|
|
||||||||
1Diabetes Research Laboratory, Winthrop University Hospital, Mineola, New York 11501; 3School of Medicine, State University of New York at Stony Brook, Stony Brook, New York 11794, and 2Department Of Biology, York University, Ontario, Canada M3J 1P3
Submitted 23 October 2002 ; accepted in final form 24 February 2003
| ABSTRACT |
|---|
|
|
|---|
, one of the downstream targets of PI 3-kinase and p38 MAPK phosphorylation, was also not affected by resistin. Expression of resistin also inhibited insulin-stimulated 2-DG uptake when compared with cells expressing the empty vector (L6Neo) without affecting GLUT4 translocation, GLUT1 content, and IRS-1/PI 3-kinase signaling. We conclude that resistin does not alter IR signaling but does affect insulin-stimulated glucose uptake, presumably by decreasing the intrinsic activity of cell surface glucose transporters. skeletal muscle; glucose transporter-4
agonists (TZDs) suppressed resistin expression in 3T3-L1 adipocytes and in the white adipose tissue of mice fed a high-fat diet (26). These studies suggested that suppression of resistin expression by PPAR
agonists (TZDs) might explain the beneficial effects of these compounds in insulin-resistant states. In contrast, there have been many reports that argue against the role of resistin in insulin resistance (4, 1213). Studies by Way et al. (33) reported reduced resistin mRNA levels in white adipose tissue of several obese rodent models. Furthermore, treating these animals with TZDs increased resistin mRNA expression in white adipose tissue (33). Another study in human subjects indicates that, although resistin expression in adipose tissue from morbidly obese subjects is increased in comparison with lean subjects, there is no correlation between body mass index (BMI) and resistin expression per se (19). However, a recent human study with type 2 diabetic Caucasian subjects suggests that noncoding sequence variation in the resistin gene may alter the interaction of BMI and insulin sensitivity index in nondiabetic members of familial type 2 diabetes (30). Recent in vivo studies in rats indicate that infusion of adipose tissue-derived and gut-derived resistin-like molecule-
markedly increased glucose production by liver and thereby modulated hepatic insulin action (15). Thus resistin may play an important role in insulin sensitivity modulation. To clearly understand the direct biological effect of resistin on skeletal muscle glucose metabolism, we incubated cultured rat L6 myotubes with recombinant resistin and also transfected myc-tagged resistin cDNA in L6 cells and examined the effect of chronic expression of resistin on insulin-stimulated glucose uptake and on the upstream insulin receptor (IR)-signaling components that mediate the metabolic effects of insulin.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Vector construction. Mouse resistin cDNA was obtained from Research Genetics (ID no. AA796548; GenBank). The full-length cDNA was amplified by PCR using the forward 5'-GGAAGCTTTCCTGCTAAGTCCTCTGCCA and reverse primer TGGGCCCGGAAGCGACCTGCAGCTTAC to create restriction sites. The PCR product was digested with both HindIII and ApaI and subcloned into the corresponding sites of pcDNA3.1/myc-His version A (Invitrogen). The clones containing insert were confirmed for the resistin cDNA sequence in frame with the COOH-terminal myc epitope by sequence analysis (Applied Biosystems).
Generation of myc-tagged resistin-expressing L6 cell lines. The spontaneously fusing rat skeletal muscle cell line, L6, and L6 cells transfected with myc-tagged GLUT4 (L6-GLUT4myc) were a kind gift from Dr. Amira Klip (The Hospital for Sick Children, Toronto). L6 myoblasts at second passage were transfected with plasmid encoding myc-tagged resistin cDNA according to our published protocol (14). Individual G418-resistant clones were tested for resistin expression by Western blot analysis using anti-myc antibody. Four resistin-expressing clones were selected and amplified. Transfection did not affect growth and differentiation of L6 cells, which was monitored by the analysis of the L6 differentiation marker myogenin and light microscopy (data not shown). A single clone (no. 42) expressing the highest amounts of myc-tagged resistin was amplified along with two other clones with moderate levels of myc-tagged resistin expression (nos. 43 and 49), and these were used for all the dose-response experiments. A single wild-type G418 clone isolated from L6 cells transfected with empty vector alone (L6 Neo control) served as a control. All of the four clones secreted resistin in the medium.
Expression of recombinant resistin in Escherichia coli. The mouse resistin cDNA encoding a peptide leader-deficient protein was subcloned in pRSET expression vector (Invitrogen) and used to transform host Escherichia coli [strain BL21(DE3)pLysS]. Synthesis of recombinant resistin was induced by isopropyl-
-D-thiogalactopyranoside (1 mM).
Purification of bacterial recombinant resistin from the inclusion bodies was performed as previously described (11). Briefly, the pellet was resuspended in buffer P containing PBS without Ca2+ and Mg2+, 5 mM EDTA, and protease inhibitors sonicated on ice three times with a 30-s pulse and a 30-s pause between pulses. RNase T1 (1.3 x 103 U/10 ml) and DNase 1 (400 µg/10 ml) were added to the sonicated cell suspension and incubated at room temperature for 10 min. The suspension was diluted further with washing buffer P, and the crude inclusion bodies were pelleted by centrifugation. Inclusion bodies were suspended in buffer W containing PBS without Ca2+/Mg2+, 25% sucrose, 5 mM EDTA, and 1% Triton X-100, incubated on ice for 10 min, followed by centrifugation. Resulting pellet containing purified inclusion bodies was resuspended in buffer D containing 50 mM Tris · HCl, pH 8.0, 5 M guanidinium hydrochloride, and 5 mM EDTA, sonicated for 5 min, and incubated on ice for 1 h followed by centrifugation at 17,000 rpm for 30 min in a TLA-100 rotor. The supernatant was added to renaturation buffer containing sterile 50 mM Tris·HCl, pH 8.0, 1 mM DTT, and 20% glycerol. The resistin-containing supernatant in sterile renaturation buffer was passed through an ion-exchange column and protein eluted with a step salt gradient. The major peak between 350 and 500 mM NaCl was concentrated by centrifugal filtration using a Microcon 3 (Amicon) column. Purity of the protein was assessed by SDS-PAGE and silver staining, and the purity was compared with a commercial resistin preparation. Purified recombinant resistin (>98% by SDS-PAGE) was tested for lipopolysaccharide contamination by a limulus amebocyte lysate test and by the analysis of interleukin (IL)-1 release by the MM6-CA8 human monocytic cell line. Lack of IL-1 and IL-6 release upon incubation of these cells with the recombinant resistin is indicative of the absence of endotoxin contamination in our preparation.
Cell culture. L6 cells were grown and maintained in
-MEM containing 2% FBS and 1% antibiotic-antimycotic mixture in an atmosphere of 5% CO2 at 37°C, as previously described (14). Transfected cell lines were grown and maintained in the medium along with 400 µg/ml G418. All experiments were performed on serum-starved cells.
Northern blot analysis of resistin mRNA expression. RNA was extracted from resistin-expressing L6 myotubes using TRIzol reagent (Life Technologies). RNA (10 µg) was electrophoresed on 1% formaldehyde agarose gel, transferred to a nylon membrane (Hybond-N+; Amersham), and probed with 32P-labeled mouse resistin cDNA using rapid-hybridization buffer (Amersham Life Science) at 65°C overnight. The blots were washed two times in 0.1% SDS-0.1x saline-sodium citrate at 65°C for 30 min each and exposed to film at -70°C.
Measurement of 2-DG uptake. Serum-starved L6 cells were exposed to various concentrations of resistin (0100 nM) for 30 min and then exposed to insulin (10 nM) for 30 min. Uptake of 2-DG was measured as previously described (2) using 2-deoxy-D-[3H]glucose. For kinetic analysis, 2-DG uptake was measured in transport buffer containing HEPES-buffered saline with Ca2+ and Mg2+ and 0.2% BSA and 0.015 mM 2-DG for 2 min after preexposure to resistin followed by insulin (100 nM) for 30 min.
Quantitative analysis of cell surface GLUT4myc content. An antibody-based colorimetric assay (31) was used to accurately quantitate the content of myc-tagged GLUT4 at the cell surface, as shown previously (27, 28). Briefly, quiescent monolayers of L6-GLUT4myc myotubes grown in 12-well plates were treated with recombinant resistin (1100 nM, 30 min) followed by insulin (100 nM, 15 min), washed with PBS, fixed with 3% paraformaldehyde in PBS for 3 min, and then incubated with 1% (wt/vol) glycine in PBS at 4°C for 10 min. Blocking buffer [5% (wt/vol) goat serum and 3% (wt/vol) BSA in PBS] was added for 30 min at 4°C. Monoclonal anti-myc antibody (9E10) was then added at a dilution of 1:200 for 30 min, and then cells were washed four times with PBS. Horse-radish peroxidase-conjugated donkey anti-mouse secondary antibody (1:1,000) was then added for 30 min at 4°C followed by extensive washing, and then 1 ml of OPD reagent (0.4 mg/ml OPD and 0.4 mg/ml urea hydrogen peroxide in 0.05 M phosphate-citrate buffer) was added to each well for 10 min at room temperature. At this stage, the colorimetric reaction was terminated by addition of 0.25 ml of 3 N HCl. The optical absorbance of the supernatant was measured at 492 nm. Absorbance associated with nonspecific binding (primary antibody omitted) was used as a blank.
Analysis of cell surface GLUT4myc by confocal microscopy. To facilitate detailed analysis of GLUT4myc distribution in intact cells by confocal microscopy, rounded-up L6-GLUT4myc myoblasts were prepared. This was achieved by detaching quiescent myoblasts from their substratum by incubation in Ca2+- and Mg2+-free PBS for 10 min. Dislodged cells were suspended in HEPES-buffered RPMI and seeded on coverslips placed in 12-well plates. Cells were allowed to attach for
10 min before treatment with resistin (0100 nM, 30 min) and 100 nM insulin for 10 min. At this time, cells were rinsed gently with PBS and then incubated at 4°C with blocking solution (5% goat serum in PBS) for 30 min. Polyclonal antibody against the myc epitope (1:150 dilution) was then added for 1 h to label cell surface GLUT4myc in intact cells. After extensive gentle washing, Cy3-conjugated goat anti-rabbit antibody (1:250) was added for 50 min. Cells were then washed and fixed with 4% paraformaldehyde for 5 min, and excess paraformaldehyde was reacted with 1% (wt/vol) glycine in PBS (10 min). Coverslips were mounted on slides using Dako anti-fade solution, and fluorescence was detected using a Bio-Rad Laser Scanning Confocal Microscope.
Subcellular fractionation and Western blot analysis of GLUTs. Serum-starved L6 cells were exposed to insulin (10 nM) as detailed above. Cellular homogenates were prepared according to published protocols by use of HEPES-EDTA-sucrose buffer and plasma membranes (PM), and low-density microsomes (LDM) were fractionated by sucrose density centrifugation according to the published protocols (2). Equal amounts of LDM and PM proteins were subjected to 10% SDS-PAGE, and proteins were transferred to polyvinylidene difluoride membranes and probed with GLUT1 and GLUT4 antibodies.
Immunoprecipitation of IRS-1 and Western blot analyses. L6 cells exposed to resistin, and those expressing resistin, were treated with and without insulin (10 nM) for 5 min. Then cell lysates were prepared and precleared, and equal amounts of precleared lysate proteins (1 mg) were immuno-precipitated with anti-IR and anti-IRS-1 antibody (10 mg) overnight followed by SDS-PAGE and immunoblot analysis as detailed (18). To ensure that enhanced chemiluminescence (ECL) signals were within the linear range, multiple exposures were taken during the short initial phase of the ECL reaction. Only those signals that were in the linear range were used for quantitation and data interpretation. The amount of p85 associated with IRS-1 and the extent of tyrosine phosphorylation of IR were measured by densitometric analysis of the ECL signals and quantitated by dividing the intensity of p85 and phosphotyrosine signals with the IR and IRS-1 protein signal.
Immunoprecipitation and in vitro assay of PI 3-kinase activity in the IRS-1 immunoprecipitates. Equal amounts of precleared lysate proteins (100 µg) were immunoprecipitated with rabbit anti-IRS-1 antibody. PI 3-kinase activity was assayed in the IRS-1 immunoprecipitates by the conversion of PI to PI phosphate. The lipid products were extracted with chloroform-methanol and were separated by TLC, as detailed in our recent publications (3, 18).
Measurement of Akt and p38 MAPK phosphorylation status. Proteins were extracted from L6 cells incubated with resistin and those expressing resistin after treatment with insulin. Equal amounts of lysate proteins (25 µg) in duplicate were subjected to 10% SDS-PAGE followed by Western blot analysis with anti-phospho-Akt, Akt, and anti-phospho-p38 MAPK and -p38 MAPK antibodies (23).
Protein assay. The protein content of the cell extracts was determined with either bicinchoninic acid (22) or Bradford reagent (4).
Statistics. Student's t-test or ANOVA was used to evaluate the significance of the effect of resistin and insulin on glucose transport. Results are expressed as means ± SE of four to five different experiments, each performed in triplicate.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
Effect of recombinant resistin on glucose uptake in L6 cells. As shown in Fig. 1, an incubation of L6 cells with recombinant resistin for 30 min dose dependently inhibited the insulin effect on 2-DG. Complete inhibition of the insulin effect on 2-DG was observed between 100 and 500 nM resistin. Resistin alone caused a small decrease (1014%) in basal glucose uptake at 10 and 50 nM concentrations.
Expression of resistin in L6 cells and its effect on basal and insulin-stimulated 2-DG uptake. The results of Northern and immunoblot analysis of transfected L6 cell lines stably expressing resistin are shown in Fig. 2A. Northern blot analysis of RNA revealed a single 800-bp band that hybridized with a full-length 32P-labeled resistin cDNA (Fig. 2A). Clone 42 revealed the highest resistin mRNA expression compared with the other three clones. RNA from L6 cells expressing empty pcDNA3 vector (L6 Neo control) did not hybridize with the resistin cDNA probe, as evidenced by the absence of an 800-bp band. Western blot analysis of proteins with anti-myc antibody confirmed the results of Northern blot analysis (Fig. 2B). As above, clone 42 revealed the highest expression of c-myc-tagged resistin compared with the other three clones. These clones secreted resistin in the medium, as evidenced by the presence of immunoreactivity with c-myc antibody and resistin antibody (Fig. 2C). The amount of resistin secreted in the medium reflected the intracellular levels of resistin in each clone, with clone 42 releasing the highest levels of resistin in the medium. The amount of resistin secreted in medium was quantitated further using a commercial kit. As shown in Fig. 2C, bottom, clone 42 released modest amounts of recombinant resistin in the conditioned medium that were equivalent to 17 nM, whereas clone 49 released 10.3 nM resistin. Resistin was also present in serum-free medium collected after overnight incubation and after incubation with insulin. However, the amount secreted in serum-free medium was nearly one-third of the conditioned medium (14 and 5.4 nM in clones 42 and 49, respectively). Clone 42, with the highest level of resistin expression, and clone 49, with modest levels of resistin expression, were used for all of the metabolic and insulin signaling studies.
Expression of resistin decreased basal glucose uptake by 25% in clone 42 and by 14% in clone 49 compared with L6 Neo control. Insulin dose-response studies revealed a marked decrease in sensitivity and responsiveness to insulin in resistin-expressing cells (Fig. 2D). In L6 cells transfected with an empty expression vector (L6 Neo control), insulin caused a dose-dependent increase in 2-DG uptake. In contrast, resistin clones 42 and 49 exhibited inhibition of 2-DG uptake in response to 0.1 and 1 nM insulin, as evidenced by reductions in 2-DG uptake below basal values. At 100 nM insulin, clones 42 and 49 exhibited a 90 and 63% inhibition in 2-DG uptake, respectively, compared with L6 Neo control. A half-maximal insulin effect was observed at 23 nM insulin in L6 Neo controls, whereas resistin clones showed no increase in 2-DG uptake at this concentration of insulin. Clone 43 also exhibited inhibition in insulin-mediated glucose uptake that was comparable to that of clone 49 (data not shown). Thus, at 100 nM insulin, the potency of resistin's inhibitory effect correlates with the level of expression.
Resistin does not alter GLUT4 translocation to PM in response to insulin. It is well known that insulin-stimulated glucose uptake is mediated by translocation of insulin-sensitive glucose transporters (GLUT4) from the intracellular compartment to the PM and their subsequent activation (6, 21). Therefore, we examined whether resistin affects GLUT4 translocation to the PM in response to insulin in L6-Glut4myc cells that stably express GLUT4 tagged with myc epitope, which is exofacial when GLUT4 is fully inserted in the PM (29). In these cells, Glut4myc is the predominant glucose transporter (29). Therefore, the amount of GLUT4 that is translocated to the PM can easily be detected and quantified by immunological labeling of the myc epitope at the cell surface of intact cells. As shown in Fig. 3A, treatment with different concentrations of resistin did not affect the appearance of GLUT4 at the cell surface after exposure to insulin measured by immunostaining followed by confocal microscopy, nor did it affect the total content of cell surface Glut4myc immunostained and quantitated by colorimetric assay (Fig. 3B). Because measurements were made in the linear part of the curve, the lack of difference in GLUT4 translocation is not because of saturation of the assay. Similar results were obtained in L6 cell lines expressing resistin. Resistin expression did not affect translocation of GLUT4 from the LDM to PM in response to insulin in clones 42 and 49 (Fig. 3C), nor were cellular levels of GLUT1 in the PM altered because of resistin expression (Fig. 3D). These observations suggest that resistin may be decreasing GLUT4 intrinsic activity rather than its translocation.
Resistin lowers the Vmax of basal and insulin-stimulated glucose uptake. It is well known that insulin increases glucose uptake by increasing the Vmax of transport without affecting the Km of the transporters for glucose in adipocytes, skeletal muscle, and L6 cells (23). We performed kinetic analysis of 2-DG uptake in L6 myotubes to determine whether resistin alters the Vmax of the transporters. Glucose uptake was analyzed as a function of the concentration of 2-DG uptake, which displayed a saturation kinetics (Fig. 4). Data were linearized by using the method described by Eadie-Hoftsee, which assumes that hexose transport displays simple hyperbolic kinetics. Incubation with resistin resulted in a 1016.5% decrease in apparent Vmax under basal conditions (Table 1). Insulin treatment increased the apparent Vmax by 1.8-fold without altering the apparent Km. Preincubation with resistin (50 nM) reduced the apparent Vmax of insulin-mediated 2-DG uptake by 52% (Table 1). The apparent Km was not altered by resistin and insulin treatment. Clones 42 and 49 also exhibited marked reductions in the apparent Vmax under both the basal and insulin-stimulated conditions (Table 1). These results suggest that resistin affects basal and insulin-stimulated glucose uptake by decreasing the intrinsic activity of both GLUT4 and GLUT1 without altering the affinity of the transporter for glucose.
|
Effect of resistin expression on the upstream insulin-signaling components. It is well recognized that insulin's metabolic effects are mediated primarily by the IRS-1/PI 3-kinase arm of the insulin-signaling pathway (20, 24). Binding of insulin to the
-subunit of the IR activates the instrinsic kinase, which autophosphorylates IR and causes tyrosine phosphorylation of its endogenous substrates, IRS-1/2/3/4. The IRS molecule binds to the SH2-containing proteins, for example, p85 subunit of PI 3-kinase, causing activation of p110 catalytic subunit of PI 3-kinase. This in turn activates Akt, leading to activation of downstream signaling events, i.e., glucose uptake and glycogen synthesis. To examine whether resistin interferes with the activation of upstream insulin-signaling components, we examined the IR and IRS-1 tyrosine phosphorylation status and insulin-stimulated IRS-1 association with p85 subunit of PI 3-kinase after exposure of L6 cells to resistin and in L6 cell lines expressing resistin. As seen in Fig. 5, A, C, F, and G, incubation of L6 cells with exogenous resistin (Fig. 5, A and C) and expression (Fig. 5, F and G) of resistin did not alter the extent of IR and IRS-1 tyrosine phosphorylation in response to insulin. Neither p85 PI 3-kinase association with the IRS-1 was affected (Fig. 5, D and H). In addition, the contents of the IR and IRS-1 protein were not affected by incubation with resistin (Fig. 5, B and E) or by resistin expression (Fig. 5I).
Analysis of PI 3-kinase activity in the IRS-1 immunoprecipitates performed on lysates prepared from resistin-exposed, insulin-treated cells revealed no difference between control cells and those incubated with resistin (Fig. 6A). Resistin-expressing cell lines also did not exhibit alterations in PI 3-kinase activation, as evidenced by an equal amount of PI formation in response to insulin stimulation in both clones 42 and 49
(Fig. 6B). We also examined the effect of insulin on Akt phosphorylation. As shown in Fig. 7A, the magnitude of Akt phosphorylation in response to insulin was comparable between controls and those exposed to resistin. Similar results were obtained in resistin-expressing cell lines (Fig. 7B). Thus it appears that resistin did not affect the postreceptor insulin signaling events.
Recent studies from Somwar and colleagues (2325) and Sweeney et al. (28) have shown that p38 MAPK may participate in the regulation of GLUT4 activation by insulin. Because we observed a decrease in the apparent Vmax of insulin-mediated glucose uptake upon incubation with resistin (Fig. 4), we examined the kinetics of p38 MAPK phosphorylation by insulin upon acute exposure to resistin and in resistin-expressing cell lines by Western blot analysis with phosphospecific p38 MAPK antibodies. As shown in Fig. 8, A and B, insulin rapidly increased p38 MAPK phosphorylation in a time-dependent manner, with a maximal phosphorylation occurring at 10 min with a return to basal levels in 20 min. The extent of insulin-stimulated p38 MAPK phosphorylation was comparable in L6 cells exposed to resistin and those treated with insulin alone (Fig. 8A). Similarly, resistin expression did not affect the insulin effect on p38 MAPK phosphorylation in clones 42 and 49 compared with L6 Neo control (Fig. 8B). Of note, basal phospho-p38 MAPK levels in clone 49 are higher than L6 Neo control and clone 42. The reason for this elevation is not known at present.
| DISCUSSION |
|---|
|
|
|---|
Previous studies by Steppan et al. (26) have reported impaired glucose tolerance and insulin action in mice injected with resistin. Furthermore, neutralization of resistin with anti-resistin antiserum caused a significant decrease in blood glucose in mice fed with a high-fat diet to create a mouse model of diet-induced obesity and insulin resistance (26). In addition, these authors also demonstrated that an overnight incubation of 3T3-L1 adipocytes with recombinant resistin impaired insulin-stimulated glucose uptake (26). However, the mechanism of resistin-mediated inhibition of glucose uptake was not studied by these authors. Recent in vivo studies by Rajala et al. (15) in rats suggest that resistin may be modulating insulin sensitivity by increasing the hepatic glucose output rather than inducing peripheral insulin resistance. In contrast to these observations, recent studies by Dietze et al. (7) reported that, under the in vitro coculture conditions, resistin was not secreted in substantial amounts. Nonetheless, another factor secreted by fat cells was sufficient to cause insulin resistance. However, it should be noted that these conditions are very different from the secretion of adipokines in vivo. Thus this study shows that, under the conditions used, resistin was not responsible for the insulin resistance observed. It does not rule out that resistin was unable to cause insulin resistance. Our results in skeletal muscle L6 cells extend these observations by demonstrating that resistin-mediated impairment in insulin action is the result of inhibition of insulin-stimulated glucose uptake by the skeletal muscle via reduced catalytic activity of glucose transporters rather than a decrease in the affinity of the transporters and their translocation to the PM.
There are at least three mechanisms by which insulin may modulate the function of the insulin-regulatable glucose transporter GLUT4 in the skeletal muscle and adipose tissue (reviewed in Ref. 32). First, insulin is known to promote translocation of GLUT4 from the preexisting intracellular pool to the PM (6). Second, insulin may increase the intrinsic transport activity of the preexisting GLUT4 proteins at the cell surface either by directly modifying GLUT4 or by its interactions with the other regulatory molecules (8, 32). In addition, insulin is known to upregulate the expression of GLUT4 protein itself by increased biosynthesis, decreased degradation, or both (32). Although these mechanisms are not mutually exclusive, the first model has been studied more extensively (6). Our results suggest that resistin may be interfering with insulin activation of the preexisting GLUT4 protein at the cell surface as well as the GLUT4 that is translocated in response to insulin. Our results are in agreement with the observations of Sweeney et al. (27), who demonstrated that high leptin levels directly inhibit insulin-stimulated glucose uptake in L6 muscle cells despite normal GLUT4 translocation. Furthermore, these authors attributed the inhibitory effects of leptin to a decrease in GLUT4 activation resulting from inhibition of p38 MAPK activation by insulin. In the present study, we did not observe alterations in p38 MAPK phosphorylation by insulin resulting from resistin. Therefore, the observed reductions in the intrinsic activity of glucose transporters and glucose uptake by resistin may not be because of inhibition of p38 MAPK signaling.
Although we observed an inhibition of insulin-stimulated glucose uptake by incubating L6 cells with recombinant resistin and by expressing resistin in L6 cells, which results in resistin secretion in the medium, it is still not clear how resistin might be working in L6 cells or in any cell type. It presumably needs to act on its putative receptor. Attempts to examine binding of resistin to its receptor on the cell surface by using resistin antibody yielded a diffused signal, the intensity of which increased dose dependently with resistin, indicating some interaction with cell surface proteins (data not shown). Further in-depth studies with a good resistin antibody are warranted to clearly identify the putative receptor.
In summary, our results indicate that resistin inhibits insulin-mediated glucose uptake without affecting GLUT4 translocation and insulin-signaling pathways that mediate glucose uptake. The inhibitory effect of resistin may be because of reductions in the intrinsic activity of glucose transporters.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M.-J. Lee, H. Lin, C.-W. Liu, M.-H. Wu, W.-J. Liao, H.-H. Chang, H.-C. Ku, Y.-S. Chien, W.-H. Ding, and Y.-H. Kao Octylphenol stimulates resistin gene expression in 3T3-L1 adipocytes via the estrogen receptor and extracellular signal-regulated kinase pathways Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1542 - C1551. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Alkhateeb, A. Chabowski, J. F. C. Glatz, J. F. P. Luiken, and A. Bonen Two phases of palmitate-induced insulin resistance in skeletal muscle: impaired GLUT4 translocation is followed by a reduced GLUT4 intrinsic activity Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E783 - E793. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haugen, T. Ranheim, N. K. Harsem, E. Lips, A. C. Staff, and C. A. Drevon Increased plasma levels of adipokines in preeclampsia: relationship to placenta and adipose tissue gene expression Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E326 - E333. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-S. Liu, Y.-H. Chen, P.-F. Hung, and Y.-H. Kao Inhibitory effect of green tea (-)-epigallocatechin gallate on resistin gene expression in 3T3-L1 adipocytes depends on the ERK pathway Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E273 - E281. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Mitchell, D T Armstrong, R L Robker, and R J Norman Adipokines: implications for female fertility and obesity Reproduction, November 1, 2005; 130(5): 583 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Chen, P.-F. Hung, and Y.-H. Kao IGF-I downregulates resistin gene expression and protein secretion Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E1019 - E1027. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kurlawalla-Martinez, B. Stiles, Y. Wang, S. U. Devaskar, B. B. Kahn, and H. Wu Insulin Hypersensitivity and Resistance to Streptozotocin-Induced Diabetes in Mice Lacking PTEN in Adipose Tissue Mol. Cell. Biol., March 15, 2005; 25(6): 2498 - 2510. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haugen, N. Zahid, K. T. Dalen, K. Hollung, H. I. Nebb, and C. A. Drevon Resistin expression in 3T3-L1 adipocytes is reduced by arachidonic acid J. Lipid Res., January 1, 2005; 46(1): 143 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Rajala, Y. Qi, H. R. Patel, N. Takahashi, R. Banerjee, U. B. Pajvani, M. K. Sinha, R. L. Gingerich, P. E. Scherer, and R. S. Ahima Regulation of Resistin Expression and Circulating Levels in Obesity, Diabetes, and Fasting Diabetes, July 1, 2004; 53(7): 1671 - 1679. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Banerjee, S. M. Rangwala, J. S. Shapiro, A. S. Rich, B. Rhoades, Y. Qi, J. Wang, M. W. Rajala, A. Pocai, P. E. Scherer, et al. Regulation of Fasted Blood Glucose by Resistin Science, February 20, 2004; 303(5661): 1195 - 1198. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||