AJP - Endo Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 286: E773-E779, 2004. First published January 6, 2004; doi:10.1152/ajpendo.00507.2003
0193-1849/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/5/E773    most recent
00507.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ding, K.-H.
Right arrow Articles by Isales, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ding, K.-H.
Right arrow Articles by Isales, C. M.

Glucose-dependent insulinotropic peptide: differential effects on hepatic artery vs. portal vein endothelial cells

Ke-Hong Ding,1 Qing Zhong,1 Jianrui Xu,1 and Carlos M. Isales1,2

1Institute of Molecular Medicine and Genetics, Department of Medicine, Medical College of Georgia, and 2Augusta Veterans Affairs Medical Center, Augusta, Georgia 30912

Submitted 11 November 2003 ; accepted in final form 4 January 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Glucose-dependent insulinotropic peptide (GIP) has been reported to have opposing effects on splanchnic blood flow. GIP infusion in dogs results in an increase in portal vein circulation but a drop in hepatic artery blood flow. In an effort to evaluate whether these different responses were related to intrinsic differences in GIP effects, we isolated canine hepatic artery (HAEC) and portal vein endothelial cells (PVEC). We report that there are differences in GIP activation of the signal transduction pathways in these two cell types. GIP stimulates secretion of endothelin-1 (ET-1), a potent vasoconstrictor, from HAEC (EC50 0.28 nM) but not from PVEC. This effect could be abolished by preventing a rise in intracellular calcium, demonstrating the calcium dependence of GIP-induced ET-1 secretion from HAEC. The GIP effect was specific, as a GIP receptor antagonist blocked it. In contrast, GIP stimulated nitric oxide production from PVEC (EC50 0.09 nM) but not from HAEC. Taken together, our data demonstrate distinct differences in GIP effects on HAEC from those on PVEC. We conclude that differences in GIP stimulation of ET-1 vs. nitric oxide production in different vascular beds may account for some of the observed differences in its physiological effects.

endothelin; receptor; nitric oxide; canine


GLUCOSE-DEPENDENT INSULINOTROPIC PEPTIDE (GIP) is a 42-amino acid peptide secreted from endocrine (K) cells in the small intestine in response to nutrient ingestion, including carbohydrates, amino acids, and fat, the latter probably being the most potent stimulus in vivo (8, 28). Initially called gastric inhibitory peptide, its name was changed to better reflect one of its major actions, potentiating nutrient-induced insulin secretion or "incretin" effect (14).

GIP receptors are widely distributed, being found in adipocytes, pancreatic islet cells, heart, brain, adrenal fasciculata, and bone cells (3, 18, 26, 27). GIP receptors are also known to be present in the endothelium (26), specifically on endothelial rather than smooth muscle cells (29). GIP has been known for some time to be a potent vasoactive agent. Fara and Salazar (7) reported in 1978 that GIP infusion resulted in an increase in mesenteric blood flow. Subsequently, Kogire et al. (15) defined specific changes induced by GIP in the splanchnic circulation. Infusion of human synthetic GIP in dogs resulted in distinct effects on blood flow, increasing portal vein blood flow and decreasing hepatic artery blood flow (16). These changes in blood flow help maximize nutrient absorption from the splanchnic circulation. Those authors did not address the issue of the underlying mechanism responsible for these opposing effects on blood flow, but it was intriguing that infusion of the same peptide could act at two separate sites to induce completely different effects.

Our laboratory was the first to report that multiple GIP receptor splice variants exist, that these GIP receptor splice variants differ between endothelial cells from different vascular beds, and that these various receptor splice variants could be coupled to different signal transduction pathways (29). Binding to the GIP receptor is known to increase cAMP and intracellular calcium and more recently has also been found to increase the production of arachidonic acid derivatives (6, 26, 29).

Our laboratory has recently reported that there are differences in functional links between the GIP receptors and secretion of bioactive peptide hormones. In particular, we found that GIP could stimulate endothelin-1 (ET-1) secretion from human umbilical vein endothelial cells but not from an immortalized endothelial cell line, ECV 304 (5).

In an attempt to shed more light on the mechanism responsible for the opposing effects on blood flow seen by GIP infusion, we made a preparation of freshly isolated canine hepatic artery endothelial cells (HAEC) and canine portal vein endothelial cells (PVEC). Our present results demonstrate that GIP stimulates ET-1 secretion from HAEC but not from PVEC, whereas GIP stimulates nitric oxide production from PVEC but not from HAEC. These opposing effects of GIP on the production of vasoactive peptides may explain the previous observations of GIP-induced vasoconstriction in one vascular bed while inducing vasodilatation in another vascular bed.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. Human GIP-(1–42) was purchased from Bachem (Torrance, CA). Fura 2-AM and EGTA-AM were purchased from Molecular Probes (Eugene, OR). Forskolin was purchased from Calbiochem (San Diego, CA). The GIP antagonist GIP-(7–30) was synthesized at the Medical College of Georgia peptide synthesis core facility.

Cell culture. For these studies, we used primary cultures of dog HAEC as well as dog PVEC. Canine blood vessels were obtained from the Richmond County Animal Control facility (Augusta, GA). This protocol was approved by the Medical College of Georgia Institutional Animal Care and Use Committee. Hepatic arteries and portal veins obtained from 4- to 6-mo-old dogs were dissected immediately after death and were transported to the laboratory in ice-cold Hanks’ balanced salt solution (HBSS).

Tissues were rinsed with HBSS, fatty tissue was removed, and the vessels were incubated for 45 min at 37°C in HBSS containing 2.5 mg/ml dispase II and 4 mg/ml BSA. After digestion, the lumina of the vessels were flushed with HBSS, and the endothelial cells obtained were centrifuged, washed, and plated in medium 199 (M-199) supplemented with 10% fetal bovine serum, 5% bovine calf serum, 16 mg/l thymidine, 150 mg/l crude endothelial cell growth factor, 15,000 U/l heparin, 100 U/ml penicillin, and 100 µg/ml streptomycin. The vascular endothelial cells thus obtained were characterized as endothelial cells by their cobblestone monolayer appearance, angiotensin-converting enzyme activity, uptake of acetylated low-density lipoprotein, and expression of von Willebrand factor (25). Endothelial cells were used at passages 2–8.

Preparation of RNA and Southern blot. Total RNA was extracted from cells by use of TRIzol (Invitrogen Life Technologies). RNA was stored at –70°C until use. A coupled reverse transcriptase PCR (RT-PCR) was utilized. The sense (CTGCCTGCCGCACGGCCCAGAT) and antisense (GCGAGCCAGCCTCAGCCGGTAA) oligonucleotide primers for the GIP receptor were synthesized and used as previously described (29). The primers were based on conserved sequences in the human, mouse, and rat GIP receptors. RNA from endothelial cells was converted to cDNA via reverse transcription using the ThermoScript RT-PCR System (Invitrogen). The resulting cDNA was subjected to amplification via PCR using 0.05 U/µl Taq polymerase (Promega), 200 µM dNTP, and 0.2 µM of sense and antisense primers for the GIP receptor in a thermocycler (Perkin Elmer-Cetus). PCR products were gel-purified and transferred overnight to Hybond nylon membrane (Amersham Pharmacia Biotech). Membranes were probed for the GIP receptor by means of a cloned PCR fragment amplified with the GIP receptor primers and verified by sequence analysis. The probe was labeled with 32P by random primer labeling (Amersham Pharmacia Biotech).

Intracellular calcium measurements with fura 2. Intracellular calcium measurements using fura 2 were made as previously described (11). Briefly, endothelial cells grown in 75-cm2 flasks were loaded with the calcium-sensitive dye fura 2-AM in Krebs-Ringer bicarbonate (KRB) buffer for 45 min at room temperature. The KRB composition was as follows (in mM): 118 NaCl, 25 NaHCO3, 4.7 KCl, 1.2 KH2PO4, 1.2 MgSO4, 1.25 CaCl2, and 10 glucose. The pH of the buffer was adjusted and maintained at 7.4 with 97% O2-3% CO2. The cells were then centrifuged and resuspended in KRB and placed in a cuvette in a dual-wavelength spectrophotometer (Photon Technologies International, South Brunswick, NJ). Fluorescence was measured using excitation wavelengths of 340 and 380 nm and an emission wavelength of 510 nm. Autofluorescence was measured in unloaded cells, and this value was subtracted from all the measurements.

Cellular cAMP assay. Experiments were performed as previously described (2). Briefly, confluent endothelial cells, in 6-well plates, were washed twice with M-199 and incubated in 1 ml of the same medium for 15 min at 37°C. The phosphodiesterase inhibitor IBMX (0.1 mM) was added and incubated for an additional 10 min. The test agents were then added and incubations continued for 10 min. Reactions were stopped by replacing the medium with 1 ml of ice-cold 5% (wt/vol) trichloroacetic acid (TCA) and left on ice for 15 min, and then the cell extract was collected. A 100-µl portion of the sample was taken, and after appropriate dilution, cAMP levels were assayed by commercially available radioimmunoassay kits (Amersham Pharmacia Biotech, Piscataway, NJ).

Nitric oxide determination. Confluent endothelial cells in 6-well plates were washed twice with KRB and incubated in 0.5 ml of KRB for 15 min at 37°C. The test agent was added and incubated for an additional 1 h. Cell culture media were collected and nitric oxide levels measured with a commercially available kit (Calbiochem, San Diego, CA). This kit measures total nitrite concentrations by converting nitrates to nitrites by means of the NADH-dependent enzyme nitrate reductase, and the nitrite is quantitated with a colorimetric reaction using the Griess reagent.

ET-1 measurements. ET-1 measurements were performed as previously described (13). In brief, endothelial cells were grown in 6-well plates, placed in 0.1% fetal calf serum overnight before use, and then incubated for an additional 20 h with the appropriate agonist. For experiments utilizing the GIP antagonist, GIP and the antagonist were added at the same time. For experiments utilizing EGTA-AM, cells were incubated with EGTA-AM (1 or 10 µM) for 10 min, and cells were then washed and stimulated with GIP for 20 h. The cell culture supernatants were removed and ET-1 contents measured with a commercially available RIA kit (Peninsula Labs, San Carlos, CA).

[3H]thymidine incorporation assay. Assays were performed as previously described (5). Briefly, endothelial cells were seeded in 6-well plates at 2 x 105/well and allowed to attach and reach 80% confluence. Cells were then placed in KRB overnight. The KRB buffer was then changed and the appropriate agonist added for an additional 24 h. During the last 6 h of incubation, 1 µCi/well of [3H]thymidine was added. Cells were then washed three times with phosphate-buffered saline, treated twice with 5% TCA (ice cold) for 15 min, washed once with water, and solubilized in 0.3 N sodium hydroxide. The cell-associated radioactivity was then determined by liquid scintillation counting.

Statistics. Results are expressed as means ± SE. Experiments were performed in triplicate except where noted. Data were analyzed using either ANOVA with Bonferroni post hoc testing or unpaired t-tests using a commercial statistical package (Instat; Graphpad, San Diego, CA).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
GIP receptor is present in canine HAEC and PVEC. Although we had previously documented the presence of the GIP receptor in all endothelial cells tested (29), dog endothelial cells were not among those we had examined. Initial experiments focused on whether canine HAEC and PVEC do in fact contain the GIP receptor. As shown in Fig. 1, GIP receptor mRNA could be demonstrated in both HAEC and PVEC by coupled reverse transcription-PCR and confirmed by sequence analysis and Southern analysis. Shown as a control is the human GIP receptor from the immortalized human umbilical vein endothelial cell line ECV 304. Even though the dog GIP receptor has not been cloned, it appears to be similar to the human GIP receptor; thus the RT-PCR assay was based on the sequence of the human GIP receptor. Sequence analysis of the amplified canine GIP receptor fragment shows 98% homology between the two receptors in the region of the RT-PCR assay. As previously described (29), a number of additional splice variants were observed in addition to the predicted wild-type receptor. The specific alternatively spliced products obtained varied on occasion from sample to sample, but the most representative pattern is depicted in Fig. 1. It is as yet unclear to what extent the alternative splicing contributes to the observed effects on GIP action. To determine whether the signal transduction pathways for GIP were different in these two cell types, we first examined the effect of GIP on intracellular calcium.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 1. Glucose-dependent insulinotropic peptide (GIP) receptor is present in both hepatic arterial (HAEC) and portal vein endothelial cells (PVEC) by Southern blot analysis. mRNA was extracted from dog PVEC and HAEC. Samples were PCR amplified and reverse transcribed (RT-PCR) and analyzed by Southern blot. As shown, both PVEC and HAEC contained a transcript of the appropriate size compared with a positive control (human umbilical vein endothelial cell line ECV 304). Shown is a representative blot of 3 different experiments.

 
GIP stimulates an increase in intracellular calcium in HAEC but not PVEC. As a G protein-coupled seven-transmembrane receptor, the GIP receptor can be coupled to both the phosphoinositol-intracellular calcium and the cAMP signal transduction pathways. Previous experiments from our laboratory (29) showed that there were differences in the magnitude of change of intracellular calcium between endothelial cells from umbilical vein and pulmonary artery in response to GIP. As shown in Fig. 2, GIP at concentrations between 10–11 and 10–7 M increased intracellular calcium over baseline. In contrast, GIP had no effect on intracellular calcium in PVEC. Shown in Fig. 2, B and C, are representative traces of changes in intracellular calcium for HAEC and PVEC, respectively. We also examined the effects of GIP on cAMP formation in these two types of endothelial cells.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. GIP increases intracellular calcium in HAEC but not in PVEC. HAEC or PVEC were loaded with the calcium-sensitive probe fura 2. Cells were stimulated with increasing concentrations of GIP and changes in the fluorescence ratio (340/380) measured using a dual-photon spectrofluorometer (A). GIP increased intracellular calcium in HAEC (B) but not in PVEC (C). Results are expressed as means ± SE of the 340/380 ratio of 3 different experiments/data points.

 
GIP has no effect on cAMP production in either HAEC or PVEC. Because GIP has been reported to increase cAMP in various different cell types, we examined GIP's effects on cAMP production. As shown in Fig. 3, GIP did not significantly increase cAMP levels. Interestingly, basal levels of cAMP were higher in PVEC. As a positive control, we used forskolin, an activator of adenylate cyclase, which increased cAMP levels between 30- and 50-fold, demonstrating the viabilility of these cells. In an attempt to determine whether the differential response to GIP in the contractile state of the portal vein vs. the hepatic artery related to differences in GIP stimulation of vasoactive substances, we examined GIP's effect on the production of nitric oxide.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3. GIP has no effect on changes in cellular cAMP content in either HAEC or PVEC. HAEC or PVEC were stimulated with increasing concentrations of GIP. There was no statistically significant change in cAMP in either HAEC or PVEC in response to GIP. In contrast, the positive control forskolin (10 µM) significantly increased cAMP in both HAEC and PVEC. Results are expressed as cellular cAMP content and are means ± SE of 3 different experiments (*P < 0.0001 vs. control).

 
GIP stimulates nitric oxide production in PVEC but not HAEC. Nitric oxide is a potent vasodilator released from the intact endothelium to induce relaxation in the underlying smooth muscle (22). We examined the ability of GIP to stimulate nitric oxide production from HAEC or PVEC. As seen in Fig. 4, GIP stimulated nitric oxide production from PVEC but not HAEC. GIP's effect on nitric oxide production from PVEC became statistically significant at GIP concentrations of 10–10 M or higher. In contrast, even at concentrations as high as 10–7 M, GIP had no effect on nitric oxide production from HAEC. These experiments examined GIP's effects on the vasodilator nitric oxide. Thus we next wished to examine GIP effects on ET-1, a potent vasoconstrictor.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4. GIP increases nitric oxide (NO) production from PVEC but not from HAEC. HAEC or PVEC were stimulated with increasing concentrations of GIP, and NO production was measured. GIP at a concentration of 10–10 M and above had a statistically significant effect on NO production from PVEC but not from HAEC. Shown are means ± SE of 9 different experiments (*P < 0.01 vs. control).

 
GIP increases ET-1 secretion in HAEC but not PVEC through a calcium-mediated mechanism. ET-1 is a potent and long-lasting vasoconstrictor secreted from endothelial cells in response to a large number of factors, including cytokines, peptide hormones, stretch, and shear stress (20). Both HAEC and PVEC were stimulated with increasing concentrations of GIP (Fig. 5). As shown, GIP significantly stimulated ET-1 secretion from HAEC at concentrations of 10–10 M or higher (Fig. 5A). The effect of GIP on ET-1 secretion at the higher concentrations was comparable to that of leptin (10–7 M GIP: 3.05 ± 0.23 ng/ml; 500 ng/ml leptin: 3.18 ± 0.33 ng/ml), a known stimulator of ET-1 secretion from endothelial cells. In contrast, GIP had no significant effect on ET-1 secretion from PVEC (Fig. 5B). To demonstrate that GIP's effect on ET-1 secretion from HAEC was a specific effect, we added GIP (100 nM) to HAEC in the presence or absence of a GIP receptor blocker, GIP-(7–30). As shown in Fig. 6A, GIP-(7–30) at a concentration of 1 µM completely abolished the GIP effect on ET-1, demonstrating the specificity of the effect.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. GIP stimulates endothelin (ET)-1 secretion from HAEC but not from PVEC. HAEC (A) or PVEC (B) were stimulated with increasing concentrations of GIP and ET-1 release into the medium measured after 20 h of stimulation. Shown are means ± SE of 9 different experiments (*P < 0.05; **P < 0.01 vs. control).

 


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 6. GIP-induced ET-1 secretion from HAEC is a calcium-dependent process and is blocked by the GIP antagonist [GIP-(7–30)]. GIP significantly stimulated ET-1 secretion in HAEC. In contrast, GIP-(7–30) had no significant effect by itself on ET-1 secretion (A). However, GIP-induced ET-1 secretion was significantly inhibited by both concentrations of the GIP antagonist. In additional experiments, HAEC were incubated with either 1 or 10 µM of the cell-permeant form of EGTA (B). Cells were then stimulated with 100 nM GIP, and ET-1 secretion was measured. Shown are means ± SE of 9 different experiments (*P < 0.01 vs. control; +P < 0.01 vs. GIP stimulated cells).

 
To further define the underlying mechanism for the GIP effect on ET-1 secretion, we utilized the cell-permeant form of the calcium-binding agent EGTA. Upon entering the cell, the ester form of EGTA is cleaved and trapped inside the cell. EGTA-AM abolishes the GIP-induced elevation in intracellular calcium and, at both 1 and 10 µM, significantly inhibits GIP-induced secretion of ET-1 from HAEC (Fig. 6B). These data suggest that GIP-induced elevations in intracellular calcium are responsible for GIP-stimulated ET-1 secretion.

We (5) have previously shown that GIP stimulates [3H]thymidine incorporation in human umbilical vein endothelial cells through both ET-1-dependent and -independent mechanisms. Thus we next examined GIP's effects on the proliferative response of both HAEC and PVEC.

GIP stimulates [3H]thymidine incorporation in both HAEC and PVEC. For these experiments, [3H]thymidine incorporation was used as an index of the proliferative response. HAEC and PVEC were stimulated with increasing concentrations of GIP, and [3H]thymidine incorporation was measured. As shown in Fig. 7, even though GIP significantly increased the proliferative response in both endothelial cell types, GIP had a larger effect on thymidine incorporation in PVEC than in HAEC. For both HAEC and PVEC, GIP's effect reached a plateau and did not increase further with higher doses of GIP.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 7. GIP stimulates [3H]thymidine incorporation in both HAEC and PVEC. HAEC or PVEC were stimulated with increasing concentrations of GIP, and [3H]thymidine incorporation was measured. Shown are means ± SE of 9 different experiments. (*P < 0.01 vs. control).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The data presented here demonstrate that GIP differentially regulates the signal transduction pathways and hormonal secretion from two different endothelial cell types. We report that GIP stimulates intracellular calcium release and ET-1 secretion from HAEC but not from PVEC. In contrast, GIP was found to stimulate nitric oxide production from PVEC but not from HAEC.

The GIP receptor belongs to the seven-transmembrane domain family of receptors and is widely distributed in the body (26). The GIP receptor is linked to both the cAMP and the phosphoinositol signal transduction pathways (8, 21). However, we (29) have previously shown that the GIP receptor can be differentially linked to one signal transduction pathway or the other. In the present study, we find that GIP increases intracellular calcium in HAEC but not in PVEC. Curiously, however, GIP did not increase cellular cAMP content in either endothelial cell type. This may be related to a coupling of the GIP receptor in PVEC different from the traditional signaling pathways.

GIP is known to play a major role in modulating insulin secretion (8). However, it is clear that GIP has multiple other effects, since its receptor is present in many tissues, including brain, endothelium, intestine, pancreas, adrenal, and bone (3, 26). GIP levels rise rapidly after a meal and remain above fasting values throughout the day. Basal GIP concentrations vary between 0.06 and 0.1 nM and increase to between 0.2 and 0.5 nM postprandially (9, 10, 12, 17, 18, 23). These concentrations are in the range of GIP concentrations found to activate the GIP receptor. GIP probably plays a role as an integrative hormone: it coordinates nutrient absorption and utilization in different tissues in the body (4, 8).

In a study by Kogire et al. (16), the authors demonstrated that infusion of GIP in conscious dogs (at concentrations of 1, 100, or 500 pmol/kg) resulted in a dose-dependent increase in portal vein blood flow (7, 15, and 46% of basal blood flow). The increased mesenteric arterial blood flow was associated with a decrease in vascular resistance. In contrast, hepatic artery blood flow was decreased in a dose-dependent manner (17, 21, and 35% of basal blood flow) at the same GIP concentrations. These results on blood flow with GIP infusion are distinct from the effects of glucagon infusion. Even though the glucagon receptor belongs to the same receptor family as GIP, activation of this receptor in the gut leads to an increase in blood flow in the portal vein but does not change hepatic artery blood flow (16). These findings highlight the fact that GIP plays a very specific and distinct role in modulating postprandial intestinal blood flow.

A key element in nutrient utilization is changes in splanchnic blood flow. Nitric oxide is a potent, short-lived vasodilator that clearly plays an important role in regulating vascular tone. Physiologically, intestinal blood flow is known to change in response to a meal. To maximize nutrient absorption, splanchnic blood flow increases. Nitric oxide appears to play an important role in regulating both basal and postprandial splanchnic blood flow (1). In contrast to the vasodilatory effect of a meal ingestion on splanchnic blood flow, blood flow in some vascular bed decreases after a meal. ET-1 is a potent vasoconstrictor released from endothelial cells in response to multiple signals. ET-1 levels appear to be increased after a meal; thus ET-1 is the most likely hormone responsible for hepatic artery vasoconstriction (19). Interestingly, changes in intracellular calcium are known to stimulate ET-1 release. Therefore GIP's ability to increase intracellular calcium in HAEC but not in PVEC (Fig. 2) may account for the fact that GIP stimulates ET-1 release in HAEC but not in PVEC.

The seemingly disparate effects of GIP on vasodilator release from PVEC and vasoconstrictor release from HAEC would be consistent with what occurs postprandially in vivo, where splanchnic blood flow increases while the blood flow in other vascular beds decreases. The mechanism responsible for the different effects of GIP on these two endothelial cell types is not clear. However, in view of the different effects of GIP on intracellular calcium release in HAEC vs. PVEC, there may be differences in G protein coupling of the receptor to the signal transduction pathways. There is a precedent for this in another member of this receptor family, the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor. Splice variants of the PACAP receptor have been found to be differentially linked to either the cAMP or the phosphoinositol signal transduction pathways (24).

In summary, the present study demonstrates that GIP stimulates release of the vasoconstrictor ET-1 from HAEC while simultaneously stimulating release of the vasodilator nitric oxide from PVEC. The differential effects of GIP on these two endothelial cell types appear to account for previous observations where GIP infusion resulted in increased blood flow in one vascular bed but not another (16).


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by grants from the Veterans Administration Merit Review (C. M. Isales) and the National Space Biomedical Research Institute through National Aeronautic and Space Administration Cooperative Agreement NCC-9-58 (C. M. Isales).


    FOOTNOTES
 

Address for reprint requests and other correspondence: C. M. Isales, Institute of Molecular Medicine and Genetics, Medical College of Georgia, CB-2803, 1120 15th St., Augusta, GA 30912 (E-mail: cisales{at}mail.mcg.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alemany CA, Oh W, and Stonestreet BS. Effects of nitric oxide synthesis inhibition on mesenteric perfusion in young pigs. Am J Physiol Gastrointest Liver Physiol 272: G612–G616, 1997.[Abstract/Free Full Text]
  2. Barrett PQ and Isales CM. The role of cyclic nucleotides in atrial natriuretic peptide-mediated inhibition of aldosterone secretion. Endocrinology 122: 799–808, 1988.[Abstract/Free Full Text]
  3. Bollag RJ, Zhong Q, Phillips P, Min L, Zhong L, Cameron R, Mulloy AL, Rasmussen H, Qin F, Ding KH, and Isales CM. Osteoblast-derived cells express functional glucose-dependent insulinotropic peptide receptors. Endocrinology 141: 1228–1235, 2000.[Abstract/Free Full Text]
  4. Brubaker PL and Drucker DJ. Structure-function of the glucagon receptor family of G protein-coupled receptors: the glucagon, GIP, GLP-1, and GLP-2 receptors. Receptors Channels 8: 179–188, 2002.[CrossRef][Web of Science][Medline]
  5. Ding KH, Zhong Q, and Isales CM. Glucose-dependent insulinotropic peptide stimulates thymidine incorporation in endothelial cells: role of endothelin-1. Am J Physiol Endocrinol Metab 285: E390–E396, 2003.[Abstract/Free Full Text]
  6. Ehses JA, Lee SS, Pederson RA, and McIntosh CH. A new pathway for glucose-dependent insulinotropic polypeptide (GIP) receptor signaling: evidence for the involvement of phospholipase A2 in GIP-stimulated insulin secretion. J Biol Chem 276: 23667–23673, 2001.[Abstract/Free Full Text]
  7. Fara JW and Salazar AM. Gastric inhibitory polypeptide increases mesenteric blood flow. Proc Soc Exp Biol Med 158: 446–448, 1978.[CrossRef][Medline]
  8. Fehmann HC, Goke R, and Goke B. Cell and molecular biology of the incretin hormones glucagon-like peptide-I and glucose-dependent insulin releasing polypeptide. Endocr Rev 16: 390–410, 1995.[Abstract/Free Full Text]
  9. Fieseler P, Bridenbaugh S, Nustede R, Martell J, Orskov C, Holst JJ, and Nauck MA. Physiological augmentation of amino acid-induced insulin secretion by GIP and GLP-I but not by CCK-8. Am J Physiol Endocrinol Metab 268: E949–E955, 1995.[Abstract/Free Full Text]
  10. Gama R, Norris F, Wright J, Morgan L, Hampton S, Watkins S, and Marks V. The entero-insular axis in polycystic ovarian syndrome. Ann Clin Biochem 33: 190–195, 1996.[Web of Science][Medline]
  11. Gasalla-Herraiz J, Rhee S, and Isales CM. Calcium-sensitive probes for the measurement of intracellular calcium: effects of buffer system and magnesium concentration. Biochem Biophys Res Commun 214: 373–388, 1995.[CrossRef][Web of Science][Medline]
  12. Herrmann C, Goke R, Richter G, Fehmann HC, Arnold R, and Goke B. Glucagon-like peptide-1 and glucose-dependent insulin-releasing polypeptide plasma levels in response to nutrients. Digestion 56: 117–126, 1995.[Web of Science][Medline]
  13. Isales CM, Sumpio B, Bollag RJ, Zhong Q, Ding KH, Du W, Rodriguez-Commes J, Lopez R, Rosales OR, Gasalla-Herraiz J, McCarthy R, and Barrett PQ. Functional parathyroid hormone receptors are present in an umbilical vein endothelial cell line. Am J Physiol Endocrinol Metab 279: E654–E662, 2000.[Abstract/Free Full Text]
  14. Jia X, Brown JC, Ma P, Pederson RA, and McIntosh CH. Effects of glucose-dependent insulinotropic polypeptide and glucagon-like peptide-I-(7–36) on insulin secretion. Am J Physiol Endocrinol Metab 268: E645–E651, 1995.[Abstract/Free Full Text]
  15. Kogire M, Inoue K, Sumi S, Doi R, Takaori K, Yun M, Fuji N, Yajima H, and Tobe T. Effects of synthetic human gastric inhibitory polypeptide on splanchnic circulation in dogs. Gastroenterology 95: 1636–1640, 1988.[Web of Science][Medline]
  16. Kogire M, Inoue K, Sumi S, Doi R, Yun M, Kaji H, and Tobe T. Effects of gastric inhibitory polypeptide and glucagon on portal venous and hepatic arterial flow in conscious dogs. Dig Dis Sci 37: 1666–1670, 1992.[CrossRef][Web of Science][Medline]
  17. Kruszynska YT, Ghatei MA, Bloom SR, and McIntyre N. Insulin secretion and plasma levels of glucose-dependent insulinotropic peptide and glucagon-like peptide 1 [7–36 amide] after oral glucose in cirrhosis. Hepatology 21: 933–941, 1995.[CrossRef][Web of Science][Medline]
  18. Lacroix A, Bolte E, Tremblay J, Dupre J, Poitras P, Fournier H, Garon J, Garrel D, Bayard F, Taillefer R, Flanagan RJ, and Hamet P. Gastric inhibitory polypeptide-dependent cortisol hypersecretion—a new cause of Cushing's syndrome. N Engl J Med 327: 974–980, 1992.[Abstract]
  19. Ludwig D, Schadel S, Bruning A, Schiefer B, and Stange EF. 48-Hour hemodynamic effects of octreotide on postprandial splanchnic hyperemia in patients with liver cirrhosis and portal hypertension: double-blind, placebo-controlled study. Dig Dis Sci 45: 1019–1027, 2000.[CrossRef][Web of Science][Medline]
  20. Luscher TF and Barton M. Endothelins and endothelin receptor antagonists: therapeutic considerations for a novel class of cardiovascular drugs. Circulation 102: 2434–2440, 2000.[Abstract/Free Full Text]
  21. McIntosh CH, Wheeler MB, Gelling RW, Brown JC, and Pederson RA. GIP receptors and signal-transduction mechanisms. Acta Physiol Scand 157: 361–365, 1996.[CrossRef][Web of Science][Medline]
  22. Moncada S, Palmer RM, and Higgs EA. Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol Rev 43: 109–142, 1991.[Web of Science][Medline]
  23. Schirra J, Katschinski M, Weidmann C, Schafer T, Wank U, Arnold R, and Goke B. Gastric emptying and release of incretin hormones after glucose ingestion in humans. J Clin Invest 97: 92–103, 1996.[Web of Science][Medline]
  24. Spengler D, Waeber C, Pantaloni C, Holsboer F, Bockaert J, Seeburg PH, and Journot L. Differential signal transduction by five splice variants of the PACAP receptor. Nature 365: 170–175, 1993.[CrossRef][Medline]
  25. Tamatani S, Ozawa T, Minakawa T, Takeuchi S, Koike T, and Tanaka R. Histological interaction of cultured endothelial cells and endovascular embolic materials coated with extracellular matrix. J Neurosurg 86: 109–112, 1997.[Web of Science][Medline]
  26. Usdin TB, Mezey E, Button DC, Brownstein MJ, and Bonner TI. Gastric inhibitory polypeptide receptor, a member of the secretin-vasoactive intestinal peptide receptor family, is widely distributed in peripheral organs and the brain. Endocrinology 133: 2861–2870, 1993.[Abstract/Free Full Text]
  27. Yip RG, Boylan MO, Kieffer TJ, and Wolfe MM. Functional GIP receptors are present on adipocytes. Endocrinology 139: 4004–4007, 1998.[Abstract/Free Full Text]
  28. Yip RG and Wolfe MM. GIP biology and fat metabolism. Life Sci 66: 91–103, 2000.[CrossRef][Web of Science][Medline]
  29. Zhong Q, Bollag RJ, Dransfield DT, Gasalla-Herraiz J, Ding K, Min L, and Isales CM. Glucose-dependent insulinotropic peptide signaling pathways in endothelial cells. Peptides 21: 1427–1432, 2000.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Q. Zhong, T. Itokawa, S. Sridhar, K.-H. Ding, D. Xie, B. Kang, W. B. Bollag, R. J. Bollag, M. Hamrick, K. Insogna, et al.
Effects of glucose-dependent insulinotropic peptide on osteoclast function
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E543 - E548.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/5/E773    most recent
00507.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ding, K.-H.
Right arrow Articles by Isales, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ding, K.-H.
Right arrow Articles by Isales, C. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.