AJP - Endo Journal of Neurophysiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 285: E449-E453, 2003. First published April 8, 2003; doi:10.1152/ajpendo.00054.2003
0193-1849/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/3/E449    most recent
00054.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (29)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Golden, K. L.
Right arrow Articles by Moulden, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Golden, K. L.
Right arrow Articles by Moulden, J.

Gonadectomy of adult male rats reduces contractility of isolated cardiac myocytes

Kish L. Golden, James D. Marsh, Yang Jiang, Tiane Brown, and Jerome Moulden

Department of Physiology and Internal Medicine, Wayne State University and John D. Dingell Veterans Affairs Medical Center, Detroit, Michigan 48201

Submitted 6 February 2003 ; accepted in final form 27 March 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Sex-related differences in cardiac function have been well documented. The extent to which sex hormones are responsible for these differences is unclear. The current study was designed to determine whether castration and androgen replacement resulted in changes in functional expression of genes encoding the L-type calcium channel and Na/Ca exchanger in isolated rat ventricular myocytes. Sixteen weeks of castration produced a 50% decline in dihydropyridine receptor expression levels and a 16% (P < 0.05) increase in time to peak shortening. Furthermore, cardiac myocytes isolated from castrated animals also displayed an 18% (P < 0.001) increase in time to relengthening and an 80% decrease in Na/Ca exchanger gene expression when compared with intact controls. Testosterone treatment of castrated animals completely reversed these effects. These results provide the first evidence that androgens regulate functional expression of the L-type calcium channel and the Na/Ca exchanger in isolated rat ventricular myocytes and thus may play a role in modulating cardiac performance in males and thereby contribute to the observed gender differences in cardiac function.

cardiac myocyte; castration; testosterone; calcium channel; sodium/calcium exchanger


CLINICAL STUDIES DEMONSTRATE sex disparities in the heart. In addition to the noted sex differences in cardiac dimensions, studies show than women have higher mortality rates postmyocardial infarction and exhibit greater diastolic heart failure when compared with men (10). Other reports demonstrate lower systolic function and greater diastolic compliance in males vs. females (7). Sex variances in cardiac excitation-contraction coupling occur after puberty, suggesting that steroid hormones may play a role in sex differences in cardiac function (14). Studies examining the influence of steroid hormones on cardiac function are limited. Using heart isolation perfusion studies, Scheuer et al. (23) demonstrated that gonadectomy of male and female rats attenuates cardiac performance. Improvement of cardiac performance was achieved with hormone replacement therapy, suggesting that sex hormones regulate cardiac performance. Thus a reduction in circulating sex hormones as a result of therapeutic interventions or as part of the normal aging process may have adverse effects on cardiac performance.

Normal cardiac function is dependent on proper calcium homeostasis. During a cardiac action potential, the influx of calcium through L-type calcium channels activates the release of calcium from the sarcoplasmic reticulum. Relaxation occurs when the influx of calcium ceases and calcium is extruded from the cytoplasm by the Na/Ca exchanger and sequestered in the sarcoplasmic reticulum by the sarco(endo)plasmic reticulum calcium ATPase (1-3). Our laboratory has recently demonstrated that gonadectomy of male rats causes a substantial reduction in the myocardial expression of genes encoding the L-type calcium channel, Na/Ca exchanger, and {beta}1-adrenergic receptor (5). A reversal in the levels of gene expression and cardiac hypertrophy occur after androgen replacement. The goal of the present investigation is to determine whether changes in gene expression of calcium homeostatic proteins in whole heart after gonadectomy and androgen replacement result in functional changes of isolated ventricular myocytes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Animal castration. The animal care committee at the Wayne State University School of Medicine approved this study. Age-matched 60-day-old male Sprague-Dawley rats were housed individually, fed and watered ad libitum, and maintained on a 12:12-h light-dark cycle at 23°C. Six rats were anesthetized, and the posterior tip of each scrotum was swabbed with alcohol and betadine solution. A small incision was made in the posterior tip of each scrotum sac. The spermatic cord was tied with 4.0 silk suture, and the testes were removed. The incision was closed with 4.0 silk sutures, and the animal was allowed to recover. Three intact animals were sham operated.

Androgen replacement. Steroid capsules were prepared by cutting Silastic tubing (0.62 ID x 0.125 in. OD; Dow Corning, Midland, MI) in 15-mm lengths, sealing one end with Silastic adhesive and filling the capsule with testosterone propionate (Sigma Chemical, St. Louis, MO). The tubes were then sealed with Silastic adhesive. Immediately before implantation, capsules were rinsed using 70% ethanol and washed with sterile saline (9). For capsule implantation, a small lateral incision was made on the back of the neck. The skin was bluntly dissected to form a pocket where the Silastic capsule was inserted in three animals immediately after castration. Three castrated control males were implanted with empty Silastic capsules. After implantation (16 wk), the animals were weighed and killed. Blood samples were collected, and hearts were frozen on dry ice for subsequent analysis of mRNA levels. Serum testosterone levels were determined using a commercially available RIA kit (Coat A Count Total testosterone kit; Diagnostic Products). The assay can detect as little as 4 ng/dl. The assay has a broad working range where the coefficient of variation is low and uniform. There were no differences in body weights among groups (data not shown).

Cell isolation procedures. Single ventricular myocytes were enzymatically isolated from three animals in each group (6). Briefly, hearts were removed rapidly and perfused (at 37°C) with Krebs-Henseleit bicarbonate (KHB) buffer containing (in mM) 118 NaCl, 4.7 KCl, 1.25 CaCl2, 1.2 MgSO4, 1.2 KH2PO4, 25 NaHCO3, 10 HEPES, and 11.1 glucose. The KHB was equilibrated with 5% CO2-95% O2. Hearts were subsequently perfused with a nominally calcium-free KHB buffer for 2-3 min until spontaneous contractions ceased. This was followed by a 20-min perfusion with calcium-free KHB containing 223 U/ml collagenase (Worthington Biochemical, Freehold, NJ) and 0.1 mg/ml hyaluronidase (Sigma Chemical). After perfusion, ventricles were removed and minced, under sterile conditions, and incubated with the above enzymatic solution for 3-5 min. The cells were further digested with 0.02 mg/ml trypsin (Sigma) before being filtered through a nylon mesh (300 µm) and subsequently separated from the enzymatic solution by centrifugation (60 g for 30 s). Myocytes were resuspended in a sterile filtered, calcium-free Tyrode buffer that contained (in mM) 131 NaCl, 4 KCl, 1 MgCl2, 10 HEPES, and 10 glucose, was supplemented with 2% BSA, and had a pH of 7.4 at 37°C. Cells were initially washed with calcium-free Tyrode buffer to remove remnant enzyme, and extracellular calcium was added incrementally back to 1.25 mM. Myocytes with obvious sarcolemmal blebs or spontaneous contractions were not used. After myocyte isolation, cells were divided into two groups. One group of myocytes was used to analyze gene expression of calcium regulatory proteins (see below), whereas only rod-shaped myocytes with clear edges from the remaining group were selected for recording of mechanical properties.

Real-time quantitative PCR. Total RNA was extracted from isolated rat ventricular myocytes with guanidium thiocyanate-phenol-chloroform by the single-step method, as previously described (6). Real-time quantitative RT-PCR was performed on cDNA generated from 300 ng of total RNA using murine Moloney leukemia virus RT (Invitrogen) and random hexamers (6). For the PCR, we used 200 nM of both sense and antisense primers (Genset), 30 ng cDNA and SYBR Green PCR Master Mix (PE Applied Biosystems) in a final volume of 25 µl, and a ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems). Sense and anti-sense primers were GATGGGATCATGGCTTATGG and GGCCAGCTTCTTTCTCTCCT for the {alpha}1c-subunit of the L-type calcium channel [dihydropyridine (DHP) receptor]; GTTCGTCGATTGCTGCATTA and ATTTCCCTCACACCTTGCTG for the Na/Ca exchanger, and CGGCTACCACATCCAAGGAA and GCTCGAATTACCGCGGCT for 18S. Fluorescent signals were normalized to an internal reference, and the threshold cycle (Ct) was set within the exponential phase of the PCR. The relative gene expression was calculated by comparing cycle times for each target PCR. The target PCR Ct values are normalized by subtracting the 18S Ct value, which gives the {Delta}Ct value. From this value the relative expression level to 18S for each target PCR can be calculated using the following equation: relative gene expression = 2-{Delta}Ct.

Cell shortening/relengthening. Mechanical properties of ventricular myocytes were assessed using a SoftEdge video-based edge-detection system (IonOptix, Milton, MA; see Ref. 6). In brief, cells were placed in a Warner chamber mounted on the stage of an inverted microscope (IX-70; Olympus) and superfused (~1 ml/min at 37°C) with a buffer containing (in mM) 131 NaCl, 4 KCl, 1 CaCl2, 1 MgCl2, 10 glucose, and 10 HEPES (pH 7.4). The cells were field stimulated with suprathreshold voltage at a frequency of 0.5 Hz and 3-ms duration, using a pair of platinum wires placed on opposite sides of the chamber connected to an FHC (Brunswick, NE) stimulator. The myocyte being studied was displayed on the computer monitor using an IonOptix MyoCam camera. Soft-Edge software (IonOptix) was used to capture changes in cell length during shortening and relengthening.

Data analysis. For data presented in Figs. 1A and 3B, differences between variables were analyzed by the nonparametric Kruskal-Wallis one-way ANOVA. For data presented in Figs. 1B, 2, and 3C, t-tests were conducted. Data are shown as means ± SE.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. A: relative quantity of dihydropyridine (DHP) receptor (DHPr; {alpha}1c-subunit of L-type calcium channel) mRNA levels in isolated ventricular myocytes isolated from intact and castrated animals treated with (cast+T) and without (Cast) testosterone for 16 wk (see MATERIALS AND METHODS). SE bars are too small to be visible. B: bar graph exhibiting effects of castration and androgen replacement on cell peak shortening. n = 47-55 experiments/group.

 


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. A: relative quantity of Na/Ca exchanger mRNA levels in isolated ventricular myocytes isolated from intact and castrated animals treated with (cast+T) and without (Cast) testosterone for 16 wk (see MATERIALS AND METHODS). SE bars are too small to be visible. B: bar graph exhibiting effects of castration and androgen replacement on ventricular myocyte time to 90% relengthening (TR90). P < 0.05 vs. intact (a) and vs. castrates (b); n = 47-55/group. Both nonparametric and parametric Mann-Whitney t-tests were conducted, which generated similar statistical results. P values from the parametric t-test are presented.

 


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 2. Effects of castration (Cast) and androgen replacement (cast+T) on time to peak shortening (TPS) of isolated rat ventricular myocytes. Animals were treated with and without testosterone for 16 wk (see MATERIALS AND METHODS). P < 0.05 vs. intact (a) and vs. castrates (b); n = 47-55/group. Both nonparametric and parametric Mann-Whitney t-tests were conducted, which generated similar statistical results. P values from the parametric t-test are presented.

 


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
After euthanasia, isolated ventricular myocytes from each group of animals were divided into two groups. One group of myocytes was employed for analysis of gene expression, whereas the remaining group was evaluated for possible changes in myocyte contractile properties. At euthanasia, serum testosterone levels were determined using an RIA. As expected, testosterone levels in gonadectomized animals were below detectable limits. Testosterone levels in intact and testosterone-treated gonadectomized animals were 2.1 ± 0.051 ng/ml and 265 ± 0.31 pg/ml, respectively.

Figure 1A shows mRNA levels for the {alpha}1c-subunit of the L-type calcium channel (DHP receptor) in ventricular myocytes isolated from intact animals and castrates treated with and without testosterone. Castration produced a 50% decline in DHP receptor expression levels compared with intact controls. Testosterone supplementation to castrates completely restored DHP receptor mRNA levels. To determine whether changes in DHP receptor gene expression resulted in functional changes, we examined cell shortening and relengthening properties. There was no significant difference in myocyte resting length among groups (data not shown). Peak shortening (normalized to cell length) in response to electrical stimulation is shown in Fig. 1B. There was a 14% decrease in peak shortening in myocytes isolated from castrated animals compared with intact controls, which was not statistically significant. Peak shortening of myocytes isolated from castrates supplemented with testosterone was similar to that of intact controls. Although there was no significant difference in peak shortening among groups, castration increased myocyte time to peak shortening by 16% (P < 0.05), which was reversed with testosterone administration (Fig. 2).

In addition to the prolonged time to peak shortening, myocytes isolated from castrated animals also displayed an increased time to 90% relengthening compared with intact controls (208 ± 4.10 vs. 170 ± 4.40 ms, P < 0.001; Fig. 3B). Testosterone administration to castrates reversed this effect. The increase in time to relengthening in castrates was associated with a decrease in Na/Ca exchanger gene expression (Fig. 3A).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
A number of studies imply that sex hormones may contribute to sex differences in cardiac function (13, 17, 20, 25). The importance of androgens as cardioregulatory hormones in males has not been elucidated completely. Published reports document a reduction in contractile performance after gonadectomy of male rats (22). Furthermore, androgens in males may contribute to gender-related differences in excitation-contraction coupling (21). Studies examining the effects of androgens on isolated ventricular myocytes are limited. Marsh et al. (18) were the first to show the presence of functional androgen receptors in isolated cardiac myocytes from several species. Furthermore, by employing both in vitro and in vivo models, it was shown that testosterone stimulates hypertrophy of cardiac myocytes via androgen receptor-dependent mechanisms (5, 18). In other studies, we demonstrated that testosterone treatment of gonadectomized male rats produces a profound increase in the expression of cardiac calcium regulatory proteins in whole heart (5). The current study was designed to determine whether these changes in gene expression of calcium homeostatic proteins resulted in functional changes of isolated ventricular myocytes.

The {alpha}1c-subunit (DHP receptor) is the pore-forming subunit of the L-type calcium channel that determines ion selectivity and voltage sensitivity and provides the binding sites for all of the clinically used calcium channel blockers (15). Consistent with our previously published results, castration reduced DHP receptor mRNA levels, whereas testosterone replacement blocked this effect (5). The decrease in DHP receptor gene expression is associated with a slight decline in cell shortening and a significant increase in the time to peak shortening, which are restored with testosterone treatment. Reduced expression of the L-type calcium channel along with a decrease in myosin ATPase activity may contribute to the observed reduction in left ventricular contractility in gonadectomized male rats reported by Scheuer et al. (23). Work from the laboratory of Liu et al. (15) has shown that the 5'-untranslated region of the gene encoding the {alpha}1c-subunit of the L-type calcium channel contains a consensus hormone replacement element. When cardiac myocytes are transfected with a reporter gene construct containing the 5'-flanking region of the calcium channel {alpha}1c-gene, there is a marked increase in reporter gene expression after testosterone treatment. Thus a reduction in L-type calcium channel expression after castration may involve a lack of interaction between hormone-bound androgen receptor (AR) and regulatory sequences within the promoter region of the L-type calcium channel. Our results are consistent with those of Koenig et al. (11), who demonstrated that androgen treatment of rat cardiac myocytes augments calcium flux across the sarcolemma. Although we did not measure calcium current or calcium transients, it is probable that the higher intracellular calcium transients reported in cardiac myocytes isolated from males vs. females is the result of the presence of testosterone (4).

Myocardial relaxation occurs when calcium is extruded from the cytoplasm by the Na/Ca exchanger and sequestered in the sarcoplasmic reticulum (3). Here we provide the first evidence that gonadectomy and androgen replacement regulate the expression of the Na/Ca exchanger. Consistent with a decline in Na/Ca exchanger functional expression, isolated myocytes from the same animals displayed an increase in the time to relengthening. Attenuated functional expression of the Na/Ca exchanger in isolated ventricular myocytes may contribute to the observed decrease in the rate of myocardial relaxation in gonadectomized animals reported by Scheuer et al. (23). Consistent with this hypothesis, Hintz el al. (8) showed that cardiac myocytes isolated from gonadectomized animals display a prolonged time to relaxation and a slowed calcium transient decay rate compared with cardiac myocytes isolated from sham-operated controls. The specific transcriptional processes by which testosterone regulates Na/Ca exchanger expression are unclear. The cardiac promoter for the Na/Ca exchanger contains several putative binding sites for a number of transcription factors (19). Gonadectomy and testosterone replacement-induced alterations in Na/Ca exchanger gene expression are likely via complex protein-protein interactions involving AR and a number of cis- and trans-acting factors (16).

Altered circulating testosterone levels occur frequently under physiological and pathophysiological conditions in human males. In addition to the dramatic fall in androgens that occurs in males after gonadectomy as part of treatment for some tumors, a substantial fall in plasma androgen concentration occurs as a part of the normal male aging process. Furthermore, advancing age is associated with the development of myocardial hypertrophy and slower contraction times (12, 24). A reduction in serum testosterone levels may contribute to the observed changes in myocardial structure and function. Interestingly, our studies suggest that only a small amount of circulating testosterone is required to modulate cardiac performance. Clearly, more detailed time-course and dose-response studies are needed to further characterize androgenic action on contractile function. Nevertheless, testosterone replacement therapy in older males has gained considerable attention over the past several years as a means to prevent or reverse aging in the male. However, solid clinical and scientific information regarding the effects of testosterone replacement therapy on modulating cardiac function in older males is lacking. Results from the current study shed some light into the potential role of androgens as cardioregulatory hormones in males. Further examination of the effects of androgen treatment for hypogonadism on cardiac function is needed to design appropriate therapeutic androgenic agents for treating older males. Ideally, these agents will have beneficial effects on cardiac function and other biological systems without having detrimental effects on other organs, such as the prostate.

In summary, we have provided the first evidence that castration and testosterone replacement alter expression of calcium regulatory proteins and contractile properties of isolated rat ventricular myocytes. Because testosterone can be aromatized to estrogen, the possibility that endogenous differences in estrogen may contribute to our observed findings cannot be excluded. Additional studies are needed to determine whether androgens influence calcium sensitivity and/or the expression of other important calcium-regulating proteins, including the calcium release channel and the sarcoplasmic reticulum calcium pump. Furthermore, the extent to which functional alterations and changes in the levels of gene expression in response to castration and androgen replacement are the result of direct signaling via myocyte androgen receptors to modified hemodynamics or to other changes in the hormonal milieu warrants further investigation (18). Nevertheless, the ability of testosterone to regulate gene expression and contractile properties of ventricular myocytes may underlie some of the observed sex differences in cardiac function.


    DISCLOSURES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
K. L. Golden was supported by National Heart, Lung, and Blood Institute Grant K01-HL-04356.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. L. Golden, Wayne State Univ. School of Medicine, 421 E. Canfield Ave., Detroit, MI 48201 (E-mail: kgolden{at}med.wayne.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Bassani JW, Bassani RA, and Bers DM. Relaxation in rabbit and rat cardiac cells: species-dependent differences in cellular mechanisms. J Physiol 476: 279-293, 1994.[Abstract/Free Full Text]
  2. Bassani RA, Bassani JW, and Bers DM. Relaxation in ferret ventricular myocytes: unusual interplay among calcium transport systems. J Physiol 476: 295-308, 1994.[Abstract/Free Full Text]
  3. Bers DM. Cardiac excitation-contraction coupling. Nature 415: 198-205, 2002.[Medline]
  4. Curl CL, Wendt IR, and Kotsanas G. Effects of gender on intracellular [Ca2+] in rat cardiac myocytes. Pflügers Arch 441: 709-716, 2001.[Web of Science][Medline]
  5. Golden KL, Marsh JD, and Jiang Y. Castration reduces mRNA levels for calcium regulatory proteins in rat heart. Endocr J 19: 339-344, 2002.
  6. Golden KL, Fan QI, Chen B, Ren J, O'Connor J, and Marsh JD. Adrenergic stimulation regulates Na(+)/Ca(2+) exchanger expression in rat cardiac myocytes. J Mol Cell Cardiol 32: 611-620, 2000.[Web of Science][Medline]
  7. Hayward CS, Kalnins WV, and Kelly RP. Gender-related differences in left ventricular chamber function. Cardiovasc Res 49: 340-350, 2001.[Abstract/Free Full Text]
  8. Hintz KK, Wold LE, Colligan PB, Scott GI, Lee KJ, Sowers JR, and Ren J. Influence of ovariectomy on ventricular myocyte contraction in simulated diabetes. J Biomed Sci 8: 307-313, 2001.[Web of Science][Medline]
  9. Kalra PS, Simpkins JW, and Kalra SP. Hyperprolactinemia counteracts the testosterone-induced inhibition of the preoptic area dopamine turnover. Neuroendocrinology 33: 118-122, 1981.[Web of Science][Medline]
  10. Kimmelstiel CD and Konstam MA. Heart failure in women. Cardiology 86: 304-309, 1995.[Web of Science][Medline]
  11. Koenig H, Fan CC, Goldstone AD, Lu CY, and Trout JJ. Polyamines mediate androgenic stimulation of calcium fluxes and membrane transport in rat heart myocytes. Circ Res 64: 415-426, 1989.[Abstract/Free Full Text]
  12. Lakatta EG. Cardiovascular regulatory mechanisms in advanced age. Physiol Rev 73: 413-467, 1993.[Free Full Text]
  13. Lauer MS, Anderson KM, Larson MG, and Levy D. A new method for indexing left ventricular mass for differences in body size. Am J Cardiol 74: 487-491, 1994.[Web of Science][Medline]
  14. Leblanc N, Chartier D, Gosselin H, and Rouleau JL. Age and gender differences in excitation-contraction coupling of the rat ventricle. J Physiol 511: 533-548, 1998.[Abstract/Free Full Text]
  15. Liu L, Fan QI, El Zaru MR, Vanderpool K, Hines RN, and Marsh JD. Regulation of DHP receptor expression by elements in the 5'-flanking sequence. Am J Physiol Heart Circ Physiol 278: H1153-H1162, 2000.[Abstract/Free Full Text]
  16. Lobaccaro JM, Poujol N, Terouanne B, Georget V, Fabre S, Lumbroso S, and Sultan C. Transcriptional interferences between normal or mutant androgen receptors and the activator protein 1: dissection of the androgen receptor functional domains. Endocrinology 140: 350-357, 1999.[Abstract/Free Full Text]
  17. Luchner A, Brockel U, Muscholl M, Hense HW, Doring A, Riegger GA, and Schunkert H. Gender-specific differences of cardiac remodeling in subjects with left ventricular dysfunction: a population-based study. Cardiovasc Res 53: 720-727, 2002.[Abstract/Free Full Text]
  18. Marsh JD, Lehmann MH, Ritchie RH, Gwathmey JK, Green GE, and Schiebinger RJ. Androgen receptors mediate hypertrophy in cardiac myocytes. Circulation 98: 256-261, 1998.[Abstract/Free Full Text]
  19. Nicholas SB, Yang W, Lee SL, Zhu H, Philipson KD, and Lytton J. Alternative promoters and cardiac muscle cell-specific expression of the Na+/Ca2+ exchanger gene. Am J Physiol Heart Circ Physiol 274: H217-H232, 1998.[Abstract/Free Full Text]
  20. Olivetti G, Giordano G, Corradi D, Melissari M, Lagrasta C, Gambert SR, and Anversa P. Gender differences and aging: effects on the human heart. J Am Coll Cardiol 26: 1068-1079, 1995.[Abstract]
  21. Rosenkranz-Weiss P, Tomek RJ, Mathew J, and Eghbali M. Gender-specific differences in expression of mRNAs for functional and structural proteins in rat ventricular myocardium. J Mol Cell Cardiol 26: 261-270, 1994.[Web of Science][Medline]
  22. Schaible TF, Malhotra A, Ciambrone G, and Scheuer J. The effects of gonadectomy on left ventricular function and cardiac contractile proteins in male and female rats. Circ Res 54: 38-49, 1984.[Abstract/Free Full Text]
  23. Scheuer J, Malhotra A, Schaible TF, and Capasso J. Effects of gonadectomy and hormonal replacement on rat hearts. Circ Res 61: 12-19, 1987.[Abstract/Free Full Text]
  24. Swynghedauw B, Besse S, Assayag P, Carre F, Chevalier B, Charlemagne D, Delcayre C, Hardouin S, Heymes C, and Moalic JM. Molecular and cellular biology of the senescent hypertrophied and failing heart. Am J Cardiol 76: 2D-7D, 1995.[Medline]
  25. Vasan RS, Larson MG, Levy D, Evans JC, and Benjamin EJ. Distribution and categorization of echocardiographic measurements in relation to reference limits: the Framingham Heart Study: formulation of a height- and sex-specific classification and its prospective validation. Circulation 96: 1863-1873, 1997.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Tsang, S. S. C. Wong, S. Wu, G. M. Kravtsov, and T.-M. Wong
Testosterone-augmented contractile responses to {alpha}1- and {beta}1-adrenoceptor stimulation are associated with increased activities of RyR, SERCA, and NCX in the heart
Am J Physiol Cell Physiol, April 1, 2009; 296(4): C766 - C782.
[Abstract] [Full Text] [PDF]


Home page
Circ Heart FailHome page
L. Sacca
Heart Failure as a Multiple Hormonal Deficiency Syndrome
Circ Heart Fail, March 1, 2009; 2(2): 151 - 156.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. S. Hydock, C.-Y. Lien, C. M. Schneider, and R. Hayward
Effects of voluntary wheel running on cardiac function and myosin heavy chain in chemically gonadectomized rats
Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3254 - H3264.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
K. L Golden, J. D Marsh, Y. Jiang, and J. Moulden
Acute actions of testosterone on contractile function of isolated rat ventricular myocytes
Eur. J. Endocrinol., March 1, 2005; 152(3): 479 - 483.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. K. Bowles, K. K. Maddali, V. K. Ganjam, L. J. Rubin, D. L. Tharp, J. R. Turk, and C. L. Heaps
Endogenous testosterone increases L-type Ca2+ channel expression in porcine coronary smooth muscle
Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2091 - H2098.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/3/E449    most recent
00054.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (29)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Golden, K. L.
Right arrow Articles by Moulden, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Golden, K. L.
Right arrow Articles by Moulden, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.