AJP - Endo AJP citation statistics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 285: E527-E533, 2003. First published May 7, 2003; doi:10.1152/ajpendo.00110.2003
0193-1849/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/3/E527    most recent
00110.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (124)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.

Regulation of adiponectin by adipose tissue-derived cytokines: in vivo and in vitro investigations in humans

Jens M. Bruun,1 Aina S. Lihn,1 Camilla Verdich,2 Steen B. Pedersen,1 Søren Toubro,2 Arne Astrup,2 and Bjørn Richelsen1

1Department of Endocrinology and Metabolism C, Aarhus Amtssygehus, Aarhus University Hospital and Faculty of Health Sciences, Aarhus University, DK-8000 Aarhus C; and 2Research Department of Human Nutrition, Center for Advanced Food Research, The Royal Veterinary and Agricultural University, DK-1958 Frederiksberg C, Denmark

Submitted 14 March 2003 ; accepted in final form 6 May 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Adiponectin is an adipose tissue-specific protein that is abundantly present in the circulation and suggested to be involved in insulin sensitivity and development of atherosclerosis. Because cytokines are suggested to regulate adiponectin, the aim of the present study was to investigate the interaction between adiponectin and three adipose tissue-derived cytokines (IL-6, IL-8, and TNF-{alpha}). The study was divided into three substudies as follows: 1) plasma adiponectin and mRNA levels in adipose tissue biopsies from obese subjects [mean body mass index (BMI): 39.7 kg/m2, n = 6] before and after weight loss; 2) plasma adiponectin in obese men (mean BMI: 38.7 kg/m2, n = 19) compared with lean men (mean BMI: 23.4 kg/m2, n = 10) before and after weight loss; and 3) in vitro direct effects of IL-6, IL-8, and TNF-{alpha} on adiponectin mRNA levels in adipose tissue cultures. The results were that 1) weight loss resulted in a 51% (P < 0.05) increase in plasma adiponectin and a 45% (P < 0.05) increase in adipose tissue mRNA levels; 2) plasma adiponectin was 53% (P < 0.01) higher in lean compared with obese men, and plasma adiponectin was inversely correlated with adiposity, insulin sensitivity, and IL-6; and 3) TNF-{alpha} (P < 0.01) and IL-6 plus its soluble receptor (P < 0.05) decreased adiponectin mRNA levels in vitro. The inverse relationship between plasma adiponectin and cytokines in vivo and the cytokine-induced reduction in adiponectin mRNA in vitro suggests that endogenous cytokines may inhibit adiponectin. This could be of importance for the association between cytokines (e.g., IL-6) and insulin resistance and atherosclerosis.

interleukin-6; tumor necrosis factor-{alpha}; interleukin-8; human adipose tissue


EXCESS ADIPOSE TISSUE is strongly associated with the development of insulin resistance and thereby the development of type 2 diabetes and cardiovascular disease (24). The mechanisms behind the development of these obesity-associated complications have still not been fully elucidated (18). However, evidence is accumulating that the adipose tissue itself produces and releases a number of bioactive proteins, including proinflammatory cytokines such as tumor necrosis factor-{alpha} (TNF-{alpha}; see Ref. 20), interleukin-6 (IL-6; see Ref. 30), and interleukin-8 (IL-8; see Ref. 7), all of which have been reported to be affected by weight loss in obese subjects (2, 5, 11) and therefore could be of importance as part of the link between obesity and health complications (e.g., insulin resistance and premature atherosclerosis).

A newer candidate for the link between obesity and the development of insulin resistance and cardiovascular disease may be adiponectin, the gene product of the adipose tissue's most abundant gene transcript (26). In humans, high levels of adiponectin (range 2-20 mg/l) are found in the circulation (1). As opposed to other adipose-derived proteins, plasma levels of adiponectin have been found to be decreased in a number of deranged metabolic states, including obesity (1), dyslipidemia (28), type 2 diabetes, and coronary artery disease (21). Previous studies have demonstrated that the reduced circulating adiponectin levels could be reversed partially after induction of weight loss in obese and in insulin-resistant subjects (21, 40) as well as after treatment with insulin-sensitizing drugs such as thiazolidinediones (8, 27). The physiological role of adiponectin in relation to diseases associated with the metabolic syndrome remains to be determined; however, adiponectin has been demonstrated to improve insulin sensitivity in animal models of insulin resistance in vivo (3, 39). Besides the involvement in insulin sensitivity, adiponectin has been reported to exhibit antiatherosclerotic activity (31, 32) through an inhibition of TNF-{alpha}-induced activation of the nuclear transcription factor-{kappa}B (NF-{kappa}B; see Ref. 33). In addition, TNF-{alpha} has been demonstrated to decrease adiponectin gene expression in human preadipocytes (22) and 3T3-L1 adipocytes (13), suggesting a relationship between TNF-{alpha} and adiponectin.

To obtain additional information on the regulation of adiponectin, we investigated the effect of weight loss on adiponectin production and insulin sensitivity in relation to concomitant changes in adipose tissue-derived cytokines (IL-6, IL-8, and TNF-{alpha}). Because we found that serum levels of adiponectin were negatively correlated with IL-6 and TNF-{alpha} in obese subjects, we hypothesized that changes in adiponectin levels might be mediated by changes in the levels of cytokines. Thus, in in vitro studies, we investigated the direct effect of these cytokines on adiponectin production in human adipose tissue.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Subjects. The present study was divided into three substudies as follows: two clinical studies and one in vitro study using human adipose tissue fragments.

The first study was a 20-wk intervention study where six (4 males and 2 females) obese subjects [mean body mass index (BMI): 39.7 ± 0.6 kg/m2] received a very low calorie diet (3.4 MJ/day) for 8 wk followed by an additional 12 wk on a weight-stabilizing diet. Fasting blood samples and subcutaneous abdominal adipose tissue biopsies were obtained at baseline and at the end of the study. None of the subjects received any medication. The subjects were fasted overnight, and the adipose tissue was removed using a sterile technique, as previously described (7, 34). Plasma samples were frozen at -20°C, and the adipose tissue was snap-frozen in liquid nitrogen and stored at -80°C for later RNA extraction.

In the second study (Table 1), nineteen abdominal obese men (waist circumference >102 cm) with a mean BMI of 38.7 ± 0.7 kg/m2 (range: 34.1-43.8 kg/m2) were compared at baseline with 10 lean men with a mean BMI of 23.4 ± 0.4 kg/m2 (range: 21.1-24.7 kg/m2). All subjects were nondiabetic, and none of them used any medication. The obese subjects underwent a 24-wk intervention where weight loss was induced by a 4.2 MJ/day, low-calorie diet for 8 wk. This was followed by 8 wk on energy restriction providing 6.2 MJ/day and an additional 8 wk on a calculated weight maintenance diet. Fasting blood samples were obtained at baseline and, for the obese subjects, after 24 wk. Plasma samples for determination of fasting insulin and fasting glucose were analyzed at the local clinical biochemical laboratory, and measures for insulin resistance were obtained using the homeostasis model assessment [HOMA = (fasting insulin x fasting glucose)/22.5], as previously described (12, 19). Body composition was assessed by dual-energy X-ray absorptiometry scan using a Lunar DPX-IQ Image Densitometer (DPX; Lunar Radiation, Madison, WI).


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of the patients in study 2

 

In the in vitro study, subcutaneous abdominal adipose tissue from six healthy women (mean BMI: 25.0 ± 0.7 kg/m2; range: 23.5-27.1 kg/m2) undergoing liposuction at a plastic surgical clinic were used. Adipose tissue was minced into fragments and placed in organ culture, as previously described (7). The adipose tissue was preincubated for 24 h. Thereafter, the medium was replaced; IL-6 (50 µg/l), IL-6 (50 µg/l) plus the IL-6 soluble receptor (IL-6sR; 100 µg/l), IL-8 (1 mg/l), or TNF-{alpha} (10 µg/l) was added; and the incubation continued for up to 48 h. The concentrations of the cytokines above were chosen, since these concentrations are suggested to elicit maximal biological effects as found in adipose tissue (7, 16, 17) or other in vitro cell systems (36). Separate incubations using either IL-6 or IL-6 plus IL-6sR were chosen since previous reports have demonstrated that no gene expression of IL-6sR was observed in human adipose stromal cells (10) and that induction of aromatase activity in human adipose stromal cells was absent when incubated with IL-6 alone but present after addition of IL-6 plus IL-6sR (41). Adipose tissue incubations were performed as duplicate incubations. Adipose tissue was snap-frozen in liquid nitrogen and kept at -80°C for later RNA extraction.

Adiponectin and cytokine protein measurements. Plasma levels of adiponectin were measured using RIA (Linco Research). The assay had an intra-assay coefficient of variation of 5.0% (n = 12). Cytokine protein levels were measured in the plasma samples by using a specific, highly sensitive human ELISA method. IL-8 (US-H-IL-8; Biosource Technologies Europe) had an intra-assay coefficient of variation of 6.0% (n = 3). IL-6 (Quantikine HS600; R&D Systems Europe) had an intra-assay coefficient of variation of 5.5% (n = 12). TNF-{alpha} (Quantikine HSTA00C; R&D Systems Europe) had an intra-assay coefficient of variation of 3.5% (n = 12).

Adiponectin mRNA level. RNA was isolated using TRIzol reagents. For the real-time RT-PCR, cDNA was made with random hexamer primers, as described elsewhere (GeneAmp PCR kit; Perkin-Elmer Cetus, Norwalk, CT). PCR-mastermix containing the specific primers, Hot Star Taq DNA polymerase, and SYBR-Green PCR buffer were then added. Adiponectin sense primer CATGACCAGGAAACCACGACT and anti-sense primer TGAATGCTGAGCGGTAT spanned a product of 301 bp. As previously described (6), real-time quantification of adiponectin mRNA to {beta}-actin mRNA was performed with a SYBR-Green real-time PCR assay using an ICycler PCR machine from Bio-Rad. Adiponectin and {beta}-actin mRNA were amplified in separate tubes, and the increase in fluorescence was measured in real time. Threshold cycle (CT) was defined as the fractional cycle number at which the fluorescence reached 10 times the SD of the baseline. Samples were amplified in duplicate, and relative gene expression of {beta}-actin to adiponectin was calculated as 1/2(CT target ÷ CT {beta}-actin).

Statistical analysis. The SPSS statistical packet (SPSS/8.0; SPSS) was used for the calculations. In obese subjects, a paired t-test was used for comparison of anthropometric data, body composition, various parameters of insulin sensitivity, circulating levels of adiponectin and cytokines, as well as adiponectin mRNA levels in adipose tissue biopsies before and after weight loss. When comparing plasma levels of adiponectin, cytokines, anthropometric data, body composition, and various parameters of insulin sensitivity in lean and obese subjects, a nonpaired t-test was used. For comparison between the various adipose tissue incubations, an ANOVA with a Dunnett's test for post hoc multiple comparison was used. To determine the relationship between plasma levels of cytokines, various metabolic or anthropometric parameters, and adiponectin at baseline as well as after weight loss, a bivariate correlation with a Pearson correlation coefficient (rp) was used. Multiple regression analysis was undertaken to address the association between adiponectin and the above-mentioned cytokines and metabolic and anthropometric parameters, taking into account the possible association between these. Values are presented as means ± SE. Threshold for significance was set at P < 0.05.

Ethics. Informed, written consent was obtained from all subjects. The studies were approved by the Ethics Committees of Aarhus, Copenhagen, Frederiksberg, and Zealand in accordance with the Helsinki II Declaration.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Study 1: effects of weight loss on adiponectin in plasma and adipose tissue. In the 20-wk weight loss intervention study, six obese subjects reduced their body weight by an average of 20 kg (122.0 ± 2.1 vs. 102.3 ± 5.0 kg; P < 0.05). The male subjects had a higher reduction in body weight compared with the two women, but there was no difference in the percentage of weight loss (14.0 ± 2.3 vs. 15.0 ± 1.0%). After the 20-wk weight loss period, circulating levels of adiponectin were increased by 51% (2.3 ± 0.6 vs. 3.4 ± 0.8 mg/l; P < 0.05; Fig. 1). This was paralleled by findings in the adipose tissue biopsies, where adiponectin mRNA levels were increased by 45% (P < 0.05; Fig 1). The weight loss-induced increments in both circulating adiponectin levels and mRNA levels in the adipose tissue samples were correlated, although insignificantly (rP = 0.59, P = 0.22), probably because of a type 2 error because of the limited number of subjects in the study.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Adiponectin in plasma and adipose tissue in association with weight loss. Study 1: circulating levels of adiponectin in plasma (A) and adiponectin mRNA levels (B) in adipose tissue biopsies assessed at baseline and after a 20-wk diet-induced weight loss (19.7 ± 4.7 kg) in 6 obese individuals. Solid lines represent each of the 6 individuals, and bars represent mean values ± SE (n = 6 subjects). *P < 0.05 compared with baseline.

 

Study 2: baseline comparison between obese and lean subjects and effect of weight loss. As shown in Table 1, obese subjects compared with lean subjects were found to have significantly higher amounts of total body fat and more visceral adipose tissue, as estimated by trunk fat mass and waist circumference. In addition, obese subjects were more insulin resistant, as assessed by fasting insulin levels and HOMA (Table 1). Plasma levels of adiponectin were 53% higher in lean compared with obese subjects (4.6 ± 0.4 vs. 3.0 ± 0.3 mg/l; P < 0.01; Fig. 2). In contrast, plasma levels of IL-6 (Fig. 2) and IL-8 were 64% (P < 0.05) and 38% (P < 0.05) higher in obese compared with lean subjects, respectively. No difference was observed in the plasma levels of TNF-{alpha} between the two groups (Table 1).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Adiponectin and interleukin (IL)-6 in plasma in lean and obese subjects. Study 2: circulating levels of adiponectin (A) and IL-6 (B) in 10 lean and 19 obese subjects before and after a 24-wk diet-induced weight loss (19.2 ± 2.0 kg). Data represent mean values ± SE. *P < 0.05 and **P < 0.01 compared with lean subjects. ###P < 0.001 compared with obese subjects at baseline.

 

In lean subjects at baseline, plasma levels of adiponectin were found to be inversely correlated with BMI (rP = -0.65; P < 0.05), but no association was found between adiponectin and other parameters of adiposity, insulin sensitivity, or circulating levels of IL-8, IL-6, or TNF-{alpha} (data not shown). In obese subjects at baseline, plasma levels of adiponectin were found to be inversely correlated with measures of insulin sensitivity, such as HOMA (P < 0.05) and fasting insulin (P < 0.05), as well as with measures of adiposity [BMI (P < 0.05) and waist circumference (P < 0.05)], but only marginally with total fat mass (P = 0.07). In addition, plasma levels of adiponectin were found to be inversely correlated with plasma levels of IL-6 (P < 0.01) and TNF-{alpha} (P < 0.05) but only marginally with plasma levels of IL-8 (P = 0.06). In obese subjects, multiple regression analysis displayed IL-6 as the main predictor (P < 0.05) of circulating adiponectin levels and BMI (P = 0.07) and waist circumference (P = 0.11) as marginally significant predictors (data not shown). When the two groups were combined, plasma adiponectin was found to be significantly correlated with measures of insulin sensitivity and with measures of adiposity (Table 2). Plasma adiponectin was correlated with IL-6, but not TNF-{alpha} or IL-8 (Table 2). Multiple regression analysis showed that BMI was the main predictor (P < 0.01) of circulating adiponectin levels.


View this table:
[in this window]
[in a new window]
 
Table 2. Association between adiponectin and measures of adiposity, insulin sensitivity, or cytokines

 

After the diet-induced weight loss (after 24 wk), the obese subjects had reduced their body weight with an average of 20 kg (P < 0.001) and their total body fat mass with ~15 kg (P < 0.001; Table 1). The decreases in both total body fat mass and visceral fat mass were related to an improvement in insulin sensitivity, as demonstrated by a decrement in fasting insulin (110.2 ± 11.1 vs. 77.9 ± 15.8 pmol/l; P < 0.01) and HOMA (26.0 ± 2.9 vs. 14.5 ± 2.1; P < 0.001). Weight loss induced a 43% increase in circulating levels of adiponectin (3.0 ± 0.3 vs. 4.3 ± 0.4 mg/l; P < 0.001) and a 25% decrease in circulating levels of IL-6 (4.1 ± 0.4 vs. 3.1 ± 0.4 ng/l; P < 0.001), thereby approaching plasma levels found in lean subjects (Fig. 2).

In obese subjects, the difference in baseline and final concentration of adiponectin ({Delta}adiponectin) was inversely correlated to the concomitant changes in measures of adiposity and insulin sensitivity (Table 3 and Fig. 3). {Delta}Adiponectin was also found to be significantly correlated with {Delta}IL-6 (rp = -0.46; P < 0.05; Fig. 3), but not with {Delta}TNF-{alpha} or {Delta}IL-8 (data not shown). Changes in insulin ({Delta}insulin) and BMI ({Delta}BMI) were found by regression analysis to be the main predictors (P < 0.01) for alterations in the circulating adiponectin levels, whereas {Delta}IL-6 was not found to be independently associated with {Delta}adiponectin (P = 0.18).


View this table:
[in this window]
[in a new window]
 
Table 3. Association between changes in plasma levels of adiponectin and changes in metabolic and anthropometric parameters

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Correlation between adiponectin and insulin or IL-6 in association with weight loss. Correlation between changes in plasma levels at baseline and after 24 wk weight loss for insulin ({Delta}insulin) and adiponectin ({Delta}adiponectin) (A) and IL-6 ({Delta}IL-6) and adiponectin ({Delta}adiponectin) (B) in 19 obese subjects. Bivariate correlation with Pearson correlation coefficient (rp).

 

In vitro study: regulation of adiponectin by cytokines. The adipose tissue fragments were incubated with cytokines in concentrations suggested to elicit maximal biological effects, as described in MATERIALS AND METHODS.

Adiponectin mRNA levels were reduced significantly after incubation of whole adipose tissue fragments with IL-6 plus IL-6sR (P < 0.05) or TNF-{alpha} (P < 0.01) for up to 48 h (Fig. 4). Neither incubation with IL-6 alone nor IL-8 had any effect on adiponectin mRNA levels (Fig 4).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4. In vitro effect of cytokines on adiponectin mRNA levels in human adipose tissue. Adipose tissue fragments were incubated as described in MATERIALS AND METHODS with either tumor necrosis factor (TNF)-{alpha} (10 µg/l), IL-6 (50 µg/l), IL-6 (50 µg/l) plus IL-6 soluble receptor (IL-6sR; 100 µg/l), or IL-8 (1 mg/l). Data represent mean values ± SE (n = 6). *P < 0.05 and **P < 0.01 compared with control incubations.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
In the present paper, it was demonstrated that diet-induced weight loss increases adiponectin mRNA levels in subcutaneous abdominal adipose tissue biopsies, paralleled by an increase in plasma levels of adiponectin. Plasma levels of adiponectin at baseline were found to be inversely correlated with measures of insulin sensitivity (fasting insulin and HOMA) and adiposity (BMI and total fat mass), including measures of visceral adiposity, such as waist circumference. In agreement with these observations, the changes in measures of insulin sensitivity ({Delta}insulin and {Delta}HOMA) and adiposity ({Delta}BMI and {Delta}waist) before and after weight loss were also found to be inversely correlated with the concomitant changes in circulating adiponectin. Some discrepancy still exists on the relationship between adiponectin and insulin resistance, especially in rodents, where reports by Yamauchi et al. (39) and Berg et al. (3) found that treatment with adiponectin was able to reverse insulin resistance in various obesity-prone and diabetic mouse strains. In contrast, Ma and colleagues (25) found no impaired glucose tolerance or insulin resistance in adiponectin-deficient mice compared with the wild type. However, our present findings are in agreement with several recent human studies (1, 21, 38).

To our knowledge, this is the first description of a relationship between adiponectin and cytokines. In obese subjects at baseline, the plasma adiponectin levels were found to be inversely correlated with circulating levels of IL-6 and TNF-{alpha}, but only marginally with IL-8. Interestingly, the weight loss-induced increment in adiponectin was also found to be inversely correlated with the decrement in IL-6. In multiple regression analysis, IL-6 was found to be an independent predictor of plasma adiponectin at baseline in obese subjects. However, after the two groups were combined and after weight loss, BMI and insulin were found to be the main predictors of circulating adiponectin levels. Because in vivo findings indicated that there could be a link between adiponectin and some of the adipose tissue-derived cytokines, inhibiting adiponectin production, we performed in vitro investigations on the direct effects of the three cytokines on adipose tissue adiponectin mRNA levels.

In vitro incubations were performed with adipose tissue from women. Even though circulating levels of adiponectin have been found to be higher in women compared with men, the association between adiponectin and measures of adiposity, type 2 diabetes, or cardiovascular disease displays no gender difference (1, 21). As described in MATERIALS AND METHODS, adipose tissue fragments were incubated with IL-6 alone as well as with IL-6 plus its soluble receptor. In this setting, we found that incubation of human adipose tissue fragments with IL-6 together with IL-6sR could decrease adiponectin mRNA levels almost to the same extent as TNF-{alpha}. No effect of IL-6 alone on adiponectin mRNA levels was observed in our in vitro study. Our findings are somewhat in contrast to the recent findings by Fasshauer et al. (14), who found that incubation with IL-6 alone could decrease adiponectin gene expression in the 3T3-L1 cell line. The discrepancy could be because 3T3-L1 cells have different characteristics compared with human adipose tissue (e.g., concerning expression of the IL-6sR) or because tissue incubations were performed differently. The direct inhibitory effect of TNF-{alpha} on adiponectin mRNA levels is in accord with two recently published papers showing that TNF-{alpha} in 3T3-L1 adipocytes (13) and in human preadipocytes (22) was able to inhibit adiponectin mRNA levels. Circulating levels of IL-6 have been found to be correlated with different measures of cardiovascular disease (29, 35) and insulin resistance (23) and to be increased in the obese state (2). In addition, Fried and coworkers (15) demonstrated that IL-6 secretion was higher in omental compared with subcutaneous adipose tissue. Adiponectin compared with IL-6 has been reported to be inversely correlated with cardiovascular disease, insulin resistance, and obesity. The findings in the present study, indicating an inverse association between IL-6 and adiponectin in vivo and in vitro, suggest that these effects of IL-6 may be mediated partly by an IL-6-induced inhibition of adiponectin. Because both adiponectin and IL-6 are produced and released from the human adipose tissue, this interaction could be exerted in a paracrine or autocrine manner. Development of atherosclerotic disease has been suggested to be mediated through a long-term, low-grade inflammatory process involving the NF-{kappa}B pathway (4, 9, 37). This pathway is known to be activated by TNF-{alpha} and reported to be inhibited (attenuated) by adiponectin in vitro (33). In the present study, neither TNF-{alpha} nor IL-8 was found to be correlated with adiponectin after weight loss in vivo. This could be because of differences in the time span by which regulation of TNF-{alpha}, IL-8, and adiponectin production is achieved. In the in vitro incubations, we found profound effects of IL-6 plus IL-6sR and TNF-{alpha} on adiponectin mRNA levels. Although Mohamed-Ali et al. (30) found no net release of TNF-{alpha} from the abdominal subcutaneous adipose tissue depot in the basal (nonstimulated) situation, TNF-{alpha} is known to be produced in the adipose tissue, affecting adipose tissue metabolism through autocrine and paracrine pathways. Moreover, TNF-{alpha} is associated with measures of adiposity and insulin sensitivity and is of importance as a marker of general activation of the cytokine system (e.g., through activation of NF-{kappa}B; see Refs. 4 and 37). Thus the findings in vitro could suggest that local production of IL-6 and TNF-{alpha} in the adipose tissue may directly inhibit the local production of adiponectin. However, IL-8, which is also produced in the adipose tissue (7), does not seem to have any direct effect on adiponectin production.

In conclusion, an inverse relationship between plasma levels of adiponectin and adipose tissue-derived cytokines, particularly IL-6, was demonstrated in vivo. Furthermore, in vitro incubation of human adipose tissue fragments with IL-6 plus IL-6sR and TNF-{alpha} resulted in a decrement in adiponectin mRNA levels, suggesting that endogenous cytokines may inhibit adiponectin, which could be of importance for the association between cytokines (e.g., IL-6) and insulin resistance and atherosclerosis.


    DISCLOSURES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
The study has been supported by the Novo Nordic Foundation, the Danish Medical Research Council, and the Aarhus University-Novo Nordic Center for Research in Growth and Regeneration. The low-calorie formula diet GERLINÉA was donated by WASABRØD, Skovlunde, Denmark.


    ACKNOWLEDGMENTS
 
The technical assistance of Lenette Pedersen and Pia Hornbek is gratefully appreciated.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. M. Bruun, Dept. of Endocrinology and Metabolism, Aarhus Amtssygehus, Tage Hansensgade 2, DK-8000 Aarhus C, Denmark (E-mail: jmb{at}mail-online.dk).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, Hotta K, Shimomura I, Nakamura T, Miyaoka K, Kuriyama H, Nishida M, Yamashita S, Okubo K, Matsubara K, Muraguchi M, Ohmoto Y, Funahashi T, and Matsuzawa Y. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun 257: 79-83, 1999.[Web of Science][Medline]
  2. Bastard JP, Jardel C, Bruckert E, Blondy P, Capeau J, Laville M, Vidal H, and Hainque B. Elevated levels of interleukin 6 are reduced in serum and subcutaneous adipose tissue of obese women after weight loss. J Clin Endocrinol Metab 85: E3338-E3342, 2000.
  3. Berg AH, Combs TP, Du X, Brownlee M, and Scherer PE. The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med 7: 947-953, 2001.[Web of Science][Medline]
  4. Brand K, Page S, Rogler G, Bartsch A, Brandl R, Knuechel R, Page M, Kaltschmidt C, Baeuerle PA, and Neumeier D. Activated transcription factor nuclear factor-kappa B is present in the atherosclerotic lesion. J Clin Invest 97: 1715-1722, 1996.[Web of Science][Medline]
  5. Bruun JM, Pedersen SB, Kristensen K, and Richelsen B. Opposite regulation of interleukin-8 and tumor necrosis factor-alpha by weight loss. Obes Res 10: 499-506, 2002.[Web of Science][Medline]
  6. Bruun JM, Pedersen SB, and Richelsen B. Interleukin-8 production in human adipose tissue. Inhibitory effects of anti-diabetic compounds, the thiazolidinedione ciglitazone and the biguanide metformin. Horm Metab Res 32: 537-541, 2000.[Web of Science][Medline]
  7. Bruun JM, Pedersen SB, and Richelsen B. Regulation of interleukin 8 production and gene expression in human adipose tissue in vitro. J Clin Endocrinol Metab 86: 1267-1273, 2001.[Abstract/Free Full Text]
  8. Combs TP, Wagner JA, Berger J, Doebber T, Wang WJ, Zhang BB, Tanen M, Berg AH, O'Rahilly S, Savage DB, Chatterjee K, Weiss S, Larson PJ, Gottesdiener KM, Gertz BJ, Charron MJ, Scherer PE, and Moller DE. Induction of adipocyte complement-related protein of 30 kilodaltons by PPARgamma agonists: a potential mechanism of insulin sensitization. Endocrinology 143: 998-1007, 2002.[Abstract/Free Full Text]
  9. Cominacini L, Pasini AF, Garbin U, Davoli A, Tosetti ML, Campagnola M, Rigoni A, Pastorino AM, Lo C, and Sawamura T. Oxidized low density lipoprotein (ox-LDL) binding to ox-LDL receptor-1 in endothelial cells induces the activation of NF-kappaB through an increased production of intracellular reactive oxygen species. J Biol Chem 275: 12633-12638, 2000.[Abstract/Free Full Text]
  10. Crichton MB, Nichols JE, Zhao Y, Bulun SE, and Simpson ER. Expression of transcripts of interleukin-6 and related cytokines by human breast tumors, breast cancer cells, and adipose stromal cells. Mol Cell Endocrinol 118: 215-220, 1996.[Web of Science][Medline]
  11. Dandona P, Weinstock R, Thusu K, Abdel-Rahman E, Aljada A, and Wadden T. Tumor necrosis factor-alpha in sera of obese patients: fall with weight loss. J Clin Endocrinol Metab 83: 2907-2910, 1998.[Abstract/Free Full Text]
  12. Emoto M, Nishizawa Y, Maekawa K, Hiura Y, Kanda H, Kawagishi T, Shoji T, Okuno Y, and Morii H. Homeostasis model assessment as a clinical index of insulin resistance in type 2 diabetic patients treated with sulfonylureas. Diabetes Care 22: 818-822, 1999.[Abstract/Free Full Text]
  13. Fasshauer M, Klein J, Neumann S, Eszlinger M, and Paschke R. Hormonal regulation of adiponectin gene expression in 3T3-L1 adipocytes. Biochem Biophys Res Commun 290: 1084-1089, 2002.[Web of Science][Medline]
  14. Fasshauer M, Kralisch S, Klier M, Lossner U, Bluher M, Klein J, and Paschke R. Adiponectin gene expression and secretion is inhibited by interleukin-6 in 3T3-L1 adipocytes. Biochem Biophys Res Commun 301: 1045-1050, 2003.[Web of Science][Medline]
  15. Fried SK, Bunkin DA, and Greenberg AS. Omental and subcutaneous adipose tissues of obese subjects release interleukin-6: depot difference and regulation by glucocorticoid. J Clin Endocrinol Metab 83: 847-850, 1998.[Abstract/Free Full Text]
  16. Gerhardt CC, Romero IA, Cancello R, Camoin L, and Strosberg AD. Chemokines control fat accumulation and leptin secretion by cultured human adipocytes. Mol Cell Endocrinol 175: 81-92, 2001.[Web of Science][Medline]
  17. Granowitz EV. Transforming growth factor-beta enhances and pro-inflammatory cytokines inhibit ob gene expression in 3T3-L1 adipocytes. Biochem Biophys Res Commun 240: 382-385, 1997.[Web of Science][Medline]
  18. Greenberg AS and McDaniel ML. Identifying the links between obesity, insulin resistance and beta-cell function: potential role of adipocyte-derived cytokines in the pathogenesis of type 2 diabetes. Eur J Clin Invest 32, Suppl 3: 24-34, 2002.[Web of Science][Medline]
  19. Haffner SM, Miettinen H, and Stern MP. The homeostasis model in the San Antonio Heart Study. Diabetes Care 20: 1087-1092, 1997.[Abstract]
  20. Hotamisligil GS and Spiegelman BM. Tumor necrosis factor alpha: a key component of the obesity-diabetes link. Diabetes 43: 1271-1278, 1994.[Abstract]
  21. Hotta K, Funahashi T, Arita Y, Takahashi M, Matsuda M, Okamoto Y, Iwahashi H, Kuriyama H, Ouchi N, Maeda K, Nishida M, Kihara S, Sakai N, Nakajima T, Hasegawa K, Muraguchi M, Ohmoto Y, Nakamura T, Yamashita S, Hanafusa T, and Matsuzawa Y. Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol 20: 1595-1599, 2000.[Abstract/Free Full Text]
  22. Kappes A and Loffler G. Influences of ionomycin, dibutyrylcycloAMP and tumour necrosis factor-alpha on intracellular amount and secretion of apM1 in differentiating primary human preadipocytes. Horm Metab Res 32: 548-554, 2000.[Web of Science][Medline]
  23. Kern PA, Ranganathan S, Li C, Wood L, and Ranganathan G. Adipose tissue tumor necrosis factor and interleukin-6 expression in human obesity and insulin resistance. Am J Physiol Endocrinol Metab 280: E745-E751, 2001.[Abstract/Free Full Text]
  24. Kopelman PG. Obesity as a medical problem. Nature 404: 635-643, 2000.[Medline]
  25. Ma K, Cabrero A, Saha PK, Kojima H, Li L, Chang BH, Paul A, and Chan L. Increased beta-oxidation but no insulin resistance or glucose intolerance in mice lacking adiponectin. J Biol Chem 277: 34658-34661, 2002.[Abstract/Free Full Text]
  26. Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, and Matsubara K. cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem Biophys Res Commun 221: 286-289, 1996.[Web of Science][Medline]
  27. Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K, Nagaretani H, Matsuda M, Komuro R, Ouchi N, Kuriyama H, Hotta K, Nakamura T, Shimomura I, and Matsuzawa Y. PPARgamma ligands increase expression and plasma concentrations of adiponectin, an adipose-derived protein. Diabetes 50: 2094-2099, 2001.[Abstract/Free Full Text]
  28. Matsubara M, Maruoka S, and Katayose S. Decreased plasma adiponectin concentrations in women with dyslipidemia. J Clin Endocrinol Metab 87: 2764-2769, 2002.[Abstract/Free Full Text]
  29. McCarty MF. Interleukin-6 as a central mediator of cardiovascular risk associated with chronic inflammation, smoking, diabetes, and visceral obesity: down-regulation with essential fatty acids, ethanol and pentoxifylline. Med Hypotheses 52: 465-477, 1999.[Web of Science][Medline]
  30. Mohamed-Ali V, Goodrick S, Rawesh A, Katz DR, Miles JM, Yudkin JS, Klein S, and Coppack SW. Subcutaneous adipose tissue releases interleukin-6, but not tumor necrosis factor-alpha, in vivo. J Clin Endocrinol Metab 82: 4196-4200, 1997.[Abstract/Free Full Text]
  31. Ouchi N, Kihara S, Arita Y, Maeda K, Kuriyama H, Okamoto Y, Hotta K, Nishida M, Takahashi M, Nakamura T, Yamashita S, Funahashi T, and Matsuzawa Y. Novel modulator for endothelial adhesion molecules: adipocyte-derived plasma protein adiponectin. Circulation 100: 2473-2476, 1999.[Abstract/Free Full Text]
  32. Ouchi N, Kihara S, Arita Y, Nishida M, Matsuyama A, Okamoto Y, Ishigami M, Kuriyama H, Kishida K, Nishizawa H, Hotta K, Muraguchi M, Ohmoto Y, Yamashita S, Funahashi T, and Matsuzawa Y. Adipocyte-derived plasma protein, adiponectin, suppresses lipid accumulation and class A scavenger receptor expression in human monocyte-derived macrophages. Circulation 103: 1057-1063, 2001.[Abstract/Free Full Text]
  33. Ouchi N, Kihara S, Arita Y, Okamoto Y, Maeda K, Kuriyama H, Hotta K, Nishida M, Takahashi M, Muraguchi M, Ohmoto Y, Nakamura T, Yamashita S, Funahashi T, and Matsuzawa Y. Adiponectin, an adipocyte-derived plasma protein, inhibits endothelial NF-kappaB signaling through a cAMP-dependent pathway. Circulation 102: 1296-1301, 2000.[Abstract/Free Full Text]
  34. Pedersen SB, Borglum J, Jorgensen JO, and Richelsen B. Growth hormone treatment of obese premenopausal women: effects on isolated adipocyte metabolism. Endocrinol Metab 2: 251-258, 1995.
  35. Ridker PM, Rifai N, Stampfer MJ, and Hennekens CH. Plasma concentration of interleukin-6 and the risk of future myocardial infarction among apparently healthy men. Circulation 101: 1767-1772, 2000.[Abstract/Free Full Text]
  36. Romano M, Sironi M, Toniatti C, Polentarutti N, Fruscella P, Ghezzi P, Faggioni R, Luini W, van H, V, Sozzani S, Bussolino F, Poli V, Ciliberto G, and Mantovani A. Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity 6: 315-325, 1997.[Web of Science][Medline]
  37. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 362: 801-809, 1993.[Medline]
  38. Weyer C, Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley RE, and Tataranni PA. Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperinsulinemia. J Clin Endocrinol Metab 86: 1930-1935, 2001.[Abstract/Free Full Text]
  39. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T, Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel P, and Kadowaki T. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 7: 941-946, 2001.[Web of Science][Medline]
  40. Yang WS, Lee WJ, Funahashi T, Tanaka S, Matsuzawa Y, Chao CL, Chen CL, Tai TY, and Chuang LM. Weight reduction increases plasma levels of an adipose-derived anti-inflammatory protein, adiponectin. J Clin Endocrinol Metab 86: 3815-3819, 2001.[Abstract/Free Full Text]
  41. Zhao Y, Nichols JE, Bulun SE, Mendelson CR, and Simpson ER. Aromatase P450 gene expression in human adipose tissue. Role of a Jak/STAT pathway in regulation of the adiposespecific promoter. J Biol Chem 270: 16449-16457, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JAMAHome page
S. Li, H. J. Shin, E. L. Ding, and R. M. van Dam
Adiponectin Levels and Risk of Type 2 Diabetes: A Systematic Review and Meta-analysis
JAMA, July 8, 2009; 302(2): 179 - 188.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
H. K. Neilson, C. M. Friedenreich, N. T. Brockton, and R. C. Millikan
Physical Activity and Postmenopausal Breast Cancer: Proposed Biologic Mechanisms and Areas for Future Research
Cancer Epidemiol. Biomarkers Prev., January 1, 2009; 18(1): 11 - 27.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
F M E Franssen, D E O'Donnell, G H Goossens, E E Blaak, and A M W J Schols
Obesity and the lung: 5 {middle dot} Obesity and COPD
Thorax, December 1, 2008; 63(12): 1110 - 1117.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. J. Puglisi and M. L. Fernandez
Modulation of C-Reactive Protein, Tumor Necrosis Factor-{alpha}, and Adiponectin by Diet, Exercise, and Weight Loss
J. Nutr., December 1, 2008; 138(12): 2293 - 2296.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
A Sood, X Cui, C Qualls, W S Beckett, M D Gross, M W Steffes, L J Smith, and D R Jacobs Jr
Association between asthma and serum adiponectin concentration in women
Thorax, October 1, 2008; 63(10): 877 - 882.
[Abstract] [Full Text] [PDF]


Home page
ANN INTERN MEDHome page
C. Heidemann, Q. Sun, R. M. van Dam, J. B. Meigs, C. Zhang, S. S. Tworoger, C. S. Mantzoros, and F. B. Hu
Total and High-Molecular-Weight Adiponectin and Resistin in Relation to the Risk for Type 2 Diabetes in Women
Ann Intern Med, September 2, 2008; 149(5): 307 - 316.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
T. Tholstrup, M. Raff, E. M. Straarup, P. Lund, S. Basu, and J. M. Bruun
An Oil Mixture with Trans-10, Cis-12 Conjugated Linoleic Acid Increases Markers of Inflammation and in Vivo Lipid Peroxidation Compared with Cis-9, Trans-11 Conjugated Linoleic Acid in Postmenopausal Women
J. Nutr., August 1, 2008; 138(8): 1445 - 1451.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
E. L Madsen, A. Rissanen, J. M Bruun, K. Skogstrand, S. Tonstad, D. M Hougaard, and B. Richelsen
Weight loss larger than 10% is needed for general improvement of levels of circulating adiponectin and markers of inflammation in obese subjects: a 3-year weight loss study
Eur. J. Endocrinol., February 1, 2008; 158(2): 179 - 187.
[Abstract] [Full Text] [PDF]


Home page
Nutr Clin PractHome page
M. C. Cave, R. T. Hurt, T. H. Frazier, P. J. Matheson, R. N. Garrison, C. J. McClain, and S. A. McClave
Obesity, Inflammation, and the Potential Application of Pharmaconutrition
Nutr Clin Pract, February 1, 2008; 23(1): 16 - 34.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. E. Spurlock and N. K. Gabler
The Development of Porcine Models of Obesity and the Metabolic Syndrome
J. Nutr., February 1, 2008; 138(2): 397 - 402.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
L. Hojbjerre, M. Rosenzweig, F. Dela, J. M Bruun, and B. Stallknecht
Acute exercise increases adipose tissue interstitial adiponectin concentration in healthy overweight and lean subjects
Eur. J. Endocrinol., November 1, 2007; 157(5): 613 - 623.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S. Ahmadizad, A. H. Haghighi, and M. R. Hamedinia
Effects of resistance versus endurance training on serum adiponectin and insulin resistance index
Eur. J. Endocrinol., November 1, 2007; 157(5): 625 - 631.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S.-A. Lee, A. Kallianpur, Y.-B. Xiang, W. Wen, Q. Cai, D. Liu, S. Fazio, M. F. Linton, W. Zheng, and X. O. Shu
Intra-individual Variation of Plasma Adipokine Levels and Utility of Single Measurement of These Biomarkers in Population-Based Studies
Cancer Epidemiol. Biomarkers Prev., November 1, 2007; 16(11): 2464 - 2470.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. F. Bodary
Links Between Adipose Tissue and Thrombosis in the Mouse
Arterioscler Thromb Vasc Biol, November 1, 2007; 27(11): 2284 - 2291.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. S. Johnston, B. L. Beezhold, B. Mostow, and P. D. Swan
Plasma Vitamin C Is Inversely Related to Body Mass Index and Waist Circumference but Not to Plasma Adiponectin in Nonsmoking Adults
J. Nutr., July 1, 2007; 137(7): 1757 - 1762.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
L. A. Barbour, C. E. McCurdy, T. L. Hernandez, J. P. Kirwan, P. M. Catalano, and J. E. Friedman
Cellular Mechanisms for Insulin Resistance in Normal Pregnancy and Gestational Diabetes
Diabetes Care, July 1, 2007; 30(Supplement_2): S112 - S119.
[Full Text] [PDF]


Home page
Eur Heart JHome page
M. B. McEntegart, B. Awede, M. C. Petrie, N. Sattar, F. G. Dunn, N. G. MacFarlane, and J. J.V. McMurray
Increase in serum adiponectin concentration in patients with heart failure and cachexia: relationship with leptin, other cytokines, and B-type natriuretic peptide
Eur. Heart J., April 2, 2007; (2007) ehm033v1.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
C. Popa, M. G. Netea, P. L. C. M. van Riel, J. W. M. van der Meer, and A. F. H. Stalenhoef
The role of TNF-{alpha} in chronic inflammatory conditions, intermediary metabolism, and cardiovascular risk
J. Lipid Res., April 1, 2007; 48(4): 751 - 762.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
E. E. Spangenburg, S. E. Shoelson, C. Weigert, R. Lehmann, E. D. Schleicher, J.-O. Jansson, V. Wallenius, J.-P. Bastard, C. Lagathu, M. Caron, et al.
Interleukin-6 does/does not have a beneficial role in insulin sensitivity and glucose homeostasis
J Appl Physiol, February 1, 2007; 102(2): 820 - 823.
[Full Text] [PDF]


Home page
J EndocrinolHome page
P. J Simons, P. S van den Pangaart, J. M F G Aerts, and L. Boon
Pro-inflammatory delipidizing cytokines reduce adiponectin secretion from human adipocytes without affecting adiponectin oligomerization
J. Endocrinol., February 1, 2007; 192(2): 289 - 299.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
G. A Martos-Moreno, V. Barrios, L. Soriano-Guillen, and J. Argente
Relationship between adiponectin levels, acylated ghrelin levels, and short-term body mass index changes in children with diabetes mellitus type 1 at diagnosis and after insulin therapy.
Eur. J. Endocrinol., November 1, 2006; 155(5): 757 - 761.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
E. P Weiss, S. B Racette, D. T Villareal, L. Fontana, K. Steger-May, K. B Schechtman, S. Klein, J. O Holloszy, and and the Washington University School of Medicine C
Improvements in glucose tolerance and insulin action induced by increasing energy expenditure or decreasing energy intake: a randomized controlled trial.
Am. J. Clinical Nutrition, November 1, 2006; 84(5): 1033 - 1042.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
C. Herder, H. Hauner, B. Haastert, K. Rohrig, W. Koenig, H. Kolb, S. Muller-Scholze, B. Thorand, R. Holle, and W. Rathmann
Hypoadiponectinemia and Proinflammatory State: Two Sides of the Same Coin?: Results From the Cooperative Health Research in the Region of Augsburg Survey 4 (KORA S4)
Diabetes Care, July 1, 2006; 29(7): 1626 - 1631.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. M. Bruun, J. W. Helge, B. Richelsen, and B. Stallknecht
Diet and exercise reduce low-grade inflammation and macrophage infiltration in adipose tissue but not in skeletal muscle in severely obese subjects
Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E961 - E967.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
A. S Greenberg and M. S Obin
Obesity and the role of adipose tissue in inflammation and metabolism
Am. J. Clinical Nutrition, February 1, 2006; 83(2): 461S - 465S.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
F. Haugen, T. Ranheim, N. K. Harsem, E. Lips, A. C. Staff, and C. A. Drevon
Increased plasma levels of adipokines in preeclampsia: relationship to placenta and adipose tissue gene expression
Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E326 - E333.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. A. Nordstrom, M. Ryden, E. C. Backlund, I. Dahlman, M. Kaaman, L. Blomqvist, B. Cannon, J. Nedergaard, and P. Arner
A Human-Specific Role of Cell Death-Inducing DFFA (DNA Fragmentation Factor-{alpha})-Like Effector A (CIDEA) in Adipocyte Lipolysis and Obesity
Diabetes, June 1, 2005; 54(6): 1726 - 1734.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y.-H. Yu and H. N. Ginsberg
Adipocyte Signaling and Lipid Homeostasis: Sequelae of Insulin-Resistant Adipose Tissue
Circ. Res., May 27, 2005; 96(10): 1042 - 1052.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. W.K. Ng, G. F. Watts, M. S. Farvid, D. C. Chan, and P. H. R. Barrett
Adipocytokines and VLDL Metabolism: Independent Regulatory Effects of Adiponectin, Insulin Resistance, and Fat Compartments on VLDL Apolipoprotein B-100 Kinetics?
Diabetes, March 1, 2005; 54(3): 795 - 802.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A M Diehl, Z P Li, H Z Lin, and S Q Yang
Cytokines and the pathogenesis of non-alcoholic steatohepatitis
Gut, February 1, 2005; 54(2): 303 - 306.
[Full Text] [PDF]


Home page
CirculationHome page
L. B. Tanko, J. M. Bruun, P. Alexandersen, Y. Z. Bagger, B. Richelsen, C. Christiansen, and P. J. Larsen
Novel Associations Between Bioavailable Estradiol and Adipokines in Elderly Women With Different Phenotypes of Obesity: Implications for Atherogenesis
Circulation, October 12, 2004; 110(15): 2246 - 2252.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. Arvidsson, N. Viguerie, I. Andersson, C. Verdich, D. Langin, and P. Arner
Effects of Different Hypocaloric Diets on Protein Secretion From Adipose Tissue of Obese Women
Diabetes, August 1, 2004; 53(8): 1966 - 1971.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. M. Sharma
Is There a Rationale for Angiotensin Blockade in the Management of Obesity Hypertension?
Hypertension, July 1, 2004; 44(1): 12 - 19.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. G. Pittas, N. A. Joseph, and A. S. Greenberg
Adipocytokines and Insulin Resistance
J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 447 - 452.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Garaulet, N. Viguerie, S. Porubsky, E. Klimcakova, K. Clement, D. Langin, and V. Stich
Adiponectin Gene Expression and Plasma Values in Obese Women during Very-Low-Calorie Diet. Relationship with Cardiovascular Risk Factors and Insulin Resistance
J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 756 - 760.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
P. J. Havel
Update on Adipocyte Hormones: Regulation of Energy Balance and Carbohydrate/Lipid Metabolism
Diabetes, February 1, 2004; 53(90001): S143 - 151.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. S. Lihn, B. Richelsen, S. B. Pedersen, S. B. Haugaard, G. S. Rathje, S. Madsbad, and O. Andersen
Increased expression of TNF-{alpha}, IL-6, and IL-8 in HALS: implications for reduced adiponectin expression and plasma levels
Am J Physiol Endocrinol Metab, November 1, 2003; 285(5): E1072 - E1080.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/3/E527    most recent
00110.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (124)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.