|
|
||||||||
Center for Integrative Metabolic and Endocrine Research, Departments of Pathology and Psychiatry, Wayne State University School of Medicine, Detroit, Michigan 48201
Submitted 1 May 2003 ; accepted in final form 25 August 2003
| ABSTRACT |
|---|
|
|
|---|
3-Adrenergic receptors (AR) are nearly exclusively expressed in brown and white adipose tissues, and chronic activation of these receptors by selective agonists has profound anti-diabetes and anti-obesity effects. This study examined metabolic responses to acute and chronic
3-AR activation in wild-type C57Bl/6 mice and congenic mice lacking functional uncoupling protein (UCP)1, the molecular effector of brown adipose tissue (BAT) thermogenesis. Acute activation of
3-AR doubled metabolic rate in wild-type mice and sharply elevated body temperature and BAT blood flow, as determined by laser Doppler flowmetry. In contrast,
3-AR activation did not increase BAT blood flow in mice lacking UCP1 (UCP1 KO). Nonetheless,
3-AR activation significantly increased metabolic rate and body temperature in UCP1 KO mice, demonstrating the presence of UCP1-independent thermogenesis. Daily treatment with the
3-AR agonist CL-316243 (CL) for 6 days increased basal and CL-induced thermogenesis compared with naive mice. This expansion of basal and CL-induced metabolic rate did not require UCP1 expression. Chronic CL treatment of UCP1 KO mice increased basal and CL-stimulated metabolic rate of epididymal white adipose tissue (EWAT) fourfold but did not alter BAT thermogenesis. After chronic CL treatment, CL-stimulated thermogenesis of EWAT equaled that of interscapular BAT per tissue mass. The elevation of EWAT metabolism was accompanied by mitochondrial biogenesis and the induction of genes involved in lipid oxidation. These observations indicate that chronic
3-AR activation induces metabolic adaptation in WAT that contributes to
3-AR-mediated thermogenesis. This adaptation involves lipid oxidation in situ and does not require UCP1 expression. metabolic plasticity; obesity; diabetes; tissue remodeling
3-ADRENERGIC RECEPTOR (AR) agonists have profound therapeutic effects in rodent models of obesity and diabetes (2, 9, 14).
3-AR in rodents are expressed almost exclusively in brown (BAT) and white adipose tissue (WAT), and the therapeutic effects of
3-AR agonists have been attributed to dramatic stimulation of adipose tissue triglyceride hydrolysis coupled to elevated fatty acid oxidation in BAT. However, the direct and indirect contribution of adipose tissue types to the therapeutic effects of these compounds is largely unknown.
3-AR agonists elicit strong thermogenesis in vivo, and this effect has been largely attributed to activation of BAT, a thermogenic organ. The mechanism of brown fat thermogenesis involves fatty acid oxidation and uncoupling of oxidative phosphorylation through uncoupling protein (UCP)1. Thus
3-AR stimulation does not produce thermogenesis in brown adipocytes of mice lacking UCP1 (3, 7, 21, 22). Furthermore,
3-AR-mediated whole animal thermogenesis is sharply reduced in UCP1 knockout (KO) mice (8).
Although UCP1-dependent BAT thermogenesis clearly plays a dominant role in the overall metabolic response to acute effects of
3-AR agonists, various lines of evidence indicate that WAT plays a role as well. For example, restoring
3-AR expression in BAT of
3-AR KO mice does not fully restore thermogenesis to acute
3-AR agonist treatment, whereas restoration in both brown and white fat does (12, 17). Furthermore, mice lacking UCP1, and hence brown adipocyte thermogenesis, still exhibit 2040% of wild-type thermogenesis in response to
3-AR stimulation (8). These observations suggest that WAT directly or indirectly participates in the overall thermogenic response to acute
3-AR stimulation and that a component of thermogenesis is UCP1 independent.
The above analysis concerns the effects of acute
3-AR activation. The anti-obesity and anti-diabetes effects of
3-AR agonists, however, require chronic drug exposure. Chronic exposure to
3-AR agonists elevates UCP1 expression in BAT, and it is thought that BAT mediates the augmented thermogenic capacity seen after chronic treatment (6, 14). However, because BAT cannot account fully for
3-AR-mediated thermogenesis to acute agonist stimulation, it is possible that other tissues contribute to the augmented thermogenic capacity seen after chronic exposure to
3-AR agonists. In this regard, recent work by Himms-Hagen et al. (15) is of interest. These investigators demonstrated that chronic exposure to
3-AR agonists induces mitochondrial biogenesis in WAT, suggesting that this tissue might be capable of oxidizing lipid in situ and could contribute to the thermogenic effects of
3-AR activation (15).
The aim of this study was to examine the acute and chronic effects of the
3-AR stimulation on thermogenesis and WAT and BAT function. The results indicate that
3-AR activation does not elevate BAT thermogenesis in UCP1 KO mice, in vivo or in vitro, but nonetheless significantly elevates body temperature and oxygen consumption. Chronic treatment of mice with the
3-AR agonist CL-316243 (CL) increases CL-induced thermogenesis, but that augmentation occurs independently of UCP1. Furthermore, chronic CL treatment elevates oxygen consumption fourfold in WAT of UCP1 KO mice but has no effect on BAT respiration. The elevation of WAT thermogenesis correlates with induction of mitochondrial biogenesis and expression of genes involved in fatty acid oxidation. These results indicate functional plasticity in WAT that has important implications for development of obesity and diabetes therapeutics.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Experiment 1. WT and UCP1 KO mice were anesthetized with pentobarbital sodium (50 mg/kg) and immediately placed on a warm surface to stabilize body temperature. Interscapular BAT (IBAT) was carefully exposed through a 1-cm incision, a 21-gauge laser Doppler probe (Transonic, Ithaca, NY) was placed into the tissue, and a temperature probe (Physitemp, Clifton, NJ) was placed into the peritoneal cavity. After stabilization of temperature and tissue blood perfusion, mice were injected intraperitoneally with norepinephrine (100 nmol) or BRL-37344 (50 nmol; RBI, Natick, MA). Temperature and blood flow data were recorded at 2-min intervals. Whole body oxygen consumption (
O2) was determined using an open-circuit system (Accuscan Oxyplot, Columbus, OH). After 10 min of stable baseline data had been collected, animals were injected with adrenergic agonists, as indicated in Figs. 1, 2, 3, 4, and
O2 was measured over the following 2030 min.
|
|
|
|
Experiment 2. The second experiment examined the effects of acute and chronic exposure to the
3-AR agonist CL-316243 (CL; 30 nmol; Wyeth, Princeton, NJ) on whole body metabolic rate, WAT and BAT respiration, WAT mitochondrial biogenesis, and WAT gene expression. Age-matched WT and UCP1 KO mice were injected daily for 6 days with saline or CL. Twenty-four hours after the last injection, animals were anesthetized with Avertin, and
O2 was determined as described in experiment 1.
WAT and BAT respiration in vitro. UCP1 KO mice were treated with saline or CL for 6 days as described. Mice were anesthetized with Avertin and acutely challenged with saline or CL (20 nmol). Fifteen to twenty minutes after injection, epididymal WAT (EWAT) and IBAT were removed and immediately placed in HEPES-buffered Krebs-Ringer solution containing 1% bovine serum albumin. The tissue was minced into 5to 10-mg fragments and placed in a closed chamber (700 µl volume) for measurement of
O2 with a Clark-style electrode (Qubit Systems, Kingston, ON, Canada) at 35°C under constant stirring. Respiration rates were determined by linear regression of the O2 concentration traces (Vernier Software, Beaverton, OR).
Labeling and confocal imaging of WAT mitochondria. WAT mitochondria were labeled using a modification of the method described by DeMartinis (1). Briefly, EWAT was dissected and minced into 10- to 20-mg fragments and placed into Delbecco's modified Eagle's medium containing the fluorescent mitochondrial dye MitoTracker Red (100 nM; Molecular Probes, Eugene, OR). Tissue minces were incubated for 30 min, washed twice in media, and then fixed in phosphate-buffered saline containing 4% paraformaldehyde. For imaging, tissue minces were placed between coverslips in a Leiden chamber and optically sectioned using confocal microscopy (Olympus Fluoview).
Quantitative RT/PCR analysis. Total RNA from EWAT was isolated, and cDNA was synthesized, as previously described (11). Synthesized cDNA was subjected to quantitative (q)RT-PCR (iCycler, Bio-Rad) in duplicate, with SYBR-green as the reporter fluorophore. Cycle threshold (Ct) values were calculated using the Bio-Rad software, and data were normalized to values obtained for peptidylprolyl isomerase 1A (PPIA). The following primers were used: PPIA (+) GTGGTCTTTGGGAAGGTGAA, () TTACAGGACATTGCGAGCAG; pyruvate dehydrogenase kinase 4 (PDK4) (+) GGCCATCCATGTAGGAGAGA, () GAGGGAGACCCACAGAAGAA; long-chain acyl-CoA dehydrogenase (Acad1) (+) CTCATGCAAGAGCTTCCACA, () CCACAAAAGCTCTGGTGACA; cytochrome c oxidase subunit 8b (Cox8b) (+) TGCGAAGTTCACAGTGGTTC, () CTCAGGGATGTGCAACTTCA.
Statistical analysis. Data are presented as means ± SE. Data were evaluated by ANOVA. Post hoc analysis was performed with the Neuman-Keuls test for multiple comparisons among means.
| RESULTS |
|---|
|
|
|---|
NE activates several AR subtypes in numerous tissues. In contrast,
3-AR are expressed nearly exclusively in BAT and WAT, and expression in these tissues is necessary and sufficient to account for the full thermogenic effects of
3-AR agonists (1, 9, 12). We therefore examined the effects of the selective
3-AR agonist BRL-37344 (BRL; 50 nmol) on thermogenesis, body temperature, and BAT blood flow in WT and UCP1 KO mice.
Acute injection of BRL sharply elevated metabolic rate (Fig. 2A) and body temperature (Fig. 2B) in WT mice. The elevation of metabolic rate was greatly blunted, but not eliminated, in UCP1 KO mice. Interestingly, the elevation in body temperature was largely intact in UCP1 KO mice, suggesting that BRL might affect body temperature independently of metabolic rate. BAT blood flow is sharply elevated by increased local tissue respiration and is a sensitive physiological measure of BAT metabolism in situ (4, 24). Injection of BRL produced an immediate and sustained elevation of BAT blood flow in WT mice, as determined by laser Doppler flowmetry (Fig. 2C). In contrast, BRL had no effect on tissue perfusion in UCP1 KO mice, indicating that the tissue is thermogenically unresponsive to
3-AR activation.
Experiment 2. The therapeutic effects of
3-AR agonists on diabetes and obesity require chronic exposure to the compounds. We therefore compared the acute and chronic effects of
3-AR activation on metabolic rate and WAT function, gene expression, and histology. WT and UCP1 KO mice were injected daily for 6 days with saline or the highly selective
3-AR agonist CL (30 nmol). On the 7th day, metabolic rate was determined under basal conditions and after stimulation by a supramaximal dose of CL (20 nmol; Fig. 3). As with NE and BRL, CL challenge strongly elevated metabolic rate in naive (i.e., saline-treated) WT mice, and this effect was significantly reduced, but not eliminated, in UCP1 KO mice. A 6-day course of CL treatment elevated both basal and stimulated
O2. Importantly, ANOVA indicated significant effects of drug treatment and genotype, but no interaction among these variables. In other words, the enhancement of thermogenesis by chronic CL treatment was independent of UCP1.
Figure 4 illustrates the time course of thermogenesis induced by CL in UCP1 KO mice previously treated with saline or CL. CL appeared to increase metabolic rate in two temporally distinct phases. The rapid phase occurred during the first 6 min after injection, with the sustained elevation occurring thereafter. Although both phases appeared to be augmented by chronic CL treatment, the first phase was affected more dramatically.
Conditions that produce sustained activation of WAT lipolysis, such as cold exposure and
3-AR agonist treatment, induce mitochondrial biogenesis in WAT and the appearance of multilocular cells, some of which express UCP1 (15). These observations suggest that chronic
3-AR activation induces metabolic adaptation in WAT, which might contribute significantly to the thermogenic response. Therefore, the above experiment was repeated, and the thermogenic responses of EWAT and IBAT were determined in vitro under basal conditions and after systemic challenge by CL.
As shown in Fig. 5, metabolic rate was low in EWAT of naive mice, and acute CL treatment produced a slight, but nonsignificant, increase in tissue respiration. Chronic treatment with CL dramatically increased basal metabolic rate in EWAT (P < 0.001). CL challenge significantly elevated thermogenesis in EWAT of chronically-treated mice (P < 0.01), and this elevation was fourfold greater (P < 0.001) than that observed in naive mice.
|
In control UCP1 KO animals, IBAT tissue thermogenesis was 78 times greater than that of EWAT (Fig. 5) and
30% lower than that of WT mice (not shown). IBAT tissue thermogenesis was not significantly affected by either acute or chronic treatment with CL. Importantly, EWAT thermogenesis equaled that of IBAT (relative to tissue weight) after chronic CL treatment and CL challenge.
The elevated metabolic capacity of EWAT was reflected in the histological appearance and gene expression pattern of the tissue. As shown in Fig. 6, 6 days of CL treatment resulted in the fragmentation of the single large lipid droplet characteristic of white adipocytes into multiple lipid droplets. These lipid droplets were completely surrounded by mitochondria in numerous cells, as demonstrated by confocal imaging of MitoTracker staining. The magnitude of the MitoTracker staining was highly similar in WT and UCP1 KO mice.
|
WAT mRNA from naive mice and mice treated chronically with CL was subjected to qRT-PCR analysis, with focus on genes that are involved in substrate selection and fatty acid oxidation. Chronic CL treatment induced PDK4 expression similarly in WT and UCP1 KO mice (Fig. 7A). Similar results were obtained for expression of LCAD (Fig. 7B), a key enzyme in mitochondrial
-oxidation. Finally, chronic CL treatment strongly (>20-fold) induced expression of Cox8b (Fig. 7C).
|
| DISCUSSION |
|---|
|
|
|---|
3-AR agonists requires activation of both BAT and WAT (5, 12). BAT clearly contributes importantly to the acute effects of
3-AR stimulation. BAT thermogenesis induced by
3-AR activation appears to be entirely dependent on UCP1, as indicated by the absence of elevated blood flow in the tissue in UCP1 KO mice. These observations confirm results of in vitro studies and extend them to the functioning of the intact tissue in situ (3, 7, 21, 22).
The dependence of BAT thermogenesis on UCP1 indicates that UCP1 KO mice represent a model with which to explore mechanisms of thermogenesis that are largely independent of BAT. In naive mice, UCP1-independent thermogenesis constitutes 2040% of the total thermogenic response to various
-AR agonists. As mentioned above, the therapeutic effects of
3-AR activation require chronic treatment. The present results indicate that chronic CL treatment significantly elevates both basal and stimulated thermogenesis. Importantly, the present data indicate that this effect does not require UCP1.
In addition to elevating the maximal level of thermogenesis, chronic CL treatment also accelerated the rate at which that maximum was achieved. The slow elevation of thermogenesis in naive UCP1 KO mice contrasts with the rapid induction of
O2 seen in WT mice in which fatty acids are rapidly oxidized by BAT in situ. The relatively slow activation of thermogenesis in naive KO mice suggests that UCP1-independent thermogenesis might involve oxidation of mobilized lipid by nonadipose tissues like liver and muscle. The time course of CL-induced thermogenesis in UCP1 KO mice chronically treated with CL resembled that of WT mice and suggests that this augmentation of thermogenesis might involve the direct effects of CL on adipocytes.
In vitro analysis of EWAT from UCP1 KO mice demonstrated that chronic CL treatment dramatically increased basal and CL-stimulated thermogenesis. In contrast, neither acute nor chronic CL treatment affected thermogenesis in IBAT from UCP1 KO mice. Importantly, the mass-specific metabolic rate of EWAT equaled that of BAT after chronic CL with acute CL challenge. Although the quantitative significance of the elevated WAT metabolism to total in vivo thermogenesis is difficult to extrapolate from in vitro data, it is likely that WAT contributes more than BAT in UCP1 KO mice given the much greater mass of WAT in these animals.
The present study addressed the molecular profile and metabolic activity of adipose tissue after chronic treatment with CL. The results demonstrate that chronic activation of WAT
3-AR induces genes involved in substrate selection, fatty acid oxidation, and mitochondrial biogenesis. PDK4 phosphorylates the pyruvate dehydrogenase complex, thereby suppressing glucose utilization in favor of lipid oxidation (23); Acad1 (LCAD) is a key step in mitochondrial
-oxidation and has been shown to be essential for nonshivering thermogenesis (13); and Cox8b is a subunit of cytochrome c oxidase that is induced during mitochondrial biogenesis. The strong upregulation of these genes, along with the pronounced induction of mitochondrial biogenesis, indicates that CL induces a novel plasticity in WAT that shifts the metabolic profile from lipid storage to lipid oxidation in situ.
Kozak's laboratory [Hofmann et al. (16) and Liu et al. (20)] has provided compelling evidence for the presence of UCP1-independent thermoregulatory thermogenesis. For example, Liu et al. reported that mildly cold-stressed UCP1 KO mice exhibited lower levels of plasma free fatty acids, higher levels of plasma ketones, and a lower cumulative respiratory quotient, all indicative of greater lipid oxidation. Similar effects occur during chronic treatment with
3-AR agonsts (2, 14, 18, 24). Furthermore, mild cold stress produces morphological changes in inguinal fat of UCP1 KO mice, similar to those produced by CL treatment in epididymal fat. These observations raise the possibility that CL and mild cold stress engage similar thermogenic mechanisms in UCP1 KO mice and that one component of that thermogenesis is likely to involve activation of white fat thermogenesis.
The quantitative significance of WAT to overall thermogenesis is presently unclear and is likely to depend on the nature and magnitude of the stimulus, as well as the thermogenic mechanisms available to the animal. For example, chronic CL treatment targets adipose tissue and produces more extensive WAT remodeling than does mild cold stress. In contrast, cold stress might be expected to elevate sympathetic activity and thereby activate thermogenesis in liver and muscle, which are important extra-adipose sites of lipid oxidation/thermogenesis. Finally, it is important to recognize that, although chronic CL treatment increases the thermogenic capacity of WT and UCP1 KO mice similarly, the mechanisms involved could differ, with WT mice relying mainly on BAT and UCP1 KO mice engaging WAT, muscle, and liver. Clearly, an important goal of future work will be to identify the tissues that contribute to UCP1-independent thermogenesis.
3-AR agonists are highly effective therapeutics in rodent models of obesity and diabetes (9, 10, 19). Nonetheless, the mechanisms and sites of
3-AR action remain poorly understood. The dominant role of UCP1-dependent thermogenesis in the acute effects of
3-AR agonists has cast doubt as to whether adipokinetic drugs will be useful as human therapeutics, given the paucity of BAT in adult humans. The present results, however, indicate that WAT is capable of pronounced thermogenic activity in response to sustained lipolytic stimulation. Clearly, the abundance of the tissue target is not limiting in human obesity and type 2 diabetes. Understanding the mechanisms controlling WAT metabolic plasticity could lead to the identification of novel points of therapeutic intervention for treatment of obesity and diabetes in humans.
| DISCLOSURES |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
4-adrenergic receptor is a novel state of the
1-adrenergic receptor. Am J Physiol Endocrinol Metab 280: E199E202, 2001.This article has been cited by other articles:
![]() |
V. Kus, T. Prazak, P. Brauner, M. Hensler, O. Kuda, P. Flachs, P. Janovska, D. Medrikova, M. Rossmeisl, Z. Jilkova, et al. Induction of muscle thermogenesis by high-fat diet in mice: association with obesity-resistance Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E356 - E367. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Myers, K. Hanson, M. Mlynarczyk, K. M. Kaushal, and C. A. Ducsay Long-term hypoxia modulates expression of key genes regulating adipose function in the late-gestation ovine fetus Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2008; 294(4): R1312 - R1318. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Jakus, A. Sandor, T. Janaky, and V. Farkas Cooperation between BAT and WAT of rats in thermogenesis in response to cold, and the mechanism of glycogen accumulation in BAT during reacclimation J. Lipid Res., February 1, 2008; 49(2): 332 - 339. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Bogacka, T. W. Gettys, L. de Jonge, T. Nguyen, J. M. Smith, H. Xie, F. Greenway, and S. R. Smith The Effect of {beta}-Adrenergic and Peroxisome Proliferator-Activated Receptor-{gamma} Stimulation on Target Genes Related to Lipid Metabolism in Human Subcutaneous Adipose Tissue Diabetes Care, May 1, 2007; 30(5): 1179 - 1186. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rink, S. Roy, S. Khanna, T. Rink, D. Bagchi, and C. K. Sen Transcriptome of the subcutaneous adipose tissue in response to oral supplementation of type 2 Leprdb obese diabetic mice with niacin-bound chromium Physiol Genomics, November 21, 2006; 27(3): 370 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Golozoubova, B. Cannon, and J. Nedergaard UCP1 is essential for adaptive adrenergic nonshivering thermogenesis Am J Physiol Endocrinol Metab, August 1, 2006; 291(2): E350 - E357. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Inokuma, Y. Okamatsu-Ogura, A. Omachi, Y. Matsushita, K. Kimura, H. Yamashita, and M. Saito Indispensable role of mitochondrial UCP1 for antiobesity effect of beta3-adrenergic stimulation Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E1014 - E1021. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Granneman, P. Li, Z. Zhu, and Y. Lu Metabolic and cellular plasticity in white adipose tissue I: effects of {beta}3-adrenergic receptor activation Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E608 - E616. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Li, Z. Zhu, Y. Lu, and J. G. Granneman Metabolic and cellular plasticity in white adipose tissue II: role of peroxisome proliferator-activated receptor-{alpha} Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E617 - E626. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Granneman, P. Li, Y. Lu, and J. Tilak Seeing the trees in the forest: selective electroporation of adipocytes within adipose tissue Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E574 - E582. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hatakeyama, Y. Sakata, S. Takakura, T. Manda, and S. Mutoh Acute and chronic effects of FR-149175, a {beta}3-adrenergic receptor agonist, on energy expenditure in Zucker fatty rats Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2004; 287(2): R336 - R341. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. CANNON and J. NEDERGAARD Brown Adipose Tissue: Function and Physiological Significance Physiol Rev, January 1, 2004; 84(1): 277 - 359. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |