|
|
||||||||
Department of Physiology and Internal Medicine, Wayne State University and John D. Dingell Veterans Affairs Medical Center, Detroit, Michigan 48201
Submitted 6 February 2003 ; accepted in final form 27 March 2003
| ABSTRACT |
|---|
|
|
|---|
cardiac myocyte; castration; testosterone; calcium channel; sodium/calcium exchanger
Normal cardiac function is dependent on proper calcium homeostasis. During
a cardiac action potential, the influx of calcium through L-type calcium
channels activates the release of calcium from the sarcoplasmic reticulum.
Relaxation occurs when the influx of calcium ceases and calcium is extruded
from the cytoplasm by the Na/Ca exchanger and sequestered in the sarcoplasmic
reticulum by the sarco(endo)plasmic reticulum calcium ATPase
(1-3).
Our laboratory has recently demonstrated that gonadectomy of male rats causes
a substantial reduction in the myocardial expression of genes encoding the
L-type calcium channel, Na/Ca exchanger, and
1-adrenergic
receptor (5). A reversal in the
levels of gene expression and cardiac hypertrophy occur after androgen
replacement. The goal of the present investigation is to determine whether
changes in gene expression of calcium homeostatic proteins in whole heart
after gonadectomy and androgen replacement result in functional changes of
isolated ventricular myocytes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Androgen replacement. Steroid capsules were prepared by cutting Silastic tubing (0.62 ID x 0.125 in. OD; Dow Corning, Midland, MI) in 15-mm lengths, sealing one end with Silastic adhesive and filling the capsule with testosterone propionate (Sigma Chemical, St. Louis, MO). The tubes were then sealed with Silastic adhesive. Immediately before implantation, capsules were rinsed using 70% ethanol and washed with sterile saline (9). For capsule implantation, a small lateral incision was made on the back of the neck. The skin was bluntly dissected to form a pocket where the Silastic capsule was inserted in three animals immediately after castration. Three castrated control males were implanted with empty Silastic capsules. After implantation (16 wk), the animals were weighed and killed. Blood samples were collected, and hearts were frozen on dry ice for subsequent analysis of mRNA levels. Serum testosterone levels were determined using a commercially available RIA kit (Coat A Count Total testosterone kit; Diagnostic Products). The assay can detect as little as 4 ng/dl. The assay has a broad working range where the coefficient of variation is low and uniform. There were no differences in body weights among groups (data not shown).
Cell isolation procedures. Single ventricular myocytes were enzymatically isolated from three animals in each group (6). Briefly, hearts were removed rapidly and perfused (at 37°C) with Krebs-Henseleit bicarbonate (KHB) buffer containing (in mM) 118 NaCl, 4.7 KCl, 1.25 CaCl2, 1.2 MgSO4, 1.2 KH2PO4, 25 NaHCO3, 10 HEPES, and 11.1 glucose. The KHB was equilibrated with 5% CO2-95% O2. Hearts were subsequently perfused with a nominally calcium-free KHB buffer for 2-3 min until spontaneous contractions ceased. This was followed by a 20-min perfusion with calcium-free KHB containing 223 U/ml collagenase (Worthington Biochemical, Freehold, NJ) and 0.1 mg/ml hyaluronidase (Sigma Chemical). After perfusion, ventricles were removed and minced, under sterile conditions, and incubated with the above enzymatic solution for 3-5 min. The cells were further digested with 0.02 mg/ml trypsin (Sigma) before being filtered through a nylon mesh (300 µm) and subsequently separated from the enzymatic solution by centrifugation (60 g for 30 s). Myocytes were resuspended in a sterile filtered, calcium-free Tyrode buffer that contained (in mM) 131 NaCl, 4 KCl, 1 MgCl2, 10 HEPES, and 10 glucose, was supplemented with 2% BSA, and had a pH of 7.4 at 37°C. Cells were initially washed with calcium-free Tyrode buffer to remove remnant enzyme, and extracellular calcium was added incrementally back to 1.25 mM. Myocytes with obvious sarcolemmal blebs or spontaneous contractions were not used. After myocyte isolation, cells were divided into two groups. One group of myocytes was used to analyze gene expression of calcium regulatory proteins (see below), whereas only rod-shaped myocytes with clear edges from the remaining group were selected for recording of mechanical properties.
Real-time quantitative PCR. Total RNA was extracted from isolated
rat ventricular myocytes with guanidium thiocyanate-phenol-chloroform by the
single-step method, as previously described
(6). Real-time quantitative
RT-PCR was performed on cDNA generated from 300 ng of total RNA using murine
Moloney leukemia virus RT (Invitrogen) and random hexamers
(6). For the PCR, we used 200
nM of both sense and antisense primers (Genset), 30 ng cDNA and SYBR Green PCR
Master Mix (PE Applied Biosystems) in a final volume of 25 µl, and a ABI
PRISM 7700 Sequence Detection System (PE Applied Biosystems). Sense and
anti-sense primers were GATGGGATCATGGCTTATGG and GGCCAGCTTCTTTCTCTCCT for the
1c-subunit of the L-type calcium channel [dihydropyridine
(DHP) receptor]; GTTCGTCGATTGCTGCATTA and ATTTCCCTCACACCTTGCTG for the Na/Ca
exchanger, and CGGCTACCACATCCAAGGAA and GCTCGAATTACCGCGGCT for 18S.
Fluorescent signals were normalized to an internal reference, and the
threshold cycle (Ct) was set within the exponential phase of the
PCR. The relative gene expression was calculated by comparing cycle times for
each target PCR. The target PCR Ct values are normalized by
subtracting the 18S Ct value, which gives the
Ct
value. From this value the relative expression level to 18S for each target
PCR can be calculated using the following equation: relative gene expression =
2-
Ct.
Cell shortening/relengthening. Mechanical properties of
ventricular myocytes were assessed using a SoftEdge video-based edge-detection
system (IonOptix, Milton, MA; see Ref.
6). In brief, cells were placed
in a Warner chamber mounted on the stage of an inverted microscope (IX-70;
Olympus) and superfused (
1 ml/min at 37°C) with a buffer containing
(in mM) 131 NaCl, 4 KCl, 1 CaCl2, 1 MgCl2, 10 glucose,
and 10 HEPES (pH 7.4). The cells were field stimulated with suprathreshold
voltage at a frequency of 0.5 Hz and 3-ms duration, using a pair of platinum
wires placed on opposite sides of the chamber connected to an FHC (Brunswick,
NE) stimulator. The myocyte being studied was displayed on the computer
monitor using an IonOptix MyoCam camera. Soft-Edge software (IonOptix) was
used to capture changes in cell length during shortening and
relengthening.
Data analysis. For data presented in Figs. 1A and 3B, differences between variables were analyzed by the nonparametric Kruskal-Wallis one-way ANOVA. For data presented in Figs. 1B, 2, and 3C, t-tests were conducted. Data are shown as means ± SE.
|
|
|
| RESULTS |
|---|
|
|
|---|
Figure 1A shows
mRNA levels for the
1c-subunit of the L-type calcium channel
(DHP receptor) in ventricular myocytes isolated from intact animals and
castrates treated with and without testosterone. Castration produced a 50%
decline in DHP receptor expression levels compared with intact controls.
Testosterone supplementation to castrates completely restored DHP receptor
mRNA levels. To determine whether changes in DHP receptor gene expression
resulted in functional changes, we examined cell shortening and relengthening
properties. There was no significant difference in myocyte resting length
among groups (data not shown). Peak shortening (normalized to cell length) in
response to electrical stimulation is shown in
Fig. 1B. There was a
14% decrease in peak shortening in myocytes isolated from castrated animals
compared with intact controls, which was not statistically significant. Peak
shortening of myocytes isolated from castrates supplemented with testosterone
was similar to that of intact controls. Although there was no significant
difference in peak shortening among groups, castration increased myocyte time
to peak shortening by 16% (P < 0.05), which was reversed with
testosterone administration (Fig.
2).
In addition to the prolonged time to peak shortening, myocytes isolated from castrated animals also displayed an increased time to 90% relengthening compared with intact controls (208 ± 4.10 vs. 170 ± 4.40 ms, P < 0.001; Fig. 3B). Testosterone administration to castrates reversed this effect. The increase in time to relengthening in castrates was associated with a decrease in Na/Ca exchanger gene expression (Fig. 3A).
| DISCUSSION |
|---|
|
|
|---|
The
1c-subunit (DHP receptor) is the pore-forming subunit
of the L-type calcium channel that determines ion selectivity and voltage
sensitivity and provides the binding sites for all of the clinically used
calcium channel blockers (15).
Consistent with our previously published results, castration reduced DHP
receptor mRNA levels, whereas testosterone replacement blocked this effect
(5). The decrease in DHP
receptor gene expression is associated with a slight decline in cell
shortening and a significant increase in the time to peak shortening, which
are restored with testosterone treatment. Reduced expression of the L-type
calcium channel along with a decrease in myosin ATPase activity may contribute
to the observed reduction in left ventricular contractility in gonadectomized
male rats reported by Scheuer et al.
(23). Work from the laboratory
of Liu et al. (15) has shown
that the 5'-untranslated region of the gene encoding the
1c-subunit of the L-type calcium channel contains a
consensus hormone replacement element. When cardiac myocytes are transfected
with a reporter gene construct containing the 5'-flanking region of the
calcium channel
1c-gene, there is a marked increase in
reporter gene expression after testosterone treatment. Thus a reduction in
L-type calcium channel expression after castration may involve a lack of
interaction between hormone-bound androgen receptor (AR) and regulatory
sequences within the promoter region of the L-type calcium channel. Our
results are consistent with those of Koenig et al.
(11), who demonstrated that
androgen treatment of rat cardiac myocytes augments calcium flux across the
sarcolemma. Although we did not measure calcium current or calcium transients,
it is probable that the higher intracellular calcium transients reported in
cardiac myocytes isolated from males vs. females is the result of the presence
of testosterone (4).
Myocardial relaxation occurs when calcium is extruded from the cytoplasm by the Na/Ca exchanger and sequestered in the sarcoplasmic reticulum (3). Here we provide the first evidence that gonadectomy and androgen replacement regulate the expression of the Na/Ca exchanger. Consistent with a decline in Na/Ca exchanger functional expression, isolated myocytes from the same animals displayed an increase in the time to relengthening. Attenuated functional expression of the Na/Ca exchanger in isolated ventricular myocytes may contribute to the observed decrease in the rate of myocardial relaxation in gonadectomized animals reported by Scheuer et al. (23). Consistent with this hypothesis, Hintz el al. (8) showed that cardiac myocytes isolated from gonadectomized animals display a prolonged time to relaxation and a slowed calcium transient decay rate compared with cardiac myocytes isolated from sham-operated controls. The specific transcriptional processes by which testosterone regulates Na/Ca exchanger expression are unclear. The cardiac promoter for the Na/Ca exchanger contains several putative binding sites for a number of transcription factors (19). Gonadectomy and testosterone replacement-induced alterations in Na/Ca exchanger gene expression are likely via complex protein-protein interactions involving AR and a number of cis- and trans-acting factors (16).
Altered circulating testosterone levels occur frequently under physiological and pathophysiological conditions in human males. In addition to the dramatic fall in androgens that occurs in males after gonadectomy as part of treatment for some tumors, a substantial fall in plasma androgen concentration occurs as a part of the normal male aging process. Furthermore, advancing age is associated with the development of myocardial hypertrophy and slower contraction times (12, 24). A reduction in serum testosterone levels may contribute to the observed changes in myocardial structure and function. Interestingly, our studies suggest that only a small amount of circulating testosterone is required to modulate cardiac performance. Clearly, more detailed time-course and dose-response studies are needed to further characterize androgenic action on contractile function. Nevertheless, testosterone replacement therapy in older males has gained considerable attention over the past several years as a means to prevent or reverse aging in the male. However, solid clinical and scientific information regarding the effects of testosterone replacement therapy on modulating cardiac function in older males is lacking. Results from the current study shed some light into the potential role of androgens as cardioregulatory hormones in males. Further examination of the effects of androgen treatment for hypogonadism on cardiac function is needed to design appropriate therapeutic androgenic agents for treating older males. Ideally, these agents will have beneficial effects on cardiac function and other biological systems without having detrimental effects on other organs, such as the prostate.
In summary, we have provided the first evidence that castration and testosterone replacement alter expression of calcium regulatory proteins and contractile properties of isolated rat ventricular myocytes. Because testosterone can be aromatized to estrogen, the possibility that endogenous differences in estrogen may contribute to our observed findings cannot be excluded. Additional studies are needed to determine whether androgens influence calcium sensitivity and/or the expression of other important calcium-regulating proteins, including the calcium release channel and the sarcoplasmic reticulum calcium pump. Furthermore, the extent to which functional alterations and changes in the levels of gene expression in response to castration and androgen replacement are the result of direct signaling via myocyte androgen receptors to modified hemodynamics or to other changes in the hormonal milieu warrants further investigation (18). Nevertheless, the ability of testosterone to regulate gene expression and contractile properties of ventricular myocytes may underlie some of the observed sex differences in cardiac function.
| DISCLOSURES |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Tsang, S. S. C. Wong, S. Wu, G. M. Kravtsov, and T.-M. Wong Testosterone-augmented contractile responses to {alpha}1- and {beta}1-adrenoceptor stimulation are associated with increased activities of RyR, SERCA, and NCX in the heart Am J Physiol Cell Physiol, April 1, 2009; 296(4): C766 - C782. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sacca Heart Failure as a Multiple Hormonal Deficiency Syndrome Circ Heart Fail, March 1, 2009; 2(2): 151 - 156. [Full Text] [PDF] |
||||
![]() |
D. S. Hydock, C.-Y. Lien, C. M. Schneider, and R. Hayward Effects of voluntary wheel running on cardiac function and myosin heavy chain in chemically gonadectomized rats Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3254 - H3264. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L Golden, J. D Marsh, Y. Jiang, and J. Moulden Acute actions of testosterone on contractile function of isolated rat ventricular myocytes Eur. J. Endocrinol., March 1, 2005; 152(3): 479 - 483. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Bowles, K. K. Maddali, V. K. Ganjam, L. J. Rubin, D. L. Tharp, J. R. Turk, and C. L. Heaps Endogenous testosterone increases L-type Ca2+ channel expression in porcine coronary smooth muscle Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2091 - H2098. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |