| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1Department of Endocrinology and Metabolism C, Aarhus Amtssygehus, Aarhus University Hospital and Faculty of Health Sciences, Aarhus University, DK-8000 Aarhus C; and 2Research Department of Human Nutrition, Center for Advanced Food Research, The Royal Veterinary and Agricultural University, DK-1958 Frederiksberg C, Denmark
Submitted 14 March 2003 ; accepted in final form 6 May 2003
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
). The study was divided into three substudies as
follows: 1) plasma adiponectin and mRNA levels in adipose tissue
biopsies from obese subjects [mean body mass index (BMI): 39.7
kg/m2, n = 6] before and after weight loss; 2)
plasma adiponectin in obese men (mean BMI: 38.7 kg/m2, n =
19) compared with lean men (mean BMI: 23.4 kg/m2, n = 10)
before and after weight loss; and 3) in vitro direct effects of IL-6,
IL-8, and TNF- on adiponectin mRNA levels in adipose tissue cultures.
The results were that 1) weight loss resulted in a 51% (P
< 0.05) increase in plasma adiponectin and a 45% (P < 0.05)
increase in adipose tissue mRNA levels; 2) plasma adiponectin was 53%
(P < 0.01) higher in lean compared with obese men, and plasma
adiponectin was inversely correlated with adiposity, insulin sensitivity, and
IL-6; and 3) TNF- (P < 0.01) and IL-6 plus its
soluble receptor (P < 0.05) decreased adiponectin mRNA levels in
vitro. The inverse relationship between plasma adiponectin and cytokines in
vivo and the cytokine-induced reduction in adiponectin mRNA in vitro suggests
that endogenous cytokines may inhibit adiponectin. This could be of importance
for the association between cytokines (e.g., IL-6) and insulin resistance and
atherosclerosis.
interleukin-6; tumor necrosis factor-; interleukin-8; human adipose tissue
(TNF-; see Ref.
20), interleukin-6 (IL-6; see
Ref. 30), and interleukin-8
(IL-8; see Ref. 7), all of
which have been reported to be affected by weight loss in obese subjects
(2,
5,
11) and therefore could be of
importance as part of the link between obesity and health complications (e.g.,
insulin resistance and premature atherosclerosis).
A newer candidate for the link between obesity and the development of
insulin resistance and cardiovascular disease may be adiponectin, the gene
product of the adipose tissue's most abundant gene transcript
(26). In humans, high levels
of adiponectin (range 2-20 mg/l) are found in the circulation
(1). As opposed to other
adipose-derived proteins, plasma levels of adiponectin have been found to be
decreased in a number of deranged metabolic states, including obesity
(1), dyslipidemia
(28), type 2 diabetes, and
coronary artery disease (21).
Previous studies have demonstrated that the reduced circulating adiponectin
levels could be reversed partially after induction of weight loss in obese and
in insulin-resistant subjects
(21,
40) as well as after treatment
with insulin-sensitizing drugs such as thiazolidinediones
(8,
27). The physiological role of
adiponectin in relation to diseases associated with the metabolic syndrome
remains to be determined; however, adiponectin has been demonstrated to
improve insulin sensitivity in animal models of insulin resistance in vivo
(3,
39). Besides the involvement
in insulin sensitivity, adiponectin has been reported to exhibit
antiatherosclerotic activity
(31,
32) through an inhibition of
TNF--induced activation of the nuclear transcription factor-
B
(NF-B; see Ref. 33). In
addition, TNF- has been demonstrated to decrease adiponectin gene
expression in human preadipocytes
(22) and 3T3-L1 adipocytes
(13), suggesting a
relationship between TNF- and adiponectin.
To obtain additional information on the regulation of adiponectin, we
investigated the effect of weight loss on adiponectin production and insulin
sensitivity in relation to concomitant changes in adipose tissue-derived
cytokines (IL-6, IL-8, and TNF-). Because we found that serum levels of
adiponectin were negatively correlated with IL-6 and TNF- in obese
subjects, we hypothesized that changes in adiponectin levels might be mediated
by changes in the levels of cytokines. Thus, in in vitro studies, we
investigated the direct effect of these cytokines on adiponectin production in
human adipose tissue.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
The first study was a 20-wk intervention study where six (4 males and 2 females) obese subjects [mean body mass index (BMI): 39.7 ± 0.6 kg/m2] received a very low calorie diet (3.4 MJ/day) for 8 wk followed by an additional 12 wk on a weight-stabilizing diet. Fasting blood samples and subcutaneous abdominal adipose tissue biopsies were obtained at baseline and at the end of the study. None of the subjects received any medication. The subjects were fasted overnight, and the adipose tissue was removed using a sterile technique, as previously described (7, 34). Plasma samples were frozen at -20°C, and the adipose tissue was snap-frozen in liquid nitrogen and stored at -80°C for later RNA extraction.
In the second study (Table 1), nineteen abdominal obese men (waist circumference >102 cm) with a mean BMI of 38.7 ± 0.7 kg/m2 (range: 34.1-43.8 kg/m2) were compared at baseline with 10 lean men with a mean BMI of 23.4 ± 0.4 kg/m2 (range: 21.1-24.7 kg/m2). All subjects were nondiabetic, and none of them used any medication. The obese subjects underwent a 24-wk intervention where weight loss was induced by a 4.2 MJ/day, low-calorie diet for 8 wk. This was followed by 8 wk on energy restriction providing 6.2 MJ/day and an additional 8 wk on a calculated weight maintenance diet. Fasting blood samples were obtained at baseline and, for the obese subjects, after 24 wk. Plasma samples for determination of fasting insulin and fasting glucose were analyzed at the local clinical biochemical laboratory, and measures for insulin resistance were obtained using the homeostasis model assessment [HOMA = (fasting insulin x fasting glucose)/22.5], as previously described (12, 19). Body composition was assessed by dual-energy X-ray absorptiometry scan using a Lunar DPX-IQ Image Densitometer (DPX; Lunar Radiation, Madison, WI).
|
In the in vitro study, subcutaneous abdominal adipose tissue from six
healthy women (mean BMI: 25.0 ± 0.7 kg/m2; range: 23.5-27.1
kg/m2) undergoing liposuction at a plastic surgical clinic were
used. Adipose tissue was minced into fragments and placed in organ culture, as
previously described (7). The
adipose tissue was preincubated for 24 h. Thereafter, the medium was replaced;
IL-6 (50 µg/l), IL-6 (50 µg/l) plus the IL-6 soluble receptor (IL-6sR;
100 µg/l), IL-8 (1 mg/l), or TNF- (10 µg/l) was added; and the
incubation continued for up to 48 h. The concentrations of the cytokines above
were chosen, since these concentrations are suggested to elicit maximal
biological effects as found in adipose tissue
(7,
16,
17) or other in vitro cell
systems (36). Separate
incubations using either IL-6 or IL-6 plus IL-6sR were chosen since previous
reports have demonstrated that no gene expression of IL-6sR was observed in
human adipose stromal cells
(10) and that induction of
aromatase activity in human adipose stromal cells was absent when incubated
with IL-6 alone but present after addition of IL-6 plus IL-6sR
(41). Adipose tissue
incubations were performed as duplicate incubations. Adipose tissue was
snap-frozen in liquid nitrogen and kept at -80°C for later RNA
extraction.
Adiponectin and cytokine protein measurements. Plasma levels of
adiponectin were measured using RIA (Linco Research). The assay had an
intra-assay coefficient of variation of 5.0% (n = 12). Cytokine
protein levels were measured in the plasma samples by using a specific, highly
sensitive human ELISA method. IL-8 (US-H-IL-8; Biosource Technologies Europe)
had an intra-assay coefficient of variation of 6.0% (n = 3). IL-6
(Quantikine HS600; R&D Systems Europe) had an intra-assay coefficient of
variation of 5.5% (n = 12). TNF- (Quantikine HSTA00C; R&D
Systems Europe) had an intra-assay coefficient of variation of 3.5%
(n = 12).
Adiponectin mRNA level. RNA was isolated using TRIzol reagents.
For the real-time RT-PCR, cDNA was made with random hexamer primers, as
described elsewhere (GeneAmp PCR kit; Perkin-Elmer Cetus, Norwalk, CT).
PCR-mastermix containing the specific primers, Hot Star Taq DNA
polymerase, and SYBR-Green PCR buffer were then added. Adiponectin sense
primer CATGACCAGGAAACCACGACT and anti-sense primer TGAATGCTGAGCGGTAT spanned a
product of 301 bp. As previously described
(6), real-time quantification
of adiponectin mRNA to 
-actin mRNA was performed with a SYBR-Green
real-time PCR assay using an ICycler PCR machine from Bio-Rad. Adiponectin and
-actin mRNA were amplified in separate tubes, and the increase in
fluorescence was measured in real time. Threshold cycle (CT) was
defined as the fractional cycle number at which the fluorescence reached 10
times the SD of the baseline. Samples were amplified in duplicate, and
relative gene expression of -actin to adiponectin was calculated as
1/2(CT target ÷ CT -actin).
Statistical analysis. The SPSS statistical packet (SPSS/8.0; SPSS) was used for the calculations. In obese subjects, a paired t-test was used for comparison of anthropometric data, body composition, various parameters of insulin sensitivity, circulating levels of adiponectin and cytokines, as well as adiponectin mRNA levels in adipose tissue biopsies before and after weight loss. When comparing plasma levels of adiponectin, cytokines, anthropometric data, body composition, and various parameters of insulin sensitivity in lean and obese subjects, a nonpaired t-test was used. For comparison between the various adipose tissue incubations, an ANOVA with a Dunnett's test for post hoc multiple comparison was used. To determine the relationship between plasma levels of cytokines, various metabolic or anthropometric parameters, and adiponectin at baseline as well as after weight loss, a bivariate correlation with a Pearson correlation coefficient (rp) was used. Multiple regression analysis was undertaken to address the association between adiponectin and the above-mentioned cytokines and metabolic and anthropometric parameters, taking into account the possible association between these. Values are presented as means ± SE. Threshold for significance was set at P < 0.05.
Ethics. Informed, written consent was obtained from all subjects. The studies were approved by the Ethics Committees of Aarhus, Copenhagen, Frederiksberg, and Zealand in accordance with the Helsinki II Declaration.
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
|
Study 2: baseline comparison between obese and lean subjects and effect
of weight loss. As shown in Table
1, obese subjects compared with lean subjects were found to have
significantly higher amounts of total body fat and more visceral adipose
tissue, as estimated by trunk fat mass and waist circumference. In addition,
obese subjects were more insulin resistant, as assessed by fasting insulin
levels and HOMA (Table 1).
Plasma levels of adiponectin were 53% higher in lean compared with obese
subjects (4.6 ± 0.4 vs. 3.0 ± 0.3 mg/l; P < 0.01;
Fig. 2). In contrast, plasma
levels of IL-6 (Fig. 2) and
IL-8 were 64% (P < 0.05) and 38% (P < 0.05) higher in
obese compared with lean subjects, respectively. No difference was observed in
the plasma levels of TNF- between the two groups
(Table 1).
|
In lean subjects at baseline, plasma levels of adiponectin were found to be
inversely correlated with BMI (rP = -0.65; P <
0.05), but no association was found between adiponectin and other parameters
of adiposity, insulin sensitivity, or circulating levels of IL-8, IL-6, or
TNF- (data not shown). In obese subjects at baseline, plasma levels of
adiponectin were found to be inversely correlated with measures of insulin
sensitivity, such as HOMA (P < 0.05) and fasting insulin
(P < 0.05), as well as with measures of adiposity [BMI (P
< 0.05) and waist circumference (P < 0.05)], but only
marginally with total fat mass (P = 0.07). In addition, plasma levels
of adiponectin were found to be inversely correlated with plasma levels of
IL-6 (P < 0.01) and TNF- (P < 0.05) but only
marginally with plasma levels of IL-8 (P = 0.06). In obese subjects,
multiple regression analysis displayed IL-6 as the main predictor (P
< 0.05) of circulating adiponectin levels and BMI (P = 0.07) and
waist circumference (P = 0.11) as marginally significant predictors
(data not shown). When the two groups were combined, plasma adiponectin was
found to be significantly correlated with measures of insulin sensitivity and
with measures of adiposity (Table
2). Plasma adiponectin was correlated with IL-6, but not
TNF- or IL-8 (Table 2).
Multiple regression analysis showed that BMI was the main predictor
(P < 0.01) of circulating adiponectin levels.
|
After the diet-induced weight loss (after 24 wk), the obese subjects had
reduced their body weight with an average of 20 kg (P < 0.001) and
their total body fat mass with 
15 kg (P < 0.001;
Table 1). The decreases in both
total body fat mass and visceral fat mass were related to an improvement in
insulin sensitivity, as demonstrated by a decrement in fasting insulin (110.2
± 11.1 vs. 77.9 ± 15.8 pmol/l; P < 0.01) and HOMA
(26.0 ± 2.9 vs. 14.5 ± 2.1; P < 0.001). Weight loss
induced a 43% increase in circulating levels of adiponectin (3.0 ± 0.3
vs. 4.3 ± 0.4 mg/l; P < 0.001) and a 25% decrease in
circulating levels of IL-6 (4.1 ± 0.4 vs. 3.1 ± 0.4 ng/l;
P < 0.001), thereby approaching plasma levels found in lean
subjects (Fig. 2).
In obese subjects, the difference in baseline and final concentration of
adiponectin (
adiponectin) was inversely correlated to the concomitant
changes in measures of adiposity and insulin sensitivity
(Table 3 and
Fig. 3). Adiponectin was
also found to be significantly correlated with IL-6
(rp = -0.46; P < 0.05;
Fig. 3), but not with
TNF- or IL-8 (data not shown). Changes in insulin
(insulin) and BMI (BMI) were found by regression analysis to be
the main predictors (P < 0.01) for alterations in the circulating
adiponectin levels, whereas IL-6 was not found to be independently
associated with adiponectin (P = 0.18).
|
|
In vitro study: regulation of adiponectin by cytokines. The adipose tissue fragments were incubated with cytokines in concentrations suggested to elicit maximal biological effects, as described in MATERIALS AND METHODS.
Adiponectin mRNA levels were reduced significantly after incubation of
whole adipose tissue fragments with IL-6 plus IL-6sR (P < 0.05) or
TNF- (P < 0.01) for up to 48 h
(Fig. 4). Neither incubation
with IL-6 alone nor IL-8 had any effect on adiponectin mRNA levels
(Fig 4).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
insulin and HOMA) and adiposity
(BMI and waist) before and after weight loss were also found to
be inversely correlated with the concomitant changes in circulating
adiponectin. Some discrepancy still exists on the relationship between
adiponectin and insulin resistance, especially in rodents, where reports by
Yamauchi et al. (39) and Berg
et al. (3) found that treatment
with adiponectin was able to reverse insulin resistance in various
obesity-prone and diabetic mouse strains. In contrast, Ma and colleagues
(25) found no impaired glucose
tolerance or insulin resistance in adiponectin-deficient mice compared with
the wild type. However, our present findings are in agreement with several
recent human studies (1,
21,
38).
To our knowledge, this is the first description of a relationship between
adiponectin and cytokines. In obese subjects at baseline, the plasma
adiponectin levels were found to be inversely correlated with circulating
levels of IL-6 and TNF-, but only marginally with IL-8. Interestingly,
the weight loss-induced increment in adiponectin was also found to be
inversely correlated with the decrement in IL-6. In multiple regression
analysis, IL-6 was found to be an independent predictor of plasma adiponectin
at baseline in obese subjects. However, after the two groups were combined and
after weight loss, BMI and insulin were found to be the main predictors of
circulating adiponectin levels. Because in vivo findings indicated that there
could be a link between adiponectin and some of the adipose tissue-derived
cytokines, inhibiting adiponectin production, we performed in vitro
investigations on the direct effects of the three cytokines on adipose tissue
adiponectin mRNA levels.
In vitro incubations were performed with adipose tissue from women. Even
though circulating levels of adiponectin have been found to be higher in women
compared with men, the association between adiponectin and measures of
adiposity, type 2 diabetes, or cardiovascular disease displays no gender
difference (1,
21). As described in
MATERIALS AND METHODS, adipose tissue fragments were incubated with
IL-6 alone as well as with IL-6 plus its soluble receptor. In this setting, we
found that incubation of human adipose tissue fragments with IL-6 together
with IL-6sR could decrease adiponectin mRNA levels almost to the same extent
as TNF-. No effect of IL-6 alone on adiponectin mRNA levels was
observed in our in vitro study. Our findings are somewhat in contrast to the
recent findings by Fasshauer et al.
(14), who found that
incubation with IL-6 alone could decrease adiponectin gene expression in the
3T3-L1 cell line. The discrepancy could be because 3T3-L1 cells have different
characteristics compared with human adipose tissue (e.g., concerning
expression of the IL-6sR) or because tissue incubations were performed
differently. The direct inhibitory effect of TNF- on adiponectin mRNA
levels is in accord with two recently published papers showing that
TNF- in 3T3-L1 adipocytes
(13) and in human
preadipocytes (22) was able to
inhibit adiponectin mRNA levels. Circulating levels of IL-6 have been found to
be correlated with different measures of cardiovascular disease
(29,
35) and insulin resistance
(23) and to be increased in
the obese state (2). In
addition, Fried and coworkers
(15) demonstrated that IL-6
secretion was higher in omental compared with subcutaneous adipose tissue.
Adiponectin compared with IL-6 has been reported to be inversely correlated
with cardiovascular disease, insulin resistance, and obesity. The findings in
the present study, indicating an inverse association between IL-6 and
adiponectin in vivo and in vitro, suggest that these effects of IL-6 may be
mediated partly by an IL-6-induced inhibition of adiponectin. Because both
adiponectin and IL-6 are produced and released from the human adipose tissue,
this interaction could be exerted in a paracrine or autocrine manner.
Development of atherosclerotic disease has been suggested to be mediated
through a long-term, low-grade inflammatory process involving the NF-B
pathway (4,
9,
37). This pathway is known to
be activated by TNF- and reported to be inhibited (attenuated) by
adiponectin in vitro (33). In
the present study, neither TNF- nor IL-8 was found to be correlated
with adiponectin after weight loss in vivo. This could be because of
differences in the time span by which regulation of TNF-, IL-8, and
adiponectin production is achieved. In the in vitro incubations, we found
profound effects of IL-6 plus IL-6sR and TNF- on adiponectin mRNA
levels. Although Mohamed-Ali et al.
(30) found no net release of
TNF- from the abdominal subcutaneous adipose tissue depot in the basal
(nonstimulated) situation, TNF- is known to be produced in the adipose
tissue, affecting adipose tissue metabolism through autocrine and paracrine
pathways. Moreover, TNF- is associated with measures of adiposity and
insulin sensitivity and is of importance as a marker of general activation of
the cytokine system (e.g., through activation of NF-B; see Refs.
4 and
37). Thus the findings in
vitro could suggest that local production of IL-6 and TNF- in the
adipose tissue may directly inhibit the local production of adiponectin.
However, IL-8, which is also produced in the adipose tissue
(7), does not seem to have any
direct effect on adiponectin production.
In conclusion, an inverse relationship between plasma levels of adiponectin
and adipose tissue-derived cytokines, particularly IL-6, was demonstrated in
vivo. Furthermore, in vitro incubation of human adipose tissue fragments with
IL-6 plus IL-6sR and TNF- resulted in a decrement in adiponectin mRNA
levels, suggesting that endogenous cytokines may inhibit adiponectin, which
could be of importance for the association between cytokines (e.g., IL-6) and
insulin resistance and atherosclerosis.
|
DISCLOSURES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  F M E Franssen, D E O'Donnell, G H Goossens, E E Blaak, and A M W J Schols Obesity and the lung: 5 {middle dot} Obesity and COPD Thorax, December 1, 2008; 63(12): 1110 - 1117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Puglisi and M. L. Fernandez Modulation of C-Reactive Protein, Tumor Necrosis Factor-{alpha}, and Adiponectin by Diet, Exercise, and Weight Loss J. Nutr., December 1, 2008; 138(12): 2293 - 2296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A Sood, X Cui, C Qualls, W S Beckett, M D Gross, M W Steffes, L J Smith, and D R Jacobs Jr Association between asthma and serum adiponectin concentration in women Thorax, October 1, 2008; 63(10): 877 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Heidemann, Q. Sun, R. M. van Dam, J. B. Meigs, C. Zhang, S. S. Tworoger, C. S. Mantzoros, and F. B. Hu Total and High-Molecular-Weight Adiponectin and Resistin in Relation to the Risk for Type 2 Diabetes in Women Ann Intern Med, September 2, 2008; 149(5): 307 - 316. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Tholstrup, M. Raff, E. M. Straarup, P. Lund, S. Basu, and J. M. Bruun An Oil Mixture with Trans-10, Cis-12 Conjugated Linoleic Acid Increases Markers of Inflammation and in Vivo Lipid Peroxidation Compared with Cis-9, Trans-11 Conjugated Linoleic Acid in Postmenopausal Women J. Nutr., August 1, 2008; 138(8): 1445 - 1451. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. L Madsen, A. Rissanen, J. M Bruun, K. Skogstrand, S. Tonstad, D. M Hougaard, and B. Richelsen Weight loss larger than 10% is needed for general improvement of levels of circulating adiponectin and markers of inflammation in obese subjects: a 3-year weight loss study Eur. J. Endocrinol., February 1, 2008; 158(2): 179 - 187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Cave, R. T. Hurt, T. H. Frazier, P. J. Matheson, R. N. Garrison, C. J. McClain, and S. A. McClave Obesity, Inflammation, and the Potential Application of Pharmaconutrition Nutr Clin Pract, February 1, 2008; 23(1): 16 - 34. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Spurlock and N. K. Gabler The Development of Porcine Models of Obesity and the Metabolic Syndrome J. Nutr., February 1, 2008; 138(2): 397 - 402. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Hojbjerre, M. Rosenzweig, F. Dela, J. M Bruun, and B. Stallknecht Acute exercise increases adipose tissue interstitial adiponectin concentration in healthy overweight and lean subjects Eur. J. Endocrinol., November 1, 2007; 157(5): 613 - 623. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ahmadizad, A. H. Haghighi, and M. R. Hamedinia Effects of resistance versus endurance training on serum adiponectin and insulin resistance index Eur. J. Endocrinol., November 1, 2007; 157(5): 625 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-A. Lee, A. Kallianpur, Y.-B. Xiang, W. Wen, Q. Cai, D. Liu, S. Fazio, M. F. Linton, W. Zheng, and X. O. Shu Intra-individual Variation of Plasma Adipokine Levels and Utility of Single Measurement of These Biomarkers in Population-Based Studies Cancer Epidemiol. Biomarkers Prev., November 1, 2007; 16(11): 2464 - 2470. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. F. Bodary Links Between Adipose Tissue and Thrombosis in the Mouse Arterioscler. Thromb. Vasc. Biol., November 1, 2007; 27(11): 2284 - 2291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Johnston, B. L. Beezhold, B. Mostow, and P. D. Swan Plasma Vitamin C Is Inversely Related to Body Mass Index and Waist Circumference but Not to Plasma Adiponectin in Nonsmoking Adults J. Nutr., July 1, 2007; 137(7): 1757 - 1762. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Barbour, C. E. McCurdy, T. L. Hernandez, J. P. Kirwan, P. M. Catalano, and J. E. Friedman Cellular Mechanisms for Insulin Resistance in Normal Pregnancy and Gestational Diabetes Diabetes Care, July 1, 2007; 30(Supplement_2): S112 - S119. [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. McEntegart, B. Awede, M. C. Petrie, N. Sattar, F. G. Dunn, N. G. MacFarlane, and J. J.V. McMurray Increase in serum adiponectin concentration in patients with heart failure and cachexia: relationship with leptin, other cytokines, and B-type natriuretic peptide Eur. Heart J., April 2, 2007; (2007) ehm033v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Popa, M. G. Netea, P. L. C. M. van Riel, J. W. M. van der Meer, and A. F. H. Stalenhoef The role of TNF-{alpha} in chronic inflammatory conditions, intermediary metabolism, and cardiovascular risk J. Lipid Res., April 1, 2007; 48(4): 751 - 762. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. E. Spangenburg, S. E. Shoelson, C. Weigert, R. Lehmann, E. D. Schleicher, J.-O. Jansson, V. Wallenius, J.-P. Bastard, C. Lagathu, M. Caron, et al. Interleukin-6 does/does not have a beneficial role in insulin sensitivity and glucose homeostasis J Appl Physiol, February 1, 2007; 102(2): 820 - 823. [Full Text] [PDF]
|
|
|
|
 |
|
 P. J Simons, P. S van den Pangaart, J. M F G Aerts, and L. Boon Pro-inflammatory delipidizing cytokines reduce adiponectin secretion from human adipocytes without affecting adiponectin oligomerization J. Endocrinol., February 1, 2007; 192(2): 289 - 299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A Martos-Moreno, V. Barrios, L. Soriano-Guillen, and J. Argente Relationship between adiponectin levels, acylated ghrelin levels, and short-term body mass index changes in children with diabetes mellitus type 1 at diagnosis and after insulin therapy. Eur. J. Endocrinol., November 1, 2006; 155(5): 757 - 761. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. P Weiss, S. B Racette, D. T Villareal, L. Fontana, K. Steger-May, K. B Schechtman, S. Klein, J. O Holloszy, and and the Washington University School of Medicine C Improvements in glucose tolerance and insulin action induced by increasing energy expenditure or decreasing energy intake: a randomized controlled trial. Am. J. Clinical Nutrition, November 1, 2006; 84(5): 1033 - 1042. [Abstract] [Full Text] [PDF]
|
|
