catalytic subunit gene expression in HepG2 cells closely matches that seen in dog liver, this does not extend to the effect of glucocorticoids. Thus glucocorticoids induce expression of the endogenous hepatic G-6-Pase catalytic subunit gene (24), but the synthetic glucocorticoid analog dexamethasone did not significantly stimulate expression of this gene, or the G-6-P transporter gene, in HepG2 cells (Fig. 5). We have previously shown that dexamethasone stimulates the expression of both genes in H4IIE rat hepatoma cells (35), suggesting that these cells are a better model, at least with respect to glucocorticoid signaling.

Analysis of CREs in mouse G-6-Pase catalytic subunit promoter. Two regions of the human G-6-Pase catalytic subunit promoter have been reported to be involved in cAMP responsiveness (43, 68). Schmoll et al. (68) demonstrated that, in H4IIE hepatoma cells, deletion of the sequence from –161 to –151 of the human G-6-Pase catalytic subunit promoter markedly reduced the combined stimulatory effect of cAMP and dexamethasone on fusion gene expression. In contrast, Lin et al. (43) showed that, in HepG2 cells, deletion of the human G-6-Pase catalytic subunit promoter sequence between –146 and –125 completely blocked the stimulatory effect of cAMP. Both of these promoter regions contain sequences that are similar to the consensus CRE sequence TGACGTCA, and both elements bind CREB (43, 68). For clarity, the G-6-Pase catalytic subunit promoter sequence between –161 and –152 has been termed CRE1, and the region between –146 and –125 has been termed CRE2. The reason for this discrepancy between the results of Schmoll et al. and those of Lin et al. is unclear, but these elements are both well conserved in the mouse G-6-Pase catalytic subunit promoter (75).

We (75) have previously shown that, in HepG2 cells, cotransfection with a plasmid encoding the catalytic subunit of PKA more robustly stimulates G-6-Pase catalytic subunit-CAT fusion gene expression than treatment with a cAMP analog (~15- vs. 2- to 3-fold). Using this approach, we demonstrated that multiple promoter elements are required for the stimulatory effect of PKA on G-6-Pase catalytic subunit-CAT fusion gene expression (75), rather than the single elements described by other investigators (43, 68). One of these elements, located between –114 and –99, was subsequently identified as a hepatocyte nuclear factor-6 (HNF-6)-binding site (73); however, the results also showed that deletion of the regions encompassing either CRE1 or CRE2 resulted in a reduction in the maximal effect of PKA on fusion gene expression (75).

To explore the role of CRE1 and CRE2 in the stimulatory effect of PKA on mouse G-6-Pase catalytic subunit gene transcription in HepG2 cells, we separately mutated CRE1 and CRE2 in the context of the –231 to +66 G-6-Pase catalytic subunit-CAT fusion gene. Figure 6A shows that, when the results are expressed in terms of maximal induction of expression by PKA, mutation of both CRE1 and CRE2 results in a decrease in the ability of PKA to stimulate G-6-Pase catalytic subunit-CAT fusion gene expression compared with the wild-type –231 G-6-Pase catalytic subunit-CAT fusion gene. However, the interpretation of this experiment is complex, because mutation of CRE1 and CRE2 also results in a reduction in basal G-6-Pase catalytic subunit-CAT fusion gene expression (Fig. 6B). Nevertheless, Fig. 6C shows that, even when the results are expressed in terms of fold induction of expression by PKA, mutation of both CRE1 and CRE2 decreases the ability of PKA to stimulate G-6-Pase catalytic subunit-CAT fusion gene expression. These data suggest that both sites are required for the stimulation of G-6-Pase catalytic subunit-CAT fusion gene expression by PKA in HepG2 cells. However, this experiment does not reveal whether CRE1 and CRE2 are acting directly as bona fide CREs or indirectly as accessory factor binding sites to enhance the effect of cAMP mediated through another element.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6. Analysis of the requirement for cAMP response element 1 (CRE1) and CRE2 in the stimulatory effect of PKA on G-6-Pase catalytic subunit fusion gene transcription in the human HepG2 hepatoma cell line. HepG2 cells were transiently cotransfected, as described in METHODS, with various G-6-Pase catalytic subunit-chloramphenicol acetyltransferase (CAT) fusion genes (15 µg), containing either wild-type (WT) promoter sequence or a site-directed mutation in the CRE1 site (CRE1 SDM) or CRE2 site (CRE2 SDM) and expression vectors encoding {beta}-galactosidase (2.5 µg) and either the catalytic subunit of PKA (5 µg) or the same vector with the PKA open reading frame deleted (5 µg). After transfection, cells were incubated for 18–20 h in serum-free medium. Cells were then harvested and both CAT and {beta}-galactosidase activity assayed as described in METHODS. A: CAT activity, corrected for the protein concentration in the cell lysate, is expressed as a percentage of that obtained with the –231 G-6-Pase catalytic subunit-CAT fusion gene in the presence of the PKA expression vector. B: CAT activity, corrected for {beta}-galactosidase activity in the cell lysate, is expressed as a percentage of that obtained with the –231 G-6-Pase catalytic subunit-CAT fusion gene in the presence of the control PKA expression vector in which the PKA open reading frame was deleted. C: results are presented as the ratio of CAT activity, corrected for the protein concentration in the cell lysate, in PKA transfected vs. empty vector transfected cells, expressed as fold induction. Results represent means ± SE of 3 experiments that used multiple preparations of each G-6-Pase catalytic subunit fusion gene construct with each sample assayed in duplicate. *P < 0.05 vs. –231 G-6-Pase catalytic subunit-CAT.

 
CRE1, but not CRE2, acts as a bona fide CRE in HepG2 cells. Multiple copies of double-stranded oligonucleotides representing the mouse G-6-Pase catalytic subunit sequence either from –175 to –142 (CRE1) or from –155 to –119 (CRE2) were ligated into the heterologous XMB-CAT expression vector and transiently transfected into HepG2 cells (Fig. 7). The G-6-Pase catalytic subunit promoter sequence from –175 to –142 (CRE1) mediated a direct stimulatory effect of PKA on reporter gene expression (Fig. 7), whereas the sequence from –155 to –119 was unable to mediate a PKA response (Fig. 7). As a control, a double-stranded oligonucleotide containing a mutation of the CRE-like motif within the CRE1 sequence, the same mutation as present in the –231 CRE1 SDM fusion gene (Fig. 6), was inserted in multiple copies into the heterologous XMB-CAT expression vector. CAT expression directed by the resulting construct (CRE1 MUT XMB) was not stimulated by PKA following transient transfection into HepG2 cells (Fig. 7). These data indicate that the CRE1 region, but not the CRE2 region, contains a bona fide CRE and that the CRE-like motif within CRE1 is responsible for the stimulatory effect of PKA on G-6-Pase catalytic subunit gene expression. In addition, this result suggests that the CRE2 region contains an accessory factor binding site that likely enhances both basal G-6-Pase catalytic subunit gene expression (Fig. 6C) and the effect of cAMP mediated through CRE1.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7. CRE1, but not CRE2, mediates a stimulatory effect of PKA on the expression of a heterologous fusion gene in the human HepG2 hepatoma cell line. HepG2 cells were transiently cotransfected, as described in METHODS, with heterologous constructs (15 µg) in which oligonucleotides representing the WT or mutated (MUT) CRE1 or CRE2 motifs had been ligated into the HindIII site of the XMB vector in multiple (3–4) copies and with expression vectors encoding {beta}-galactosidase (2.5 µg) and either an expression vector (5 µg) encoding the catalytic subunit of PKA or the same vector (5 µg) with the PKA open reading frame deleted. After transfection, cells were incubated for 18–20 h in serum-free medium. Cells were then harvested and CAT and {beta}-galactosidase activities assayed as described in METHODS. Results are presented as the ratio of CAT activity, corrected for the protein concentration in the cell lysate, in PKA transfected vs. empty vector transfected cells, expressed as fold induction. Results represent means ± SE of 4 experiments in which each construct was assayed in duplicate.

 
CREB and C/EBP bind the G-6-Pase catalytic subunit CRE. When a labeled oligonucleotide representing the wild-type G-6-Pase catalytic subunit promoter sequence from –175 to –142 that encompasses CRE1 was incubated with nuclear extract prepared from HepG2 cells, several protein-DNA complexes were detected in gel retardation assays (Fig. 8A). Competition experiments, in which a 100-fold molar excess of unlabeled DNA was included with the labeled probe, were used to correlate protein binding with cAMP-regulated G-6-Pase catalytic subunit gene expression. The wild-type CRE1 oligonucleotide competed effectively for the formation of four protein-DNA complexes (Fig. 8A; see arrows). In contrast, an oligonucleotide designated CRE1 MUT (75), which contains a mutation identical to that described in the –231 CRE1 SDM construct (Fig. 6), failed to compete with the labeled probe for formation of these complexes (Fig. 8A). This indicates that these four complexes represent specific protein-DNA interactions and that their formation correlates with cAMP-regulated G-6-Pase catalytic subunit gene transcription conferred by CRE1.

Gel retardation assays were performed in which HepG2 cell nuclear extract was preincubated with antisera specific for transcription factors which are known to bind CRE motifs (14, 58). Schmoll et al. (68) have reported that, by using nuclear extracts from either human HepG2 or rat hepatoma H4IIE cells, CRE1 binds only a single factor, which was identified as CREB. However, as can be seen in Fig. 8A, addition of antibodies recognizing CREB resulted in a selective disruption in the formation of only complex 1, with no effect on the formation of complexes 2–4. Concomitant with the disruption of complex 1, a clear supershift was apparent upon addition of the CREB antisera. To identify the factors present in the other three complexes, gel retardation assays were performed in which HepG2 cell nuclear extract was preincubated with antisera specific for different members of the C/EBP transcription factor family (64). It has been previously shown that members of the C/EBP transcription factor family bind the CRE motif in the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter (60, 62). Figure 8B shows that addition of antibodies recognizing C/EBP{alpha} resulted in a selective disruption in the formation of only complexes 2 and 3, with no effect on the formation of complexes 1 and 4, whereas addition of antibodies recognizing C/EBP{beta} resulted in a selective disruption in the formation of only complex 4, with no effect on the formation of complexes 1–3. Concomitant with the disruption of complexes 2–4, a clear supershift was apparent upon addition of the C/EBP{alpha} and C/EBP{beta} antisera (Fig. 8B). Addition of antibodies recognizing C/EBP{delta} had no effect on complex formation (Fig. 8B). These results suggest that complex 1 contains CREB, complexes 2 and 3 contain C/EBP{alpha}, and complex 4 contains C/EBP{beta}. Previous studies suggest that C/EBP{alpha} is susceptible to proteolysis such that complexes 2 and 3 may represent the binding of full-length and truncated C/EBP{alpha}, respectively (60).

It is unclear why Schmoll et al. (68) detected binding only of CREB to CRE1, whereas we detect the binding of CREB, C/EBP{alpha}, and C/EBP{beta}. However, when a labeled oligonucleotide representing a consensus wild-type CRE sequence was incubated with nuclear extract prepared from HepG2 cells, only a single protein-DNA complex was detected (Fig. 8A). Competition experiments, in which a 100-fold molar excess of unlabeled DNA was included with the labeled probe, showed that the wild-type consensus CRE oligonucleotide competed effectively for the formation of this protein-DNA complex, whereas an unrelated, random (RN) oligonucleotide failed to compete with the labeled probe for formation of this complex (Fig. 8A). This indicates that this complex represents a specific protein-DNA interaction. Addition of antibodies recognizing CREB resulted in a selective disruption in the formation of this complex concomitant with the formation of a clear supershift (Fig. 8A). Antisera to C/EBP{alpha}, C/EBP{beta}, and C/EBP{delta} had no effect on complex formation (data not shown). The core sequence of the G-6-Pase catalytic subunit CRE (TTACGTAA) differs from the consensus CRE (TGACGTCA), which may explain this difference in transcription factor binding.


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have previously shown that, in pancreatic-clamped, euglycemic conscious dogs, a 5-h period of hypoinsulinemia leads to a marked increase in hepatic G-6-Pase catalytic subunit mRNA, whereas G-6-P transporter mRNA remains unchanged (35). Although the dog studies described here were initially designed for a different purpose, namely to determine the effect of elevated circulating NEFA levels on glucagon action in vivo, we were able to use the samples already generated to address the question of what factor is likely to be responsible for the selective induction of G-6-Pase catalytic subunit gene expression in hypoinsulinemic dogs. We show that glucagon is a prime candidate for this factor. Thus glucagon selectively stimulated G-6-Pase catalytic subunit but not G-6-P transporter gene expression in vivo (Fig. 3). This stimulation of G-6-Pase catalytic subunit gene expression cannot be due to the secondary rise in glucose levels induced by the elevation in glucagon concentration, since the resulting glucose level was identical to that in the control, hyperglycemic animals (Fig. 2). Moreover, it is unlikely that glucagon alters the abundance of another metabolite/factor that then mediates the induction of G-6-Pase catalytic subunit gene expression, since glucagon can directly stimulate G-6-Pase catalytic subunit fusion gene expression in HepG2 hepatoma cells (Fig. 4). Furthermore, cAMP also stimulated endogenous G-6-Pase catalytic subunit gene expression in HepG2 cells but had no effect on G-6-P transporter gene expression (Fig. 5). This result is consistent with previous results showing that cAMP selectively stimulates G-6-Pase catalytic subunit, but not G-6-P transporter, gene expression in rat H4IIE cells and rat primary hepatocytes (35). Moreover, although Li et al. (40) initially reported that, in HepG2 cells, cAMP stimulated G-6-P transporter gene expression, more recently Li and van de Werve (41) reported that cAMP had no effect.

In the substrate-transport model for G-6-Pase, the translocation of G-6-P across the ER membrane was identified as a major control point in the G-6-Pase reaction on the basis of the phenomenon of latency, which is defined as the difference in the rate of G-6-P hydrolysis by intact vs. disrupted microsomes (5). Disruption of microsomes with detergents increases the rate of G-6-P hydrolysis, suggesting that G-6-P transport is limiting (5). However, Newgard and colleagues have shown, using adenoviral technology, that overexpression of either the G-6-Pase catalytic subunit [Seoane et al. (70)] or G-6-P transporter [An et al. (1)] is sufficient to cause an increased rate of HGP in primary hepatocyes. These experiments suggest that both the G-6-Pase catalytic subunit and G-6-P transporter contribute significantly to the overall rate of the G-6-Pase reaction. The data presented here and in our previous study (35) suggest that hormones differentially regulate G-6-Pase catalytic subunit and G-6-P transporter gene expression. This, then, may explain the observations that the degree of latency varies in microsomes prepared from fed or fasted rats (5) and with aging (27). One caveat with this hypothesis is that it is based on the assumption that G-6-Pase catalytic subunit and G-6-P transporter mRNA and protein/activity levels correlate. Studies on gene expression changes during liver regeneration show that this is not necessarily the case. G-6-Pase catalytic subunit mRNA is induced 30-fold during liver regeneration, but there is little (29) or no change (81) in G-6-Pase catalytic subunit protein or G-6-Pase enzyme activity. Furthermore, it cannot be assumed that the changes in G-6-Pase catalytic subunit and G-6-P transporter mRNA reported in our studies reflect transcriptional changes, since many hepatic genes are regulated at the level of mRNA stability (37), including the G-6-Pase catalytic subunit (48).

Multiple promoter elements are required to mediate the stimulatory effect of cAMP on G-6-Pase catalytic subunit gene expression in HepG2 cells (73, 75). However, we show here that the main target for cAMP signaling is the element CRE1, located between –162 and –155 (Fig. 7). We speculate that other elements in the G-6-Pase catalytic subunit promoter, such as CRE2, bind accessory factors that act to enhance cAMP signaling through CRE1. Such an arrangement is referred to as a cAMP response unit (46, 65). One exception is an HNF-6 motif located between –110 and –101 that can directly mediate cAMP signaling by a mechanism that involves direct phosphorylation of HNF-6 by PKA (73). However, cAMP signaling through CRE1 appears to be quantitatively more important than cAMP signaling through the HNF-6 motif (73).

A key question that remains to be addressed is which CRE1-bound factor mediates cAMP signaling. Gel retardation assays show that CRE1 can bind CREB, C/EBP{alpha}, and C/EBP{beta} in vitro (Fig. 8). Moreover, studies on the PEPCK promoter, using chimeric GAL4 fusion proteins, show that each of these factors can directly mediate cAMP signaling (79). The mechanism of cAMP signaling through CREB is well established and involves the direct phosphorylation of CREB by PKA, which then leads to binding of the coactivator CREB-binding protein (14, 58). In contrast, when bound to the PEPCK promoter, cAMP activates C/EBP{alpha} and C/EBP{beta} through an unknown mechanism that does not involve the direct phosphorylation of these factors by PKA (79). It is therefore possible that cAMP can activate G-6-Pase catalytic subunit gene expression through CRE1 regardless of which specific factor is bound. However, it is more likely that the selective binding of each of these factors will be important for different aspects of G-6-Pase catalytic subunit gene expression. For example, binding of C/EBP{beta}, but not C/EBP{alpha} or CREB, to the CRE in the PEPCK promoter is required for the maximal glucocorticoid-stimulated expression of that gene (80). Studies of mice expressing dominant negative CREB (34) and studies in which the genes encoding C/EBP{alpha} (78) and C/EBP{beta} (7) have been selectively deleted, support the involvement of all of these factors in the regulation of G-6-Pase catalytic subunit gene expression. However, the changes in G-6-Pase catalytic subunit gene expression observed in these animals could be indirect. In addition, C/EBP{alpha} and C/EBP{beta} may bind to elements in the G-6-Pase catalytic subunit promoter other than CRE1 (4, 43).

Commerford et al. (13) have recently shown that high-fat diets do not affect G-6-P transporter gene expression in rats. However, the lack of a stimulatory effect of fatty acids and glycerol on G-6-Pase catalytic subunit gene expression in conscious dogs in vivo (Fig. 3) was surprising, because feeding rats high-fat diets (13), infusing conscious rats with a triglyceride emulsion (51), or treating primary rat hepatocytes with either short-chain (49) or long-chain fatty acids (11) all elevate rat G-6-Pase catalytic subunit gene expression. Similarly, glycerol increases G-6-Pase catalytic subunit mRNA levels in rat primary hepatocytes (48). The reason for this lack of stimulation of G-6-Pase catalytic subunit gene expression by NEFA in conscious dogs is unclear. The concentration of NEFA achieved in our study (~1,500 µmol/l; Fig. 2E) is similar to that reported by Massillon et al. (51) in studies involving the infusion of conscious rats with a triglyceride emulsion. However, Massillon et al. used Liposyn (Abbott) rather than Intralipid (Baxter) as the source of fatty acids; the fatty acid composition of these products is not identical. This may be significant, since the regulation of G-6-Pase catalytic subunit gene expression by fatty acids is complex. Thus, although short- and long-chain fatty acids stimulate G-6-Pase catalytic subunit gene expression, polyunsaturated fatty acids actually suppress expression of the gene (63). Perhaps more significant, in the study by Massillon et al., the animals were mildly hyperinsulinemic, and glucagon was not replaced following somatostatin administration. It is therefore possible that basal G-6-Pase catalytic subunit gene expression was reduced relative to the level seen in our dogs, in which insulin and glucagon were both at basal levels. Such a reduction in basal G-6-Pase catalytic subunit gene expression might make a stimulatory effect of fatty acids more apparent.

Another possible explanation for the lack of fatty acid-stimulated G-6-Pase catalytic subunit gene expression in conscious dogs in vivo is that this gene is regulated differently in dogs and rats. Interestingly, we (35) have previously reported that, in conscious dogs in vivo, glucose also fails to stimulate G-6-Pase catalytic subunit gene expression. In contrast, in conscious rats (50, 52), primary rat hepatocytes (3, 11, 48), and rat FAO hepatoma cells (3, 38), glucose stimulates rat G-6-Pase catalytic subunit gene expression. We propose to explore this potential differential regulation of rat and dog G-6-Pase catalytic subunit gene expression in future experiments that will involve the cloning of the dog G-6-Pase catalytic subunit gene promoter. The comparative analysis of the rat and dog promoters in both rat and dog primary hepatocytes will reveal whether there is an inherent difference in NEFA and glucose signaling between these species or a specific difference in the regulation of dog G-6-Pase catalytic subunit gene expression. Such primary hepatocyte studies will also be critical for confirming the results of our analysis of PKA-stimulated G-6-Pase catalytic subunit fusion gene transcription in HepG2 cells. This is an important issue, since HepG2 cells (36) and hepatoma cells in general (31) differ from normal liver cells in several respects, including reduced gluconeogenic capacity, and therefore may be lacking other key transcription factors or proteins important for understanding the regulation of this gene.

In summary, this study demonstrates that glucagon and its second messenger cAMP differentially regulate the hepatic expression of the genes encoding the G-6-Pase catalytic subunit and the G-6-P transporter in vivo and in situ. In contrast, insulin suppresses the expression of both genes, although the magnitude of the effect of insulin is much greater on G-6-Pase catalytic subunit gene expression (35). Interestingly, there have been two recent reports that described a differential regulation of G-6-Pase catalytic subunit and the G-6-P transporter gene expression in the liver of mice bearing Ehrlich ascites tumor cells (23) and in the clear cell type of human renal cell carcinoma (67), although the mechanisms responsible for this differential regulation were not elucidated.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This research was supported by National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) Grants DK-56374 to R. M. O'Brien and DK-18243 to A. D. Cherrington and by the Vanderbilt Diabetes Core Laboratory (P60 DK-20593). L. A. Hornbuckle and S. S. Gustavson were supported by the Vanderbilt Molecular Endocrinology Training Program (5 T32 DK-07563–12). C. A. Everett was supported by NIDDK Grant R37 DK-18243–27S1 (to A. D. Cherrington).


    ACKNOWLEDGMENTS
 
We thank Drs. Richard A. Maurer and Thomas P. Sakmar for providing the PKA and glucagon receptor expression vectors, respectively. We also thank Dr. Steven L. McKnight for providing antisera raised against various C/EBP isoforms.


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. M. O'Brien, Dept. of Molecular Physiology and Biophysics, 761 PRB, Vanderbilt Univ. Medical School, Nashville, TN 37232–0615 (E-mail: richard.obrien{at}mcmail.vanderbilt.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. An J, Li Y, van de Werve G, and Newgard CB. Overexpression of the P46 (T1) translocase component of the glucose-6-phosphatase complex in hepatocytes impairs glycogen accumulation via hydrolysis of glucose-1-phosphate. J Biol Chem 276: 10722–10729, 2001.[Abstract/Free Full Text]
  2. Andrews NC and Faller DV. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19: 2499, 1991.[Free Full Text]
  3. Argaud D, Kirby TL, Newgard CB, and Lange AJ. Stimulation of glucose-6-phosphatase gene expression by glucose and fructose-2,6-bisphosphate. J Biol Chem 272: 12854–12861, 1997.[Abstract/Free Full Text]
  4. Argaud D, Zhang Q, Pan W, Maitra S, Pilkis SJ, and Lange AJ. Regulation of rat liver glucose-6-phosphatase gene expression in different nutritional and hormonal states: gene structure and 5'-flanking sequence. Diabetes 45: 1563–1571, 1996.[Abstract]
  5. Arion WJ, Lange AJ, Walls HE, and Ballas LM. Evidence for the participation of independent translocation for phosphate and glucose 6-phosphate in the microsomal glucose-6-phosphatase system. Interactions of the system with orthophosphate, inorganic pyrophosphate, and carbamyl phosphate. J Biol Chem 255: 10396–10406, 1980.[Abstract/Free Full Text]
  6. Arion WJ, Wallin BK, Lange AJ, and Ballas LM. On the involvement of a glucose 6-phosphate transport system in the function of microsomal glucose 6-phosphatase. Mol Cell Biochem 6: 75–83, 1975.[CrossRef][Web of Science][Medline]
  7. Arizmendi C, Liu S, Croniger C, Poli V, and Friedman JE. The transcription factor CCAAT/enhancer-binding protein beta regulates gluconeogenesis and phosphoenolpyruvate carboxykinase (GTP) gene transcription during diabetes. J Biol Chem 274: 13033–13040, 1999.[Abstract/Free Full Text]
  8. Birkenmeier EH, Gwynn B, Howard S, Jerry J, Gordon JI, Landschulz WH, and McKnight SL. Tissue-specific expression, developmental regulation, and genetic mapping of the gene encoding CCAAT/enhancer binding protein. Genes Dev 3: 1146–1156, 1989.[Abstract/Free Full Text]
  9. Carruthers CJ, Unson CG, Kim HN, and Sakmar TP. Synthesis and expression of a gene for the rat glucagon receptor. Replacement of an aspartic acid in the extracellular domain prevents glucagon binding. J Biol Chem 269: 29321–29328, 1994.[Abstract/Free Full Text]
  10. Chapman SC, Ayala JE, Streeper RS, Culbert AA, Eaton EM, Svitek CA, Goldman JK, Tavare JM, and O'Brien RM. Multiple promoter elements are required for the stimulatory effect of insulin on human collagenase-1 gene transcription. Selective effects on activator protein-1 expression may explain the quantitative difference in insulin and phorbol ester action. J Biol Chem 274: 18625–18634, 1999.[Abstract/Free Full Text]
  11. Chatelain F, Pegorier JP, Minassian C, Bruni N, Tarpin S, Girard J, and Mithieux G. Development and regulation of glucose-6-phosphatase gene expression in rat liver, intestine, and kidney: in vivo and in vitro studies in cultured fetal hepatocytes. Diabetes 47: 882–889, 1998.[Abstract]
  12. Chou JY and Mansfield BC. Molecular genetics of type I glycogen storage disease. Trends Endocrinol Metab 10: 104–113, 1999.[CrossRef][Web of Science][Medline]
  13. Commerford SR, Ferniza JB, Bizeau ME, Thresher JS, Willis WT, and Pagliassotti MJ. Diets enriched in sucrose or fat increase gluconeogenesis and G-6-Pase but not basal glucose production in rats. Am J Physiol Endocrinol Metab 283: E545–E555, 2002.[Abstract/Free Full Text]
  14. Daniel PB, Walker WH, and Habener JF. Cyclic AMP signaling and gene regulation. Annu Rev Nutr 18: 353–383, 1998.[CrossRef][Web of Science][Medline]
  15. Danielson PE, Forss-Petter S, Brow MA, Calavetta L, Douglass J, Milner RJ, and Sutcliffe JG. p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA (NY) 7: 261–267, 1988.
  16. Dobbins RL, Davis SN, Neal DW, Cobelli C, Jaspan J, and Cherrington AD. Compartmental modeling of glucagon kinetics in the conscious dog. Metabolism 44: 452–459, 1995.[CrossRef][Web of Science][Medline]
  17. Ebert DH, Bischof LJ, Streeper RS, Chapman SC, Svitek CA, Goldman JK, Mathews CE, Leiter EH, Hutton JC, and O'Brien RM. Structure and promoter activity of an islet-specific glucose-6-phosphatase catalytic subunit-related gene. Diabetes 48: 543–551, 1999.[Abstract]
  18. Edgerton DS, Cardin S, Pan C, Neal D, Farmer B, Converse M, and Cherrington AD. Effects of insulin deficiency or excess on hepatic gluconeogenic flux during glycogenolytic inhibition in the conscious dog. Diabetes 51: 3151–3162, 2002.[Abstract/Free Full Text]
  19. Evans HE and Christensen GC. Miller's Anatomy of the Dog. Philadelphia, PA: Saunders, 1979.
  20. Fehlmann M, Crettaz M, and Kahn CR. Glucagon resistance of hepatoma cells. Evidence for receptor and post-receptor defects. Biochem J 214: 845–850, 1983.[Web of Science][Medline]
  21. Forest CD, O'Brien RM, Lucas PC, Magnuson MA, and Granner DK. Regulation of phosphoenolpyruvate carboxykinase gene expression by insulin. Use of the stable transfection approach to locate an insulin responsive sequence. Mol Endocrinol 4: 1302–1310, 1990.[Abstract/Free Full Text]
  22. Foster JD, Pederson BA, and Nordlie RC. Glucose-6-phosphatase structure, regulation, and function: an update. Proc Soc Exp Biol Med 215: 314–332, 1997.[CrossRef][Medline]
  23. Foster JD, Wiedemann JM, Pan CJ, Chou JY, and Nordlie RC. Discriminant responses of the catalytic unit and glucose 6-phosphate transporter components of the hepatic glucose-6-phosphatase system in Ehrlich ascites-tumor-bearing mice. Arch Biochem Biophys 393: 117–122, 2001.[CrossRef][Web of Science][Medline]
  24. Friedman JE, Sun Y, Ishizuka T, Farrell CJ, McCormack SE, Herron LM, Hakimi P, Lechner P, and Yun JS. Phosphoenolpyruvate carboxykinase (GTP) gene transcription and hyperglycemia are regulated by glucocorticoids in genetically obese db/db transgenic mice. J Biol Chem 272: 31475–31481, 1997.[Abstract/Free Full Text]
  25. Gascon-Barre M, Huet PM, Belgiorno J, Plourde V, and Coulombe PA. Estimation of collagen content of liver specimens. Variation among animals and among hepatic lobes in cirrhotic rats. J Histochem Cytochem 37: 377–381, 1989.[Abstract]
  26. Gerin I, Veiga-da-Cunha M, Achouri Y, Collet JF, and Van Schaftingen E. Sequence of a putative glucose 6-phosphate translocase, mutated in glycogen storage disease type Ib. FEBS Lett 419: 235–238, 1997.[CrossRef][Web of Science][Medline]
  27. Goldsmith PK and Stetten MR. Different developmental changes in latency for two functions of a single membrane bound enzyme: glucose-6-phosphatase activities as a function of age. Biochim Biophys Acta 583: 133–147, 1979.[Medline]
  28. Gustavson SM, Chu CA, Nishizawa M, Farmer B, Neal D, Yang Y, Donahue EP, Flakoll P, and Cherrington AD. Interaction of glucagon and epinephrine in the control of hepatic glucose production in the conscious dog. Am J Physiol Endocrinol Metab 284: E695–E707, 2003.[Abstract/Free Full Text]
  29. Haber BA, Chin S, Chuang E, Buikhuisen W, Naji A, and Taub R. High levels of glucose-6-phosphatase gene and protein expression reflect an adaptive response in proliferating liver and diabetes. J Clin Invest 95: 832–841, 1995.[Web of Science][Medline]
  30. Haendler B and Hofer E. Characterization of the human cyclophilin gene and of related processed pseudogenes. Eur J Biochem 190: 477–482, 1990.[Web of Science][Medline]
  31. Hammond KD and Balinsky D. Activities of key gluconeogenic enzymes and glycogen synthase in rat and human livers, hepatomas, and hepatoma cell cultures. Cancer Res 38: 1317–1322, 1978.[Abstract/Free Full Text]
  32. Hasel KW and Sutcliffe JG. Nucleotide sequence of a cDNA coding for mouse cyclophilin. Nucleic Acids Res 18: 4019, 1990.[Free Full Text]
  33. Hasmall SC, Pyrah IT, Soames AR, and Roberts RA. Expression of the immediate-early genes, c-fos, c-jun, and c-myc: a comparison in rats of nongenotoxic hepatocarcinogens with noncarcinogenic liver mitogens. Fundam Appl Toxicol 40: 129–137, 1997.[CrossRef][Web of Science][Medline]
  34. Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz G, Yoon C, Puigserver P, Spiegelman B, and Montminy M. CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413: 179–183, 2001.[CrossRef][Medline]
  35. Hornbuckle LA, Edgerton DS, Ayala JE, Svitek CA, Neal DW, Cardin S, Cherrington AD, and O'Brien RM. Selective, tonic inhibition of G-6-Pase catalytic subunit but not G-6-P transporter gene expression by insulin in vivo. Am J Physiol Endocrinol Metab 281: E713–E725, 2001.[Abstract/Free Full Text]
  36. Knowles BB, Howe CC, and Aden DP. Human hepatocellular carcinoma cell lines secrete the major plasma proteins and hepatitis B surface antigen. Science 209: 497–499, 1980.[Abstract/Free Full Text]
  37. Kren BT and Steer CJ. Posttranscriptional regulation of gene expression in liver regeneration: role of mRNA stability. FASEB J 10: 559–573, 1996.[Abstract]
  38. Lange AJ, Argaud D, el-Maghrabi MR, Pan W, Maitra SR, and Pilkis SJ. Isolation of a cDNA for the catalytic subunit of rat liver glucose-6-phosphatase: regulation of gene expression in FAO hepatoma cells by insulin, dexamethasone and cAMP. Biochem Biophys Res Commun 201: 302–309, 1994.[CrossRef][Web of Science][Medline]
  39. Lei KJ, Shelly LL, Pan CJ, Sidbury JB, and Chou JY. Mutations in the glucose-6-phosphatase gene that cause glycogen storage disease type 1a. Science 262: 580–583, 1993.[Abstract/Free Full Text]
  40. Li Y, Mechin MC, and van de Werve G. Diabetes affects similarly the catalytic subunit and putative glucose-6-phosphate translocase of glucose-6-phosphatase. J Biol Chem 274: 33866–33868, 1999.[Abstract/Free Full Text]
  41. Li Y and van de Werve G. Distinct hormone stimulation and counteraction by insulin of the expression of the two components of glucose-6-phosphatase in HepG2 cells. Biochem Biophys Res Commun 272: 41–44, 2000.[CrossRef][Web of Science][Medline]
  42. Lin B, Annabi B, Hiraiwa H, Pan CJ, and Chou JY. Cloning and characterization of cDNAs encoding a candidate glycogen storage disease type 1b protein in rodents. J Biol Chem 273: 31656–31660, 1998.[Abstract/Free Full Text]
  43. Lin B, Morris DW, and Chou JY. The role of HNF1alpha, HNF3gamma, and cyclic AMP in glucose-6-phosphatase gene activation. Biochemistry 36: 14096–14106, 1997.[CrossRef][Web of Science][Medline]
  44. Liu Z, Barrett EJ, Dalkin AC, Zwart AD, and Chou JY. Effect of acute diabetes on rat hepatic glucose-6-phosphatase activity and its messenger RNA level. Biochem Biophys Res Commun 205: 680–686, 1994.[CrossRef][Web of Science][Medline]
  45. Lloyd B, Burrin J, Smythe P, and Alberti KG. Enzymic fluorometric continuous-flow assays for blood glucose, lactate, pyruvate, alanine, glycerol, and 3-hydroxybutyrate. Clin Chem 24: 1724–1729, 1978.[Abstract/Free Full Text]
  46. Lucas PC and Granner DK. Hormone response domains in gene transcription. Annu Rev Biochem 61: 1131–1173, 1992.[CrossRef][Web of Science][Medline]
  47. Martin CC, Oeser JK, Svitek CA, Hunter SI, Hutton JC, and O'Brien RM. Identification and characterization of a human cDNA and gene encoding a ubiquitously expressed glucose-6-phosphatase catalytic subunit-related protein. J Mol Endocrinol 29: 205–222, 2002.[Abstract]
  48. Massillon D. Regulation of the glucose-6-phosphatase gene by glucose occurs by transcriptional and post-transcriptional mechanisms. Differential effect of glucose and xylitol. J Biol Chem 276: 4055–4062, 2001.[Abstract/Free Full Text]
  49. Massillon D, Arinze IJ, Xu C, and Bone F. Regulation of glucose-6-phosphatase gene expression in cultured hepatocytes and H4IIE cells by short-chain fatty acids: role of HNF-4a. J Biol Chem 278: 40694–40701, 2003.[Abstract/Free Full Text]
  50. Massillon D, Barzilai N, Chen W, Hu M, and Rossetti L. Glucose regulates in vivo glucose-6-phosphatase gene expression in the liver of diabetic rats. J Biol Chem 271: 9871–9874, 1996.[Abstract/Free Full Text]
  51. Massillon D, Barzilai N, Hawkins M, Prus-Wertheimer D, and Rossetti L. Induction of hepatic glucose-6-phosphatase gene expression by lipid infusion [published erratum appears in Diabetes 46: 536, 1997]. Diabetes 46: 153–157, 1997.
  52. Massillon D, Chen W, Barzilai N, Prus-Wertheimer D, Hawkins M, Liu R, Taub R, and Rossetti L. Carbon flux via the pentose phosphate pathway regulates the hepatic expression of the glucose-6-phosphatase and phosphoenolpyruvate carboxykinase genes in conscious rats. J Biol Chem 273: 228–234, 1998.[Abstract/Free Full Text]
  53. Maurer RA. Both isoforms of the cAMP-dependent protein kinase catalytic subunit can activate transcription of the prolactin gene. J Biol Chem 264: 6870–6873, 1989.[Abstract/Free Full Text]
  54. Mirel RD, Morris HP, and DiAugustine RP. Membrane receptor function and the loss of glucagon-stimulated adenylate cyclase activity in hepatomas. Endocrinology 102: 1237–1246, 1978.[Abstract/Free Full Text]
  55. Mithieux G. New knowledge regarding glucose-6 phosphatase gene and protein and their roles in the regulation of glucose metabolism. Eur J Endocrinol 136: 137–145, 1997.[Abstract/Free Full Text]
  56. Mithieux G, Vidal H, Zitoun C, Bruni N, Daniele N, and Minassian C. Glucose-6-phosphatase mRNA and activity are increased to the same extent in kidney and liver of diabetic rats. Diabetes 45: 891–896, 1996.[Abstract]
  57. Moghimzadeh E, Nobin A, and Rosengren E. Fluorescence microscopical and chemical characterization of the adrenergic innervation in mammalian liver tissue. Cell Tissue Res 230: 605–613, 1983.[CrossRef][Web of Science][Medline]
  58. Montminy M. Transcriptional regulation by cyclic AMP. Annu Rev Biochem 66: 807–822, 1997.[CrossRef][Web of Science][Medline]
  59. Morgan CR and Lazarow AL. Immunoassay of insulin: two antibody system: plasma insulin of normal, subdiabetic, and diabetic rats. Am J Med Sci 257: 415–419, 1963.
  60. O'Brien RM, Lucas PC, Yamasaki T, Noisin EL, and Granner DK. Potential convergence of insulin and cAMP signal transduction systems at the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter through CCAAT/enhancer binding protein (C/EBP). J Biol Chem 269: 30419–30428, 1994.[Abstract/Free Full Text]
  61. O'Brien RM, Noisin EL, Suwanichkul A, Yamasaki T, Lucas PC, Wang JC, Powell DR, and Granner DK. Hepatic nuclear factor 3- and hormone-regulated expression of the phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein 1 genes. Mol Cell Biol 15: 1747–1758, 1995.[Abstract]
  62. Park EA, Gurney AL, Nizielski SE, Hakimi P, Cao Z, Moorman A, and Hanson RW. Relative roles of CCAAT/enhancer-binding protein beta and cAMP regulatory element-binding protein in controlling transcription of the gene for phosphoenolpyruvate carboxykinase (GTP). J Biol Chem 268: 613–619, 1993.[Abstract/Free Full Text]
  63. Rajas F, Gautier A, Bady I, Montano S, and Mithieux G. Polyunsaturated fatty acyl coenzyme A suppress the glucose-6-phosphatase promoter activity by modulating the DNA binding of hepatocyte nuclear factor 4 alpha. J Biol Chem 277: 15736–15744, 2002.[Abstract/Free Full Text]
  64. Ramji DP and Foka P. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 365: 561–575, 2002.[Web of Science][Medline]
  65. Roesler WJ. What is a cAMP response unit? Mol Cell Endocrinol 162: 1–7, 2000.[CrossRef][Web of Science][Medline]
  66. Sambrook J, Fritsch EF, and Maniatis EF. Molecular Cloning: A Laboratory Manual. Plainview, NY: Cold Spring Harbor Laboratory, 1989.
  67. Schmoll D, Balabanov S, Schwarck D, Burchell A, Kleist B, Zimmermann U, and Walther R. Differential expression of the subunits of the glucose-6-phosphatase system in the clear cell type of human renal cell carcinoma—no evidence for an overexpression of protein kinase B. Cancer Lett 167: 85–90, 2001.[CrossRef][Web of Science][Medline]
  68. Schmoll D, Wasner C, Hinds CJ, Allan BB, Walther R, and Burchell A. Identification of a cAMP response element within the glucose-6-phosphatase hydrolytic subunit gene promoter which is involved in the transcriptional regulation by cAMP and glucocorticoids in H4IIE hepatoma cells. Biochem J 338: 457–463, 1999.
  69. Schreiber E, Matthias P, Muller MM, and Schaffner W. Rapid detection of octamer binding proteins with "mini-extracts", prepared from a small number of cells. Nucleic Acids Res 17: 6419, 1989.[Free Full Text]
  70. Seoane J, Trinh K, O'Doherty RM, Gomez-Foix AM, Lange AJ, Newgard CB, and Guinovart JJ. Metabolic impact of adenovirus-mediated overexpression of the glucose-6-phosphatase catalytic subunit in hepatocytes. J Biol Chem 272: 26972–26977, 1997.[Abstract/Free Full Text]
  71. Siller-Lopez F, Garcia-Banuelos J, Hasty KA, Segura J, Ramos-Marquez M, Qoronfleh MW, Aguilar-Cordova E, and Armendariz-Borunda J. Truncated active matrix metalloproteinase-8 gene expression in HepG2 cells is active against native type I collagen. J Hepatol 33: 758–763, 2000.[CrossRef][Web of Science][Medline]
  72. Streeper RS, Eaton EM, Ebert DH, Chapman SC, Svitek CA, and O'Brien RM. Hepatocyte nuclear factor-1 acts as an accessory factor to enhance the inhibitory action of insulin on mouse glucose-6-phosphatase gene transcription. Proc Natl Acad Sci USA 95: 9208–9213, 1998.[Abstract/Free Full Text]
  73. Streeper RS, Hornbuckle LA, Svitek CA, Goldman JK, Oeser JK, and O'Brien RM. Protein kinase A phosphorylates hepatocyte nuclear factor-6 and stimulates glucose-6-phosphatase catalytic subunit gene transcription. J Biol Chem 276: 19111–19118, 2001.[Abstract/Free Full Text]
  74. Streeper RS, Svitek CA, Chapman S, Greenbaum LE, Taub R, and O'Brien RM. A multicomponent insulin response sequence mediates a strong repression of mouse glucose-6-phosphatase gene transcription by insulin. J Biol Chem 272: 11698–11701, 1997.[Abstract/Free Full Text]
  75. Streeper RS, Svitek CA, Goldman JK, and O'Brien RM. Differential role of hepatocyte nuclear factor-1 in the regulation of glucose-6-phosphatase catalytic subunit gene transcription by cAMP in liver- and kidney-derived cell lines. J Biol Chem 275: 12108–12118, 2000.[Abstract/Free Full Text]
  76. Van de Werve G, Lange A, Newgard C, Mechin MC, Li Y, and Berteloot A. New lessons in the regulation of glucose metabolism taught by the glucose 6-phosphatase system. Eur J Biochem 267: 1533–1549, 2000.[Web of Science][Medline]
  77. Van Schaftingen E and Gerin I. The glucose-6-phosphatase system. Biochem J 362: 513–532, 2002.[CrossRef][Web of Science][Medline]
  78. Wang ND, Finegold MJ, Bradley A, Ou CN, Abdelsayed SV, Wilde MD, Taylor LR, Wilson DR, and Darlington GJ. Impaired energy homeostasis in C/EBP alpha knockout mice. Science 269: 1108–1112, 1995.[Abstract/Free Full Text]
  79. Wilson HL and Roesler WJ. CCAAT/enhancer binding proteins: do they possess intrinsic cAMP-inducible activity? Mol Cell Endocrinol 188: 15–20, 2002.[CrossRef][Web of Science][Medline]
  80. Yamada K, Duong DT, Scott DK, Wang JC, and Granner DK. CCAAT/enhancer-binding protein beta is an accessory factor for the glucocorticoid response from the cAMP response element in the rat phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 274: 5880–5887, 1999.[Abstract/Free Full Text]
  81. Zakko WF, Berg CL, Gollan JL, and Green RM. Hepatocellular expression of glucose-6-phosphatase is unaltered during hepatic regeneration. Am J Physiol Gastrointest Liver Physiol 275: G717–G722, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Nutr.Home page
C. Xu, K. Chakravarty, X. Kong, T. T. Tuy, I. J. Arinze, F. Bone, and D. Massillon
Several Transcription Factors Are Recruited to the Glucose-6-Phosphatase Gene Promoter in Response to Palmitate in Rat Hepatocytes and H4IIE Cells
J. Nutr., March 1, 2007; 137(3): 554 - 559.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. Everett-Grueter, D. S. Edgerton, E. P. Donahue, S. Vaughan, C. A. Chu, D. K. Sindelar, and A. D. Cherrington
The effect of an acute elevation of NEFA concentrations on glucagon-stimulated hepatic glucose output
Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E449 - E459.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. Desvergne, L. Michalik, and W. Wahli
Transcriptional Regulation of Metabolism
Physiol Rev, April 1, 2006; 86(2): 465 - 514.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/5/E795    most recent
00455.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hornbuckle, L. A.
Right arrow Articles by O'Brien, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hornbuckle, L. A.
Right arrow Articles by O'Brien, R. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.