AJP - Endo Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 286: E194-E200, 2004. First published October 14, 2003; doi:10.1152/ajpendo.00147.2003
0193-1849/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/2/E194    most recent
00147.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (55)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mahlapuu, M.
Right arrow Articles by Marklund, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mahlapuu, M.
Right arrow Articles by Marklund, S.

Expression profiling of the {gamma}-subunit isoforms of AMP-activated protein kinase suggests a major role for {gamma}3 in white skeletal muscle

Margit Mahlapuu,1,* Carina Johansson,1,* Kerstin Lindgren,1 Göran Hjälm,2 Brian R. Barnes,3 Anna Krook,3 Juleen R. Zierath,3 Leif Andersson,2,4 and Stefan Marklund2

1Arexis AB, SE-413 46 Gothenburg; 2Department of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, and 4Department of Medical Biochemistry and Microbiology, Uppsala University, Uppsala Biomedical Center, SE-751 23 Uppsala; and 3Department of Surgical Sciences, Karolinska Institutet, SE-171 77 Stockholm, Sweden

Submitted 3 April 2003 ; accepted in final form 6 October 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression patterns of the three isoforms of the regulatory {gamma}-subunit of AMP-activated protein kinase (AMPK) were determined in various tissues from adult humans, mice, and rats, as well as in human primary muscle cells. Real-time PCR-based quantification of mRNA showed similar expression patterns in the three species and a good correlation with protein expression in mice and rats. The {gamma}3-isoform appeared highly specific to skeletal muscle, whereas {gamma}1 and {gamma}2 showed broad tissue distributions. Moreover, the proportion of white, type IIb fibers in the mouse and rat muscle samples, as indicated by real-time PCR quantification of Atp1b2 mRNA, showed a strong positive correlation with the expression of {gamma}3. In samples of white skeletal muscle, {gamma}3 clearly appeared to be the most abundant {gamma}-isoform. Differentiation of human primary muscle cells from myoblasts into multinucleated myotubes was accompanied by upregulation of {gamma}3 mRNA expression, whereas levels of {gamma}1 and {gamma}2 remained largely unchanged. However, even in these cultured myotubes, {gamma}2 was the most highly expressed isoform, indicating a considerable difference compared with adult skeletal muscle. Immunoblot analysis of mouse gastrocnemius and quadriceps muscle extracts precipitated with a {gamma}3-specific antibody showed that {gamma}3 was exclusively associated with the {alpha}2- and {beta}2-subunit isoforms. The observation that the AMPK{gamma}3 isoform is expressed primarily in white skeletal muscle, in which it is the predominant {gamma}-isoform, strongly suggests that {gamma}3 has a key role in this tissue.

adenosine monophosphate; real-time polymerase chain reaction; antibodies; mouse; rat; human


AMP-ACTIVATED PROTEIN KINASE (AMPK) is a fuel-sensing enzyme that plays a key role in regulation of carbohydrate and fat metabolism in response to cellular stress (10, 21). When activated by energy depletion, AMPK switches off ATP-consuming processes while switching on pathways that generate ATP. AMPK acts via phosphorylation of downstream metabolic enzymes as well as via effects on gene expression. AMPK is expressed in most mammalian tissues, but its actions have most widely been studied in skeletal muscle. The alternation in energy charge during exercise activates AMPK, which is associated with enhanced glucose uptake and fatty acid oxidation. Together, these mechanisms provide the working muscle with additional substrates for ATP-generating processes.

AMPK is a heterotrimeric complex comprising a catalytic {alpha}-subunit and two regulatory components ({beta} and {gamma}), all of which are required for full activity. The understanding of the AMPK system is complicated because of the existence of two {alpha}- and two {beta}-isoforms ({alpha}1, {alpha}2, {beta}1, {beta}2) and three {gamma}-isoforms ({gamma}1, {gamma}2, {gamma}3), all encoded by different genes. Thus 12 different heterotrimeric combinations of AMPK may potentially form, and the physiological function of the AMPK holoenzyme depends on the particular isoforms present in the complex (7, 19). A clear tissue distribution profile and the relative expression of different isoforms can shed light on AMPK function in the specific metabolic pathways studied. Previously reported expression differences between subunit isoforms include tissue distribution and cellular location (6, 7, 15, 16, 18, 19). Northern blot analysis in human tissues has provided evidence that the mRNA expression of the {gamma}3-isoform is restricted to skeletal muscle, whereas {gamma}1 and {gamma}2 show broad tissue distributions (7, 15). Furthermore, immunoprecipitation studies of AMPK with subsequent kinase assays have indicated that {gamma}1 is the predominant isoform contributing to kinase activity in skeletal muscle (7, 9). This observation is surprising considering the high {gamma}3 mRNA expression specifically directed to skeletal muscle and the critical role of {gamma}3 in pig skeletal muscle, as indicated by the identification of a mutation causing a 70% increase of muscle glycogen (15). Of note is the finding that this mutation leads to an increase in glycogen content and influences enzyme activities in skeletal muscles with a large proportion of white muscle fibers (2, 14). This implies that, even within divergent skeletal muscle types, the {gamma}-isoforms affects metabolic pathways differently. Additional data on tissue distribution and relative expression of different {gamma}-isoforms can elucidate their specific contribution to AMPK function.

In this study, we have determined the expression patterns of the genes encoding AMPK{gamma} isoforms in various human, mouse, and rat tissues, including skeletal muscles of different fiber type composition. Additionally, we have analyzed human primary muscle cells (HPMC) as a model system for studies of AMPK function. HPMC, originating from satellite cells, can be induced to differentiate in culture to form multinucleated myotubes (1), and they have been used as a model system for studies of insulin action and glucose metabolism. We report real-time PCR-based analyses of the distribution and relative amounts of mRNA representing the three AMPK{gamma} isoforms as well as data on the tissue distribution of each isoform at the protein level. Finally, we show the {alpha}- and {beta}-subunit composition in {gamma}3-containing AMPK complexes in mouse skeletal muscle.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture, tissues, and RNA isolation. HPMC originate from satellite cells, a population of stem cells responsible for postnatal growth, repair, and maintenance of skeletal muscle (17). The HPMC used here were cultured from satellite cells isolated from biopsies of rectus abdominus muscle from three healthy subjects. The ethics committee at Karolinska Institutet approved the protocols, and informed consent was obtained from the subjects. Biopsies were obtained during scheduled abdominal surgery. Isolation of satellite cells and initiation of differentiation program was performed as previously described (1). Cultures were harvested on day 0 (corresponding to mononucleated myoblasts) or day 14 (corresponding to polynucleated myotubes) after initiation of differentiation, and preparation of RNA and protein was performed as described previously (1).

Fed C57Bl/6 mice (one male and one female for each tissue, 8–12 wk of age) and Wistar rats (2–4 males per tissue, 8 wk of age) were anesthetized with an intraperitoneal injection of either 2.5% avertin (0.02 ml/g body wt) for mice or pentobarbital sodium (5 mg/100 g body wt) for rats. Tissue samples, including liver, heart, extensor digitorum longus (EDL), gastrocnemius, quadriceps, soleus, and diaphragm muscles, brain, white adipose tissue (WAT), brown adipose tissue (BAT), lung, spleen, kidney, and testis were collected. Thus a variety of rodent hindlimb skeletal muscles were obtained that contained predominantly red, slow-twitch, type I fibers (e.g., the soleus) or predominantly fast-twitch fibers [e.g., the EDL, gastrocnemius, and quadriceps with fiber types IIa, IIb (2, 3)]. In the case of the gastrocnemius and quadriceps muscles in rats, the red (predominantly fast-twitch, oxidative-glycolytic type IIa fibers) and white (predominantly fast-twitch, glycolytic type IIb fibers) parts of the muscle could be visually recognized and were analyzed separately. The Ethics Committee on Animal Research in Northern Stockholm approved all experimental protocols. Poly(A+) RNA was isolated from mouse and rat samples using the Quickprep Micro mRNA purification Kit (Amersham Biosciences, Little Chalfont, Buckinghamshire, UK).

Relative quantification of mRNA using real-time PCR. Quantification of AMPK{gamma} mRNA from adult mouse, rat and human tissues, as well as from HPMC cultures, was performed using real-time PCR with the ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Warrington, UK) and SYBR-green (human samples) or Taqman chemistry (mouse and rat samples). To indicate the relative proportion of different fiber types in each mouse and rat muscle sample, real-time PCR was used to quantify the relative amounts of Atp1b1 and Atp1b2 mRNA, which encode the ATPase, Na+/K+ transporting, {beta}1- and {beta}2-polypeptides, respectively. Predominant expression of Atp1b1 and Atp1b2 in red, slow-twitch, type I fibers and fast-twitch, glycolytic type IIb fibers, respectively, has been shown previously (11). The relative quantities of different mRNA transcripts were calculated after normalization of the data against a housekeeping gene (see below) by use of the comparative CT method (20).

Real-time RT-PCR on human samples. Human tissue-specific Poly(A+) RNA (pooled from 3–20 male/female Caucasians; Clontech Laboratories, Palo Alto, CA) and RNA from HPMC were used as a template for cDNA synthesis using Superscript II RNaseH Reverse Transcriptase and oligo(dT) primers (Invitrogen, San Diego, CA). All samples were analyzed in triplicate, and the data were normalized using the peptidylprolyl isomerase A (PPIA) and {beta}-actin (ACTB) genes as internal controls. One of the primers in each amplicon was spanning an exon/intron boundary. The forward (F) and reverse (R) primer sequences were as follows, 5'-3': for the PRKAG1 gene (encoding AMPK{gamma}1; GenBank NM_002733 [GenBank] ) TGGAAGCAGAGGTTCACCGA (F) and TCTCCACCTGTGAGCACCAG (R); for PRKAG2 (encoding AMPK{gamma}2; GenBank AJ249976 [GenBank] ) CCAGATGCAAGCCTCTTCGA (F) and GTGCATTCCCACTGATAGGGTC (R); for PRKAG3 (encoding AMPK{gamma}3; GenBank NM_017431 [GenBank] ) CCGCTTTGATGTGATTCACCT (F) and GGGCTTCTCCCACACTCATG (R).

Real-time RT-PCR on mouse and rat samples. Reverse transcription on mouse and rat mRNA samples was performed using the First-Strand cDNA Synthesis Kit (Amersham Biosciences) with random hexamer priming in 15-µl reactions, as recommended by the manufacturer. The cDNA was then purified using the QIAquick PCR purification Kit (Qiagen, Hilden, Germany) and used in 25-µl TaqMan PCR reactions with 17.5 pmol of each PCR primer, a 6.25-pmol probe, and 1x TaqMan Universal PCR Master Mix (PE Applied Biosystems, Foster City, CA). In each Taqman amplicon, either the probe or the 3' end of one of the primers included sequences from adjacent exons. The primers and probes (P) were as follows, 5'-3': mouse Prkag1 (GenBank AH010706 [GenBank] ) CAAGTTCCAAGTTGGTGGTATTTG (F), CGAACACCATTGGTCACCAG (R), TET-CACTTCGCTACAGGTAAAGAAAGCCTTTTTTGC-TAMRA (P); rat Prkag1 (GenBank U42413 [GenBank] ) GCTCCAAGCTGGTGGTATTTG (F), GGCAGCACGAACACCGTTA (R), TET-TACTTCGCTGCAGGTAAAGAAAGCCTTCTTTG-TAMRA (P); mouse/rat Prkag2 (targeting both described Prkag2 transcripts; GenBank NM_145401 [GenBank] and XM_231276 [GenBank] ) ATACTTACCCACAAAAGAATCCTCAAG (F), AGCTCATCCAGGTTCTGCTTC (R), TET-TCCTCCAGCTTTTTATGTCTGACATGCCAA-TAMRA (P); mouse/rat Prkag2-a transcript [corresponding to the human PRKAG2-a (13) GenBank NM_145401 [GenBank] and Ensembl Transcript ID: ENSRNOT00000012111] AAGAGGCGGTCACTGCGA (F), CTCCACATCTCCATCCAGGAG (R), TET-CACATTCCGGACCTGAGTTCCTTTGC-TAMRA; mouse/rat Prkag2-b transcript [corresponding to the human PRKAG2-b (13) GenBank BQ572978 [GenBank] and AY348865 [GenBank] ] CGCGGCCCATGCTGAT (F), AAACGCCACTTTCTGAGTCTTCTT (R, used on mouse samples), AAACGCCACTCTCTGAGTCTTCTT (R, used on rat samples), TET-CTCCTGGAACTCCAGCTTCTCCAGCAT-TAMRA (P); mouse/rat Prkag3 (GenBank AF525500 [GenBank] and XM_237293 [GenBank] ) AGAGCCTAGGTGAAGTCATTGACA (F), AGATGGCTTGGGTGTGAGGA (R, used on mouse samples), GCTGGGTCTCATCCACCAA (R, used on rat samples), TET-ACCAGCCTATGCACCTGTTCCCGTG-TAMRA (P); mouse/rat Atp1b1 (GenBank NM_009721 [GenBank] .1 and NM_013113 [GenBank] .1) TCATCTGGAACTCGGAGAAGAAG (F), AATATCACGTAGAACAGAAGGATCTTAAAC (R), FAM-AACTACCACCGGTCCTGCCCAAAAACT-TAMRA; and for mouse/rat Atp1b2 (GenBank NM_013415 [GenBank] .1 and NM_012507 [GenBank] .1) GGGACCAGCTGGGCC (F), AGCATTACCCACATGGTGAGG (R), FAM-CCTCTTCTACCTCGTCTTCTATGGTTTCCTCACG-TAMRA.

All samples were analyzed in duplicate, and the data were normalized using the Actb ({beta}-actin) gene as an internal control.

Quantitative analysis of protein expression. Approximately 20 mg of tissue from male mice/rats were ground to powder under liquid nitrogen and homogenized in an ice-cold lysis buffer (50 mM HEPES, 1% Triton X-100, 1 mM DTT, 10% glycerol, 1 mM EDTA, 5 mM NaPP, 50 mM NaF, and proteolytic enzyme inhibitors) by use of a motor-driven pestle in a 1.5-ml microcentrifuge tube. The homogenate was kept on ice for 30 min, and insoluble material was removed by centrifugation (9,000 rpm, 10 min, 4°C). Supernatants were removed, and total protein content was measured by the bicinchoninic acid method (Pierce Chemical, Rockford, IL). The samples were run on 4–12% precast polyacrylamide gels (Invitrogen) with 40 µg protein lysate/lane and transferred to Immobilon-P membranes (Millipore, Bedford, MA) by semidry transfer (20 V, 45 min). Membranes were blocked by incubation in Tris-buffered saline (TBS; 0.137 M NaCl, 20 mM Tris, pH 7.6) containing 5% low-fat milk powder for 1 h at room temperature and probed with primary antibodies for 1–18 h in TBS containing 2.5% low-fat milk powder. Antibodies against the {gamma}1-subunit were raised using the synthetic peptide CALENEHFQETPESN (residues 12–25 of {gamma}1), against the {gamma}2-subunit using the CKRRSLRVHIPDLSS peptide (residues 29–42 of {gamma}2) or CLTPAGAKQKETETE peptide (residues 556–569 of {gamma}2), and against {gamma}3 using the MSVGEALRQRTLCLEG peptide (residues 415–431 of {gamma}3). The antibodies were affinity-purified using the SulfoLink Kit (Pierce Chemical, Rockford, IL) and following the manufacturer's instructions. After three washing steps with TBS-Tween (0.5% Tween 20 in TBS) for 10 min each, the membrane was incubated for 1 h with horseradish peroxidase-conjugated secondary antibody in TBS containing 2.5% low-fat milk powder. After further extensive washing in TBS-Tween, the blots were developed using enhanced chemiluminescence (Amersham Biosciences) and captured on X-ray film. Densitometry-derived values reflecting band intensities were used for quantification by Image Gauge V3.01 software (Fujifilm, Tokyo, Japan). Quantification was based on Western blot analysis of three different individuals, and the expression level of corresponding protein in EDL muscle was taken as 100%. As size markers in the Western analysis, bacterially expressed AMPK {gamma}-subunit proteins were included in each SDS-PAGE. Briefly, synthetic oligos designed for amplification of the full-length open-reading frames of the different {gamma}-subunits (GenBank nos. AF036535 [GenBank] , AJ249976 [GenBank] , and AJ249977 [GenBank] ) were used in RT-PCR with first cDNA strands synthesized with mouse or human skeletal muscle RNA as template. PCR fragments were cloned into the pQE-32 vector (Qiagen) in frame after an NH2-terminal His6 tag. Fusion protein from isopropyl-{beta}-D-thiogalactopyranoside-induced TOP10F' bacteria (Invitrogen) was purified by a nitrilotriacetic acid chromatography matrix (Qiagen).

Immunoprecipitation of {gamma}3-containing complexes. For immunoprecipitation studies, 50-mg samples from mouse gastrocnemius or quadriceps muscles were homogenized, and lysate was prepared as described above. AMPK{gamma}3-containing complexes were immunoprecipitated from equal amounts of muscle lysate by incubation with an anti-{gamma}3 antibody prebound to protein A-Sepharose for 2 h on a roller mixer at 4°C. The immune complexes were washed four times with an ice-cold lysis buffer containing 0.5 mM NaCl and resolved using SDS-PAGE, followed by Western blotting with affinity-purified rabbit antibodies as described above. Antibodies against the {alpha}1-subunit were raised with the synthetic peptide CRHTLDELNPQKSKH (residues 377–389 of {alpha}1), against {alpha}2 with the CDDSAMHIPPGLKPH peptide (residues 353–366 of {alpha}2), against {beta}1 with the CKAPEKEEFLAWQHD peptide (residues 53–66 of {beta}1) and against {beta}2 with the CSVFSLPDSKLPGDK peptide (residues 44–57 of {beta}2). Protein A conjugated to horseradish peroxidase (Amersham Biosciences) was used for detection.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
mRNA expression. The real-time PCR measurements of the relative expression levels of mRNA representing different AMPK{gamma} isoforms in human, mouse, and rat tissues are presented in Fig. 1. The expression of the {gamma}3-isoform appeared highly specific for skeletal muscle in all species examined. Conversely, expression of {gamma}1 and {gamma}2 showed a broad tissue distribution. ANOVA was performed with the mouse and rat data but did not show any significant effect of sex or covariation between the mRNA levels of the three isoforms (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Relative expression of AMP-activated protein kinase (AMPK) {gamma}-subunit isoform mRNA in human (A), mouse (B), and rat (C) tissues assessed by real-time PCR analysis. Values are normalized to the endogenous control and expressed as percentage of the highest value in each species: {gamma}3 mRNA level in skeletal muscle (human), gastrocnemius (mouse), or white quadriceps (rat). Li, liver; H, heart; P, pancreas; SM, skeletal muscle; HPMC, human primary muscle cells, differentiated stage (myotubes); EDL, extensor digitorum longus; RG, red gastrocnemius; WG, white gastrocnemius; RQ, red quadriceps; WQ, white quadriceps; S, soleus; D, diaphragm; B, brain; T, testis; WAT, white adipose tissue; BAT, brown adipose tissue; Lu, lung; Sp, spleen; K, kidney. Mouse and rat AMPK{gamma} mRNA data are means ± SE from 2–4 different animals, except for mouse testis, which is based on a single sample. For mouse and rat muscle samples, the Atp1b2 and Atb1b1 mRNA expression levels in relation to the endogenous control (Actb) are shown to indicate the fiber composition.

 

The mRNA expression of AMPK{gamma} isoforms in the HPMC established from rectus abdominus muscle showed severalfold higher mRNA expression of {gamma}2 than of {gamma}1 and {gamma}3 (Figs. 1A and 2). Moreover, differentiation of HPMC from myoblasts into polynucleated myotubes was accompanied by an approximately fivefold increase in mRNA levels of {gamma}3, with only minor changes in {gamma}1 and {gamma}2 (Fig. 2).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Expression of mRNA from PRKAG1 ({gamma}1; A), PRKAG2 ({gamma}2; B), and PRKAG3 ({gamma}3; C) in HPMC assessed by real-time PCR analysis. Values are normalized to an endogenous control and expressed as means ± SE. Data were compiled from HPMC cultures established from 3 healthy individuals. D: levels of AMPK{gamma}3 protein in HPMC revealed by Western blot analysis. MB, myoblasts; MT, myotubes; SM, adult human skeletal muscle.

 

In mice, an 8- to 33-fold higher {gamma}3 mRNA expression was observed in skeletal muscles containing mostly fast-twitch (type II) fibers (EDL, gastrocnemius and quadriceps) compared with the soleus muscle, which is composed mostly of slow (type I) fibers (Fig. 1B). Furthermore, when red (type IIa) and white (type IIb) portions of rat gastrocnemius and quadriceps muscles were analyzed separately, {gamma}3 mRNA expression was found to be three- to ninefold higher in the white vs. red portions of the muscle (Fig. 1C). In these white muscle portions, the {gamma}3/{gamma}1 and {gamma}3/{gamma}2 mRNA expression ratios were in the range 9-13 and 27-44, respectively. The proportion of fast-twitch glycolytic (type IIb) fibers in the mouse and rat muscle samples, as indicated by real-time PCR quantification of Atp1b2 mRNA, showed a highly significant correlation with the expression of {gamma}3 mRNA (Pearson coefficient = 0.84, P < 0.001; Fig. 1, B and C). The {gamma}1 and {gamma}2 expression levels did not vary between red and white portions of rat skeletal muscle. However, in mice and rats, we observed slightly lower {gamma}2 expression in the soleus muscle, with a greater proportion of type I fibers compared with skeletal muscle composed predominantly of type II fibers.

Expression of {gamma}2 mRNA showed a broad tissue distribution in all of the three species tested. In mice and rats, we detected the highest levels of {gamma}2 mRNA in testis and BAT, whereas we found the highest human {gamma}2 mRNA expression in heart (Fig. 1). In mice and rats, real-time PCR analysis was also used to quantify the relative proportions of the two different {gamma}2 transcripts previously observed in humans [PRKAG2-a and PRKAG2-b (7, 13)], which showed that Prkag2-a is the highly predominant transcript in most tissues (Table 1). In fact, the highest Prkag2-b proportions of the total Prkag2 were found in skeletal muscle (<=48% in mice) and brain (~16%).


View this table:
[in this window]
[in a new window]
 
Table 1. Relative expression of the Prkag2-a and Prkag2-b transcripts* in mouse and rat tissues as measured by real-time PCR

 

Protein expression. To complement the data on the relative abundance of {gamma} mRNA with data at the protein level, we performed Western blot analysis on mouse and rat tissues. This showed a positive correlation between mRNA and protein expression in different skeletal muscles and confirmed that {gamma}3 is expressed primarily in white skeletal muscle (Fig. 3, A and B). For example, the levels of {gamma}3 mRNA and {gamma}3 protein were both highest in white parts of gastrocnemius and quadriceps muscles in rats (Figs. 1C and 3B). By using an anti-{gamma}2 antibody, which detects both the longer ({gamma}2a) and the shorter ({gamma}2b) variants of the protein, we also confirmed highly predominant expression of {gamma}2 protein encoded by the Prkag2-a transcript in relation to the Prkag2-b (Fig. 3C).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3. Protein expression profiles of AMPK{gamma} subunit isoforms as revealed by Western blot analyses of mouse (A) and rat (B) tissues. In rats, the white (W) and red (R) parts of gastrocnemius and quadriceps muscle were separated. Samples were resolved by SDS-PAGE and immunoblotted with antibodies against AMPK{gamma}1 (epitope ALENEHFQETPESN, residues 12–25 of {gamma}1), {gamma}2 [epitope KRRSLRVHIPDLSS, residues 29–42 of {gamma}2 (A) or LTPAGAKQKETETE, residues 556–569 of {gamma}2 (B)], or {gamma}3 (epitope MSVGEALRQRTLCLEG, residues 415–431 of {gamma}3). Quantification is based on results from 3 different animals and shown as means ± SE. Inset: representative blot from 1 animal. The apparent double band for AMPK{gamma}3 in A is frequently seen after separation on a SDS-PAGE gel and may relate to the protease-sensitive site within the protein. C: relative abundance of 2 protein variants of AMPK{gamma}2 ({gamma}2a and {gamma}2b) in mouse quadriceps, heart, and liver assessed by Western blot analysis. In this case, the anti-{gamma}2 antibody used detects both the longer ({gamma}2a) and the shorter ({gamma}2b) variants of the protein (epitope LTPAGAKQKETETE, residues 556–569 of {gamma}2). D: subunit composition of {gamma}3-containing AMPK complexes in skeletal muscle. AMPK complexes were immunoprecipitated from mouse gastrocnemius and quadriceps muscles using anti-{gamma}3 antibody bound to protein A-Sepharose. The presence of different {alpha}- and {beta}-subunits in {gamma}3-containing complexes was estimated by Western blot analyses. Corresponding bacterially expressed His-tagged proteins (BCT) were included in each SDS-PAGE run to serve as size markers. In D, equal amounts of bacterially expressed {alpha}1/{alpha}2 and {beta}1/{beta}2 proteins were loaded.

 

Some discrepancies between our mRNA and protein expression data could be noted. For example, although very low {gamma}1 mRNA expression was observed in mouse brain and WAT, the amount of the {gamma}1 protein in these tissues reached similar levels to what was observed for heart and skeletal muscle. Likewise, the relative abundance of {gamma}2 protein in mouse heart appears to be lower than one would predict on the basis of our mRNA expression analysis (Figs. 1B and 3A). This may reflect a true biological difference; however, we cannot exclude the possibility that these differences were caused by minor variations between samples used for mRNA and protein isolation.

To define the subunit composition of {gamma}3-containing complexes in the skeletal muscle, we immunoprecipitated extracts from mouse gastrocnemius and quadriceps muscle with {gamma}3-specific antibody and performed immunoblot analysis to determine {alpha}- and {beta}-subunit isoforms (Fig. 3D). In both of these muscles types, the {gamma}3-subunit was detected only in association with the AMPK {alpha}2- and {beta}2-isoforms.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we demonstrate that expression of the AMPK{gamma}3 isoform shows a high degree of specificity for white skeletal muscle and clearly appears to be the most highly expressed {gamma}-isoform in this muscle type. The expression profile described fits well with the dramatic effect on glycogen content in pig skeletal muscle caused by a mutation in the PRKAG3 gene encoding {gamma}3 (15). The increased glycogen levels found are particularly pronounced in white skeletal muscles, which is in good correlation with our data (14). The results are also consistent with previously published Northern blot results in humans, showing that {gamma}3 is specifically expressed in skeletal muscle, whereas {gamma}1 and {gamma}2 are more widely distributed (7, 15).

The data presented here show the mRNA expression ratios between the three {gamma}-isoforms in several tissues, with a high degree of consistency between the three mammalian species investigated. Moreover, our observations of protein expression in mice and rats largely confirm the tissue distribution of each {gamma}-isoform observed at the mRNA level. Yet our data on {gamma}3 expression in skeletal muscle are obviously in contrast to previously published results of Western blot analysis of AMPK subunit isoforms in rats, which showed undetectable levels of {gamma}3 in white quadriceps, but small amounts of {gamma}3 in red quadriceps (9). We also find a surprising contrast between the results presented here and previously reported data showing very low proportion of {gamma}3-related AMPK activity in rat skeletal muscle (7, 9), whereas the activity was considerably higher in brain and testis (7). The latter observations, however, were not direct measurements of {gamma}3 expression but were based on the AMPK activity, measured as the level of phosphorylation of the SAMS-peptide, after immunoprecipitation with isoform-specific antibodies. Hence, we cannot exclude the possibility that this principal difference in methodology may explain some of the discrepancies. For example, the presence of inactive {gamma}3-containing complexes or free {gamma}3 (not bound in AMPK complex) may explain why high {gamma}3 expression can be observed despite low {gamma}3-associated activity. Such explanations, however, do not seem to clarify why we observe practically no {gamma}3 mRNA or {gamma}3 protein in brain and testis in contrast to the previous data showing relatively high {gamma}3-related activity in these tissues (7). In fact, we found {gamma}1/{gamma}3 and {gamma}2/{gamma}3 mRNA expression ratios higher than 150 in brain samples from rats, mice, and humans. The situation was similar in testis, where the human and rat/mouse {gamma}3 mRNA fractions of the total {gamma}-mRNA were <2% and 0.02%, respectively. The reason(s) for these conflicting data may have to do with the different anti-{gamma}3 antibodies used, their specificity, and location in the peptide sequence. For example, one possibility is the existence of more or less tissue-specific splice variants affecting an epitope for antibody binding. The anti-{gamma}3 antibody used in this study binds a carboxy-terminal epitope whereas the antibodies used in the previous studies (7, 9) bind NH2-terminal epitopes. Although the reason(s) for the conflicting data discussed above is still unclear, the protein expression data in mice and rats presented here are fully consistent with our mRNA data. Also, the specificity of our anti-{gamma}3 antibody has been confirmed using a recently developed {gamma}3 knockout mouse line that showed positive staining for {gamma}3 expression in wild-type mice and no staining for {gamma}3 expression in knockout mice when tested with this antibody in Western blot analysis (data not shown).

The striking difference in {gamma}3 expression between white and red skeletal muscle fiber types probably accounts for most of the variation in the {gamma}3/{gamma}1 expression ratio between skeletal muscle samples studied. For example, a first glance at our data may give the impression that the {gamma}3/{gamma}1 expression ratio in skeletal muscle is much higher in human than in mouse skeletal muscle. Although we cannot exclude the possibility of a true expression difference between these species, this observation is rather likely to reflect differences in fiber composition between the samples compared.

In this study, the mRNA expression in skeletal muscle appeared to be generally higher for {gamma}1 than for {gamma}2. Interestingly, in human heart, the {gamma}2 expression level was close to fivefold higher than the {gamma}1 expression level. Several mutations in the PRKAG2 gene (encoding AMPK{gamma}2) causing cardiac hypertrophy have been reported (4, 8). In rats and mice, however, we found that the {gamma}2/{gamma}1 mRNA expression ratios were considerably lower (1.3 and 0.6, respectively). If this reflects a general difference in {gamma}1 and {gamma}2 protein expression between rodents and humans, it may raise doubts for the use of rodents as model animals for functional analysis of {gamma}2 in heart.

Our investigation of AMPK{gamma} mRNA expression in HPMC, a possible model for functional studies of AMPK in adult skeletal muscle, showed that {gamma}2 remains the most abundant {gamma}-isoform in these cells throughout the differentiation program. Thus {gamma}2 expression reaches its full level very early during muscle cell differentiation, whereas {gamma}1 and {gamma}3 are upregulated at a later stage. This indicates a dramatic difference between HPMC and adult skeletal muscle regarding the {gamma}1/{gamma}2/{gamma}3 mRNA expression ratio and may raise caution for using HPMC as a model for studies of regulation and action of AMPK in adult muscle.

We found that the {gamma}3-subunit of AMPK, in mouse gastrocnemius and quadriceps, was associated solely with the {alpha}2- and {beta}2-isoforms. This finding may reflect the relative abundance of {alpha}- and {beta}-subunit isoforms in white skeletal muscle. Previous studies have shown that {alpha}2- and {beta}2-subunits have considerably higher levels of expression in white compared with red skeletal muscle (21) and that interaction can occur between {gamma}3- and all {alpha}- and {beta}-isoforms (7). In this study, however, we did not detect any {alpha}1 or {beta}1 protein, as assessed by immunoblot analysis after precipitation with our anti-{gamma}3 antibody, despite the strong corresponding signals obtained with the {alpha}2 and {beta}2 immunoblots. Thus the relatively small amount of {alpha}1 and {beta}1 expected to be present in these muscles does not seem to associate with {gamma}3. Therefore, our data indicate that {gamma}3 preferentially forms a complex with {alpha}2 and {beta}2.

Both exercise and the AMPK activator 5-aminoimidazole-4-carboxamide-1-{beta}-D-ribofuranoside (AICAR) are known to display a fiber type-specific effect on AMPK activity, with the most marked increase in skeletal muscle composed predominantly of type IIb fibers (12). Glucose uptake is also stimulated by AICAR in a fiber type-specific manner, with the largest effects noted in white skeletal muscle (5). It is therefore intriguing that our data reveal {alpha}2{beta}2{gamma}3 as the major AMPK heterotrimer in skeletal muscle composed predominantly of white fibers. This indicates that targeting {gamma}3-containing AMPK complexes might give an opportunity to promote glucose uptake specifically in skeletal muscle and thereby reverse some metabolic abnormalities in type 2 diabetes patients.


    ACKNOWLEDGMENTS
 
We thank Lubna Al-Khalili for help with the analysis of HPMC, Elisabeth Nilsson for help with bioinformatics, and Björn Löwenadler for valuable comments during the preparation of this manuscript.

Current address of G. Hjälm: Dept. of Molecular Biosciences, Swedish University of Agricultural Sciences, Uppsala Biomedical Center, SE-751 23 Uppsala, Sweden.

GRANTS

This study was supported by the Arexis Research and Development Fund, the Swedish Medical Research Council, and the Torsten and Ragnar Söderbergs Foundation. G. Hjälm and S. Marklund were funded by the AgriFunGen program, Swedish University of Agricultural Sciences.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. Marklund, Dept. of Animal Breeding and Genetics, Swedish Univ. of Agricultural Sciences, Uppsala Biomedical Center, Box 597, SE-751 24 Uppsala, Sweden (E-mail: Stefan.Marklund{at}bmc.uu.se).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* Margit Mahlapuu and Carina Johansson contributed equally to this study. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Al-Khalili L, Chibalin AV, Kannisto K, Zhang BB, Permert J, Holman GD, Ehrenborg E, Ding VDH, Zierath JR, and Krook A. Insulin action in cultured human skeletal muscle cells during differentiation: assessment of cell surface GLUT4 and GLUT1. Cell Mol Life Sci. 60: 991–998, 2003.[Web of Science][Medline]
  2. Ariano MA, Armstrong RB, and Edgerton VR. Hindlimb muscle fiber populations of five mammals. J Histochem Cytochem 21: 51–55, 1973.[Abstract]
  3. Armstrong RB and Phelps RO. Muscle fiber type composition of the rat hindlimb. Am J Anat 171: 259–272, 1984.[CrossRef][Web of Science][Medline]
  4. Blair E, Redwood C, Ashrafian H, Oliveira M, Broxholme J, Kerr B, Salmon A, Ostman-Smith I, and Watkins H. Mutations in the gamma(2) subunit of AMP-activated protein kinase cause familial hypertrophic cardiomyopathy: evidence for the central role of energy compromise in disease pathogenesis. Hum Mol Genet 10: 1215–1220, 2001.[Abstract/Free Full Text]
  5. Buhl ES, Jessen N, Schmitz O, Pedersen SB, Pedersen O, Holman GD, and Lund S. Chronic treatment with 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside increases insulin-stimulated glucose uptake and GLUT4 translocation in rat skeletal muscles in a fiber type-specific manner. Diabetes 50: 12–17, 2001.[Abstract/Free Full Text]
  6. Chen Z, Heierhorst J, Mann RJ, Mitchelhill KI, Michell BJ, Witters LA, Lynch GS, Kemp BE, and Stapleton D. Expression of the AMP-activated protein kinase {beta}1 and {beta}2 subunits in skeletal muscle. FEBS Lett 460: 343–348, 1999.[CrossRef][Web of Science][Medline]
  7. Cheung CF, Salt IP, Davies A, Hardie DG, and Carling D. Characterization of AMP-activated protein kinase gamma subunit isoforms and their role in AMP binding. Biochem J 346: 659–669, 2000.
  8. Daniel T and Carling D. Functional analysis of mutations in the gamma 2 subunit of AMP-activated protein kinase associated with cardiac hypertrophy and Wolff-Parkinson-White syndrome. J Biol Chem 277: 51017–51024, 2002.[Abstract/Free Full Text]
  9. Durante PE, Mustard KJ, Park SH, Winder WW, and Hardie DG. Effects of endurance training on activity and expression of AMP-activated protein kinase isoforms in rat muscles. Am J Physiol Endocrinol Metab 283: E178–E186, 2002.[Abstract/Free Full Text]
  10. Hardie DG and Carling D. The AMP-activated protein kinase: fuel gauge of the mammalian cell? Eur J Biochem 246: 259–273, 1997.[Web of Science][Medline]
  11. Hundal HS, Marette A, Ramlal T, Liu Z, Klip A. Expression of {beta} subunit isoforms of the Na+ K+-ATPase is muscle type-specific. FEBS Lett 328: 253–258, 1993.[CrossRef][Web of Science][Medline]
  12. Jessen N, Pold R, Buhl ES, Jensen LS, Schmitz O, and Lund S. Effects of AICAR and exercise on insulin-stimulated glucose uptake, signaling, and GLUT4 content in rat muscles. J Appl Physiol 94: 1373–1379, 2003.[Abstract/Free Full Text]
  13. Lang T, Yu L, Tu Q, Jiang J, Chen Z, Xin Y, Liu G, and Zhao S. Molecular cloning, genomic organization, and mapping of PRKAG2, a heart abundant gamma2 subunit of 5'-AMP-activated protein kinase, to human chromosome 7q36. Genomics 70: 258–263, 2000.[CrossRef][Web of Science][Medline]
  14. Lebret B, Le Roy P, Monin G, Lefaucheur L, Caritez JC, Talmant A, Elsen JM, and Sellier P. Influence of the three RN genotypes on chemical composition, enzyme activities, and myofiber characteristics of porcine skeletal muscle. J Anim Sci 77: 1482–1489, 1999.[Abstract/Free Full Text]
  15. Milan D, Jeon JT, Looft C, Amarger V, Robic A, Thelander M, Rogel-Gaillard C, Paul S, Iannuccelli N, Rask L, Ronne H, Lundström K, Reinsch N, Gellin J, Kalm E, Roy PL, Chardon P, and Andersson L. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. Science 288: 1248–1251, 2000.[Abstract/Free Full Text]
  16. Salt I, Celler JW, Hawley SA, Prescott A, Woods A, Carling D, and Hardie DG. AMP-activated protein kinase: greater AMP dependence, and preferential nuclear localization, of complexes containing the {alpha}2 isoform. Biochem J 334: 177–187, 1998.
  17. Seale P and Rudnicki MA. A new look at the origin, function, and "stem-cell" status of muscle satellite cells. Dev Biol 218: 115–124, 2000.[CrossRef][Web of Science][Medline]
  18. Stapleton D, Mitchelhill KI, Gao G, Widmer J, Michell BJ, Teh T, House CM, Fernandez CS, Cox T, Witters LA, and Kemp BE. Mammalian AMP-activated protein kinase subfamily. J Biol Chem 271: 611–614, 1996.[Abstract/Free Full Text]
  19. Thornton C, Snowden MA, and Carling D. Identification of a novel AMP-activated protein kinase beta subunit isoform that is highly expressed in skeletal muscle. J Biol Chem 273: 12443–12450, 1998.[Abstract/Free Full Text]
  20. User Bulletin No. 2. ABI PRISM 7700 Sequence Detection System. Warrington, UK: Applied Biosystems, 1997.
  21. Winder WW. Energy-sensing and signaling by AMP-activated protein kinase in skeletal muscle. J Appl Physiol 91: 1017–1028, 2001.[Abstract/Free Full Text]
  22. Winder WW, Hardie DG, Mustard KJ, Greenwood LJ, Paxton BE, Park SH, Rubink DS, and Taylor EB. Long-term regulation of AMP-activated protein kinase and acetyl-CoA carboxylase in skeletal muscle. Biochem Soc Trans 31: 182–185, 2003.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. S. Deshmukh, S. Glund, R. Z. Tom, and J. R. Zierath
Role of the AMPK{gamma}3 isoform in hypoxia-stimulated glucose transport in glycolytic skeletal muscle
Am J Physiol Endocrinol Metab, December 1, 2009; 297(6): E1388 - E1394.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Mortensen, P. Poulsen, L. Wegner, K. L. Stender-Petersen, R. Ribel-Madsen, M. Friedrichsen, J. B. Birk, A. Vaag, and J. F. P. Wojtaszewski
Genetic and metabolic effects on skeletal muscle AMPK in young and older twins
Am J Physiol Endocrinol Metab, October 1, 2009; 297(4): E956 - E964.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. T. Treebak, J. B. Birk, B. F. Hansen, G. S. Olsen, and J. F. P. Wojtaszewski
A-769662 activates AMPK {beta}1-containing complexes but induces glucose uptake through a PI3-kinase-dependent pathway in mouse skeletal muscle
Am J Physiol Cell Physiol, October 1, 2009; 297(4): C1041 - C1052.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
R. S. Lee-Young, B. J. Canny, D. E. Myers, and G. K. McConell
AMPK activation is fiber type specific in human skeletal muscle: effects of exercise and short-term exercise training
J Appl Physiol, July 1, 2009; 107(1): 283 - 289.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. R. Steinberg and B. E. Kemp
AMPK in Health and Disease
Physiol Rev, July 1, 2009; 89(3): 1025 - 1078.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
S. K. Park, A. M. Gunawan, T. L. Scheffler, A. L. Grant, and D. E. Gerrard
Myosin heavy chain isoform content and energy metabolism can be uncoupled in pig skeletal muscle
J Anim Sci, February 1, 2009; 87(2): 522 - 531.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Miura, Y. Kai, Y. Kamei, C. R. Bruce, N. Kubota, M. A. Febbraio, T. Kadowaki, and O. Ezaki
{alpha}2-AMPK activity is not essential for an increase in fatty acid oxidation during low-intensity exercise
Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E47 - E55.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Vieira, E. C. Nilsson, A. Nerstedt, M. Ormestad, Y. C. Long, P. M. Garcia-Roves, J. R. Zierath, and M. Mahlapuu
Relationship between AMPK and the transcriptional balance of clock-related genes in skeletal muscle
Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1032 - E1037.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
V. Sibut, E. Le Bihan-Duval, S. Tesseraud, E. Godet, T. Bordeau, E. Cailleau-Audouin, P. Chartrin, M. J. Duclos, and C. Berri
Adenosine monophosphate-activated protein kinase involved in variations of muscle glycogen and breast meat quality between lean and fat chickens
J Anim Sci, November 1, 2008; 86(11): 2888 - 2896.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Y. C. Long and J. R. Zierath
Influence of AMP-activated protein kinase and calcineurin on metabolic networks in skeletal muscle
Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E545 - E552.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. T. Putman, K. J. B. Martins, M. E. Gallo, G. D. Lopaschuk, J. A. Pearcey, I. M. MacLean, R. J. Saranchuk, and D. Pette
{alpha}-Catalytic subunits of 5'AMP-activated protein kinase display fiber-specific expression and are upregulated by chronic low-frequency stimulation in rat muscle
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1325 - R1334.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. B. Jorgensen, J. T. Treebak, B. Viollet, P. Schjerling, S. Vaulont, J. F. P. Wojtaszewski, and E. A. Richter
Role of AMPK{alpha}2 in basal, training-, and AICAR-induced GLUT4, hexokinase II, and mitochondrial protein expression in mouse muscle
Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E331 - E339.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
N. Fujii, N. Jessen, and L. J. Goodyear
AMP-activated protein kinase and the regulation of glucose transport
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E867 - E877.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Yu, M. F. Hirshman, N. Fujii, J. M. Pomerleau, L. E. Peter, and L. J. Goodyear
Muscle-specific overexpression of wild type and R225Q mutant AMP-activated protein kinase {gamma}3-subunit differentially regulates glycogen accumulation
Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E557 - E565.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. T. Treebak, S. Glund, A. Deshmukh, D. K. Klein, Y. C. Long, T. E. Jensen, S. B. Jorgensen, B. Viollet, L. Andersson, D. Neumann, et al.
AMPK-Mediated AS160 Phosphorylation in Skeletal Muscle Is Dependent on AMPK Catalytic and Regulatory Subunits.
Diabetes, July 1, 2006; 55(7): 2051 - 2058.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. R. B. Dyck and G. D. Lopaschuk
AMPK alterations in cardiac physiology and pathology: enemy or ally?
J. Physiol., July 1, 2006; 574(1): 95 - 112.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. B. Jorgensen, E. A. Richter, and J. F. P. Wojtaszewski
Role of AMPK in skeletal muscle metabolic regulation and adaptation in relation to exercise
J. Physiol., July 1, 2006; 574(1): 17 - 31.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Gregor, A. Zeold, S. Oehler, K. A. Marobela, P. Fuchs, G. Weigel, D. G. Hardie, and G. Wiche
Plectin scaffolds recruit energy-controlling AMP-activated protein kinase (AMPK) in differentiated myofibres
J. Cell Sci., May 1, 2006; 119(9): 1864 - 1875.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. K. Davies, D. J. Wells, K. Liu, H. R. Whitrow, T. D. Daniel, R. Grignani, C. A. Lygate, J. E. Schneider, G. Noel, H. Watkins, et al.
Characterization of the role of {gamma}2 R531G mutation in AMP-activated protein kinase in cardiac hypertrophy and Wolff-Parkinson-White syndrome
Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H1942 - H1951.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
D. G. Hardie and K. Sakamoto
AMPK: A Key Sensor of Fuel and Energy Status in Skeletal Muscle
Physiology, February 1, 2006; 21(1): 48 - 60.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
B. R. Barnes, Y. C. Long, T. L. Steiler, Y. Leng, D. Galuska, J. F.P. Wojtaszewski, L. Andersson, and J. R. Zierath
Changes in Exercise-Induced Gene Expression in 5'-AMP-Activated Protein Kinase {gamma}3-Null and {gamma}3 R225Q Transgenic Mice
Diabetes, December 1, 2005; 54(12): 3484 - 3489.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. W. Ryder, Y. C. Long, E. Nilsson, M. Mahlapuu, and J. R. Zierath
Effects of calcineurin activation on insulin-, AICAR- and contraction-induced glucose transport in skeletal muscle
J. Physiol., September 1, 2005; 567(2): 379 - 386.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
N. Jessen and L. J. Goodyear
Contraction signaling to glucose transport in skeletal muscle
J Appl Physiol, July 1, 2005; 99(1): 330 - 337.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. C. Wright, P. C. Geiger, J. O. Holloszy, and D.-H. Han
Contraction- and hypoxia-stimulated glucose transport is mediated by a Ca2+-dependent mechanism in slow-twitch rat soleus muscle
Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1062 - E1066.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. F. P Wojtaszewski, J. B Birk, C. Frosig, M. Holten, H. Pilegaard, and F. Dela
5'AMP activated protein kinase expression in human skeletal muscle: effects of strength training and type 2 diabetes
J. Physiol., April 15, 2005; 564(2): 563 - 573.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Fraser, P. Mount, R. Hill, V. Levidiotis, F. Katsis, D. Stapleton, B. E. Kemp, and D. A. Power
Regulation of the energy sensor AMP-activated protein kinase in the kidney by dietary salt intake and osmolality
Am J Physiol Renal Physiol, March 1, 2005; 288(3): F578 - F586.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. R. Barnes, S. Marklund, T. L. Steiler, M. Walter, G. Hjalm,, V. Amarger, M. Mahlapuu, Y. Leng, C. Johansson, D. Galuska, et al.
The 5'-AMP-activated Protein Kinase {gamma}3 Isoform Has a Key Role in Carbohydrate and Lipid Metabolism in Glycolytic Skeletal Muscle
J. Biol. Chem., September 10, 2004; 279(37): 38441 - 38447.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. A. Iglesias, S. M. Furler, G. J. Cooney, E. W. Kraegen, and J.-M. Ye
AMP-Activated Protein Kinase Activation by AICAR Increases Both Muscle Fatty Acid and Glucose Uptake in White Muscle of Insulin-Resistant Rats In Vivo
Diabetes, July 1, 2004; 53(7): 1649 - 1654.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/2/E194    most recent
00147.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (55)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mahlapuu, M.
Right arrow Articles by Marklund, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mahlapuu, M.
Right arrow Articles by Marklund, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.