AJP - Endo AJP: Gastrointestinal and Liver Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 285: E106-E115, 2003. First published March 4, 2003; doi:10.1152/ajpendo.00457.2002
0193-1849/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/1/E106    most recent
00457.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (70)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moon, B.
Right arrow Articles by Begum, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moon, B.
Right arrow Articles by Begum, N.

Resistin inhibits glucose uptake in L6 cells independently of changes in insulin signaling and GLUT4 translocation

Byoung Moon,1 Jamie Jun-Mae Kwan,2 Noreen Duddy,1 Gary Sweeney,2 and Najma Begum1,3

1Diabetes Research Laboratory, Winthrop University Hospital, Mineola, New York 11501; 3School of Medicine, State University of New York at Stony Brook, Stony Brook, New York 11794, and 2Department Of Biology, York University, Ontario, Canada M3J 1P3

Submitted 23 October 2002 ; accepted in final form 24 February 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Elevated levels of resistin have been proposed to cause insulin resistance and therefore may serve as a link between obesity and type 2 diabetes. However, its role in skeletal muscle metabolism is unknown. In this study, we examined the effect of resistin on insulin-stimulated glucose uptake and the upstream insulin-signaling components in L6 rat skeletal muscle cells that were either incubated with recombinant resistin or stably transfected with a vector containing the myc-tagged mouse resistin gene. Transfected clones expressed intracellular resistin, which was released in the medium. Incubation with recombinant resistin resulted in a dose-dependent inhibition of insulin-stimulated 2-deoxyglucose (2-DG) uptake. The inhibitory effect of resistin on insulin-stimulated 2-DG uptake was not the result of impaired GLUT4 translocation to the plasma membrane. Furthermore, resistin did not alter the insulin receptor (IR) content and its phosphorylation, nor did it affect insulin-stimulated insulin receptor substrate (IRS)-1 tyrosine phosphorylation, its association with the p85 subunit of phosphatidylinositol (PI) 3-kinase, or IRS-1-associated PI 3-kinase enzymatic activity. Insulin-stimulated phosphorylation of Akt/protein kinase B-{alpha}, one of the downstream targets of PI 3-kinase and p38 MAPK phosphorylation, was also not affected by resistin. Expression of resistin also inhibited insulin-stimulated 2-DG uptake when compared with cells expressing the empty vector (L6Neo) without affecting GLUT4 translocation, GLUT1 content, and IRS-1/PI 3-kinase signaling. We conclude that resistin does not alter IR signaling but does affect insulin-stimulated glucose uptake, presumably by decreasing the intrinsic activity of cell surface glucose transporters.

skeletal muscle; glucose transporter-4


RESISTIN, also known as adipocyte-secreted factor and Fizz3 (9), is secreted by rodent fat cells and was recently postulated to be an important link between obesity and insulin resistance (26). Resistin gene expression is induced during adipocyte differentiation (10), and the resistin polypeptide is specifically expressed and secreted by adipocytes (10). Resistin levels were shown to be increased in both genetic and diet-induced obesity in mice (26). Immunoneutralization of resistin improved blood glucose and insulin action in a mouse model of type 2 diabetes. In contrast, administration of recombinant resistin impaired glucose tolerance and insulin action in normal mice (26). On the basis of these results, it was postulated that resistin is the link between obesity and insulin resistance. Furthermore, resistin is believed to be a thiazolidinedione (TZD)-regulated protein, as peroxisome proliferator-activated receptor (PPAR){gamma} agonists (TZDs) suppressed resistin expression in 3T3-L1 adipocytes and in the white adipose tissue of mice fed a high-fat diet (26). These studies suggested that suppression of resistin expression by PPAR{gamma} agonists (TZDs) might explain the beneficial effects of these compounds in insulin-resistant states. In contrast, there have been many reports that argue against the role of resistin in insulin resistance (4, 1213). Studies by Way et al. (33) reported reduced resistin mRNA levels in white adipose tissue of several obese rodent models. Furthermore, treating these animals with TZDs increased resistin mRNA expression in white adipose tissue (33). Another study in human subjects indicates that, although resistin expression in adipose tissue from morbidly obese subjects is increased in comparison with lean subjects, there is no correlation between body mass index (BMI) and resistin expression per se (19). However, a recent human study with type 2 diabetic Caucasian subjects suggests that noncoding sequence variation in the resistin gene may alter the interaction of BMI and insulin sensitivity index in nondiabetic members of familial type 2 diabetes (30). Recent in vivo studies in rats indicate that infusion of adipose tissue-derived and gut-derived resistin-like molecule-{beta} markedly increased glucose production by liver and thereby modulated hepatic insulin action (15). Thus resistin may play an important role in insulin sensitivity modulation.

To clearly understand the direct biological effect of resistin on skeletal muscle glucose metabolism, we incubated cultured rat L6 myotubes with recombinant resistin and also transfected myc-tagged resistin cDNA in L6 cells and examined the effect of chronic expression of resistin on insulin-stimulated glucose uptake and on the upstream insulin receptor (IR)-signaling components that mediate the metabolic effects of insulin.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals. Cell culture reagents, FBS, transfection reagent (lipofectamine plus), geneticin (G418), and antibiotics were purchased from Life Technologies (Grand Island, NY). Deoxy-D-[2-3H]glucose was from DuPont/New England Nuclear (Boston, MA). Electrophoresis, protein assay reagents, and Western blot reagents were from Bio-Rad (Hercules, CA). Anti-insulin receptor substrate (IRS)-1 antibody and anti-p85 phosphatidylinositol (PI) 3-kinase antibody were from Upstate Biotechnology. Anti-phosphotyrosine antibodies were from Zymed. Anti-mouse IgG-agarose, protein A-Sepharose CL-4B, protease inhibitors, sodium orthovanadate, sucrose, PI, 2-deoxyglucose (2-DG), glucose 6-phosphate, UDP-glucose, and o-phenylenediamine dihydrochloride (OPD) reagent were from Sigma Chemical (St. Louis, MO). Porcine insulin was a kind gift from Eli Lilly (Indianapolis, IN). GLUT1 and GLUT4 polyclonal antibodies were from East Acers Biologicals (Southbridge, MA). Silica gel-coated TLC plates were purchased from Selectro Scientific. Phospho-Akt and Akt antibodies were from Cell Signaling (Beverly, MA). pcDNA3 and anti-myc antibody were from Invitrogen (Carlsbad, CA). Monoclonal (9E10) and polyclonal (A-14) antibody to the myc epitope were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Cy3-conjugated goat anti-rabbit secondary antibody was from Jackson Immunoresearch (West Grove, PA). Recombinant resistin was purchased from PeproTech. The resistin enzyme immunoassay kit and resistin antibody were from Phoenix.

Vector construction. Mouse resistin cDNA was obtained from Research Genetics (ID no. AA796548 [GenBank] ; GenBank). The full-length cDNA was amplified by PCR using the forward 5'-GGAAGCTTTCCTGCTAAGTCCTCTGCCA and reverse primer TGGGCCCGGAAGCGACCTGCAGCTTAC to create restriction sites. The PCR product was digested with both HindIII and ApaI and subcloned into the corresponding sites of pcDNA3.1/myc-His version A (Invitrogen). The clones containing insert were confirmed for the resistin cDNA sequence in frame with the COOH-terminal myc epitope by sequence analysis (Applied Biosystems).

Generation of myc-tagged resistin-expressing L6 cell lines. The spontaneously fusing rat skeletal muscle cell line, L6, and L6 cells transfected with myc-tagged GLUT4 (L6-GLUT4myc) were a kind gift from Dr. Amira Klip (The Hospital for Sick Children, Toronto). L6 myoblasts at second passage were transfected with plasmid encoding myc-tagged resistin cDNA according to our published protocol (14). Individual G418-resistant clones were tested for resistin expression by Western blot analysis using anti-myc antibody. Four resistin-expressing clones were selected and amplified. Transfection did not affect growth and differentiation of L6 cells, which was monitored by the analysis of the L6 differentiation marker myogenin and light microscopy (data not shown). A single clone (no. 42) expressing the highest amounts of myc-tagged resistin was amplified along with two other clones with moderate levels of myc-tagged resistin expression (nos. 43 and 49), and these were used for all the dose-response experiments. A single wild-type G418 clone isolated from L6 cells transfected with empty vector alone (L6 Neo control) served as a control. All of the four clones secreted resistin in the medium.

Expression of recombinant resistin in Escherichia coli. The mouse resistin cDNA encoding a peptide leader-deficient protein was subcloned in pRSET expression vector (Invitrogen) and used to transform host Escherichia coli [strain BL21(DE3)pLysS]. Synthesis of recombinant resistin was induced by isopropyl-{beta}-D-thiogalactopyranoside (1 mM).

Purification of bacterial recombinant resistin from the inclusion bodies was performed as previously described (11). Briefly, the pellet was resuspended in buffer P containing PBS without Ca2+ and Mg2+, 5 mM EDTA, and protease inhibitors sonicated on ice three times with a 30-s pulse and a 30-s pause between pulses. RNase T1 (1.3 x 103 U/10 ml) and DNase 1 (400 µg/10 ml) were added to the sonicated cell suspension and incubated at room temperature for 10 min. The suspension was diluted further with washing buffer P, and the crude inclusion bodies were pelleted by centrifugation. Inclusion bodies were suspended in buffer W containing PBS without Ca2+/Mg2+, 25% sucrose, 5 mM EDTA, and 1% Triton X-100, incubated on ice for 10 min, followed by centrifugation. Resulting pellet containing purified inclusion bodies was resuspended in buffer D containing 50 mM Tris · HCl, pH 8.0, 5 M guanidinium hydrochloride, and 5 mM EDTA, sonicated for 5 min, and incubated on ice for 1 h followed by centrifugation at 17,000 rpm for 30 min in a TLA-100 rotor. The supernatant was added to renaturation buffer containing sterile 50 mM Tris·HCl, pH 8.0, 1 mM DTT, and 20% glycerol. The resistin-containing supernatant in sterile renaturation buffer was passed through an ion-exchange column and protein eluted with a step salt gradient. The major peak between 350 and 500 mM NaCl was concentrated by centrifugal filtration using a Microcon 3 (Amicon) column. Purity of the protein was assessed by SDS-PAGE and silver staining, and the purity was compared with a commercial resistin preparation. Purified recombinant resistin (>98% by SDS-PAGE) was tested for lipopolysaccharide contamination by a limulus amebocyte lysate test and by the analysis of interleukin (IL)-1 release by the MM6-CA8 human monocytic cell line. Lack of IL-1 and IL-6 release upon incubation of these cells with the recombinant resistin is indicative of the absence of endotoxin contamination in our preparation.

Cell culture. L6 cells were grown and maintained in {alpha}-MEM containing 2% FBS and 1% antibiotic-antimycotic mixture in an atmosphere of 5% CO2 at 37°C, as previously described (14). Transfected cell lines were grown and maintained in the medium along with 400 µg/ml G418. All experiments were performed on serum-starved cells.

Northern blot analysis of resistin mRNA expression. RNA was extracted from resistin-expressing L6 myotubes using TRIzol reagent (Life Technologies). RNA (10 µg) was electrophoresed on 1% formaldehyde agarose gel, transferred to a nylon membrane (Hybond-N+; Amersham), and probed with 32P-labeled mouse resistin cDNA using rapid-hybridization buffer (Amersham Life Science) at 65°C overnight. The blots were washed two times in 0.1% SDS-0.1x saline-sodium citrate at 65°C for 30 min each and exposed to film at -70°C.

Measurement of 2-DG uptake. Serum-starved L6 cells were exposed to various concentrations of resistin (0–100 nM) for 30 min and then exposed to insulin (10 nM) for 30 min. Uptake of 2-DG was measured as previously described (2) using 2-deoxy-D-[3H]glucose. For kinetic analysis, 2-DG uptake was measured in transport buffer containing HEPES-buffered saline with Ca2+ and Mg2+ and 0.2% BSA and 0.01–5 mM 2-DG for 2 min after preexposure to resistin followed by insulin (100 nM) for 30 min.

Quantitative analysis of cell surface GLUT4myc content. An antibody-based colorimetric assay (31) was used to accurately quantitate the content of myc-tagged GLUT4 at the cell surface, as shown previously (27, 28). Briefly, quiescent monolayers of L6-GLUT4myc myotubes grown in 12-well plates were treated with recombinant resistin (1–100 nM, 30 min) followed by insulin (100 nM, 15 min), washed with PBS, fixed with 3% paraformaldehyde in PBS for 3 min, and then incubated with 1% (wt/vol) glycine in PBS at 4°C for 10 min. Blocking buffer [5% (wt/vol) goat serum and 3% (wt/vol) BSA in PBS] was added for 30 min at 4°C. Monoclonal anti-myc antibody (9E10) was then added at a dilution of 1:200 for 30 min, and then cells were washed four times with PBS. Horse-radish peroxidase-conjugated donkey anti-mouse secondary antibody (1:1,000) was then added for 30 min at 4°C followed by extensive washing, and then 1 ml of OPD reagent (0.4 mg/ml OPD and 0.4 mg/ml urea hydrogen peroxide in 0.05 M phosphate-citrate buffer) was added to each well for 10 min at room temperature. At this stage, the colorimetric reaction was terminated by addition of 0.25 ml of 3 N HCl. The optical absorbance of the supernatant was measured at 492 nm. Absorbance associated with nonspecific binding (primary antibody omitted) was used as a blank.

Analysis of cell surface GLUT4myc by confocal microscopy. To facilitate detailed analysis of GLUT4myc distribution in intact cells by confocal microscopy, rounded-up L6-GLUT4myc myoblasts were prepared. This was achieved by detaching quiescent myoblasts from their substratum by incubation in Ca2+- and Mg2+-free PBS for 10 min. Dislodged cells were suspended in HEPES-buffered RPMI and seeded on coverslips placed in 12-well plates. Cells were allowed to attach for ~10 min before treatment with resistin (0–100 nM, 30 min) and 100 nM insulin for 10 min. At this time, cells were rinsed gently with PBS and then incubated at 4°C with blocking solution (5% goat serum in PBS) for 30 min. Polyclonal antibody against the myc epitope (1:150 dilution) was then added for 1 h to label cell surface GLUT4myc in intact cells. After extensive gentle washing, Cy3-conjugated goat anti-rabbit antibody (1:250) was added for 50 min. Cells were then washed and fixed with 4% paraformaldehyde for 5 min, and excess paraformaldehyde was reacted with 1% (wt/vol) glycine in PBS (10 min). Coverslips were mounted on slides using Dako anti-fade solution, and fluorescence was detected using a Bio-Rad Laser Scanning Confocal Microscope.

Subcellular fractionation and Western blot analysis of GLUTs. Serum-starved L6 cells were exposed to insulin (10 nM) as detailed above. Cellular homogenates were prepared according to published protocols by use of HEPES-EDTA-sucrose buffer and plasma membranes (PM), and low-density microsomes (LDM) were fractionated by sucrose density centrifugation according to the published protocols (2). Equal amounts of LDM and PM proteins were subjected to 10% SDS-PAGE, and proteins were transferred to polyvinylidene difluoride membranes and probed with GLUT1 and GLUT4 antibodies.

Immunoprecipitation of IRS-1 and Western blot analyses. L6 cells exposed to resistin, and those expressing resistin, were treated with and without insulin (10 nM) for 5 min. Then cell lysates were prepared and precleared, and equal amounts of precleared lysate proteins (1 mg) were immuno-precipitated with anti-IR and anti-IRS-1 antibody (10 mg) overnight followed by SDS-PAGE and immunoblot analysis as detailed (18). To ensure that enhanced chemiluminescence (ECL) signals were within the linear range, multiple exposures were taken during the short initial phase of the ECL reaction. Only those signals that were in the linear range were used for quantitation and data interpretation. The amount of p85 associated with IRS-1 and the extent of tyrosine phosphorylation of IR were measured by densitometric analysis of the ECL signals and quantitated by dividing the intensity of p85 and phosphotyrosine signals with the IR and IRS-1 protein signal.

Immunoprecipitation and in vitro assay of PI 3-kinase activity in the IRS-1 immunoprecipitates. Equal amounts of precleared lysate proteins (100 µg) were immunoprecipitated with rabbit anti-IRS-1 antibody. PI 3-kinase activity was assayed in the IRS-1 immunoprecipitates by the conversion of PI to PI phosphate. The lipid products were extracted with chloroform-methanol and were separated by TLC, as detailed in our recent publications (3, 18).

Measurement of Akt and p38 MAPK phosphorylation status. Proteins were extracted from L6 cells incubated with resistin and those expressing resistin after treatment with insulin. Equal amounts of lysate proteins (25 µg) in duplicate were subjected to 10% SDS-PAGE followed by Western blot analysis with anti-phospho-Akt, Akt, and anti-phospho-p38 MAPK and -p38 MAPK antibodies (23).

Protein assay. The protein content of the cell extracts was determined with either bicinchoninic acid (22) or Bradford reagent (4).

Statistics. Student's t-test or ANOVA was used to evaluate the significance of the effect of resistin and insulin on glucose transport. Results are expressed as means ± SE of four to five different experiments, each performed in triplicate.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To examine whether resistin affects basal and insulin-stimulated glucose uptake in skeletal muscle, two different but complementary approaches were used. First, L6 cells were exposed to various concentrations of resistin, as described in the legends for Figs. 1, 2, 3, 4, 5, 6, 7, 8, for 30 min and then stimulated with insulin and 2-DG uptake; next, GLUT4 translocation was assayed. In the second approach, resistin was expressed in L6 cells, and two of the four independent clones expressing moderate to high levels of resistin were examined for resistin secretion in the medium and for alterations in glucose uptake upon treatment with insulin.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1. Effect of recombinant resistin on insulin (Ins)-stimulated 2-deoxyglucose (2-DG) uptake by L6 cells. Serum-starved L6 myotubes were exposed to various concentrations of recombinant resistin (RSTN) for 30 min followed by exposure to 10 nM insulin for 15 min and then incubated with 2-[3H]DG for 15 min at 37°C. The reaction was stopped by the addition of buffer containing phloretin. After extensive washing, cells were solubilized, and radioactivity was counted. Results are means ± SE of 5 experiments performed in duplicate. Results are expressed as %increase over basal value set to 100%. *P < 0.05 vs. insulin alone.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. A: Northern blot analysis of resistin mRNA expression in L6 cells. L6 cells stably expressing the empty expression vector (L6 Neo control) and resistin (clones 12, 42, 43, and 49) were grown and differentiated as detailed under MATERIALS AND METHODS. RNA prepared from these cell lines upon differentiation was subjected to formaldehyde-agarose gel electrophoresis, transferred to a nylon membrane, and hybridized with a 32P-labeled resistin cDNA probe. Top: representative autoradiogram from 3 independent experiments. Bottom: ethidium bromide staining of the RNA gel showing 18S ribosomal RNA to document equal loading of the RNA. B: expression of resistin by Western analysis. Differentiated L6 cells expressing myc-tagged resistin were extracted with 1% SDS buffer. Equal amounts of protein lysates (25 µg) were subjected to 15% SDS-PAGE, and proteins were transferred to a polyvinylidene difluoride (PVDF) membrane followed by immunoblot analysis with a monoclonal anti-myc antibody (Ab). A representative blot from 4–5 independent experiments is shown. C: secretion of resistin in the medium from transfected L6 cell lines. Conditioned medium obtained from L6 Neo control and clones 13, 42, and 49 was subjected to electrophoresis on duplicate gels, transferred to PVDF membranes, and probed with resistin antibody and c-myc antibody. Recombinant resistin (0.1 µg RSTN) was used as a positive control. Top: representative blots. Similar results were obtained in 5 different experiments. Bottom: quantitative analysis of resistin secretion by various clones by enzyme immunoassay (EIA). Conditioned medium (50 µl) was used to measure the amount of resistin secreted by respective clones using an EIA kit supplied by Phoenix Pharmaceuticals. Results are means ± SE of 4 different preparations. D: resistin expression inhibits insulin-stimulated 2-DG uptake. Serum-starved L6 cell lines expressing resistin were incubated in glucose transport buffer containing various concentrations of insulin (0–100 nM) for 30 min. 2-DG uptake was measured as detailed in Fig. 1. Insulin-stimulated 2-DG uptake was expressed as %increase over the basal values set at 100%. Results are the means of 4–5 experiments performed in duplicate. *P < 0.05 vs. L6 Neo control. Basal 2-DG uptake was as follows: Neo control, 381 ± 50; clone 42, 284 ± 55; clone 49, 329 ± 45 pmol·mg protein-1·min-1.

 


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3. Resistin does not alter GLUT4 translocation to the plasma membranes and cell-surface GLUT4 content in response to insulin. A: detection of cell-surface GLUT4 by confocal microscopy. L6Glut4myc cells were serum starved for 5 h and incubated with resistin (1–100 nM) for 30 min, followed by treatment with 100 nM insulin for 15 min. Cells were probed with anti-myc antibody followed by Cy3-conjugated goat-rabbit antibody. Fluorescence was detected by confocal microscopy. A representative experiment is shown. Similar results were obtained in 4 separate experiments. B: quantitative analysis of cell-surface Glut4myc content. L6-Glut4myc myotubes grown in 12-well plates were exposed to resistin and insulin, as described in A. Cells were fixed with paraformaldehyde and blocked and treated with myc antibody (9E10), followed by horseradish peroxidase (HRP)-conjugated anti-mouse secondary antibody and color development with o-phenylenediamine dihydrochloride (OPD). Results are means ± SE of 5 experiments performed in triplicate. C: resistin expression does not affect GLUT4 translocation of the low-density microsomes (LDM) to plasma membranes (PM). Resistin-expressing cell lines were serum starved and exposed to 10 nM insulin for 30 min, followed by subcellular fractionation of proteins by sucrose density gradient centrifugation. Equal amounts of proteins (10 µg) from LDM and PM were subjected to SDS-PAGE followed by immunoblot analysis with a polyclonal anti-GLUT4 antibody. D: GLUT1 content in cells expressing resistin. Blot containing LDM and PM proteins were probed with GLUT1 antibody. A representative immunoblot from 3 different experiments is shown.

 


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4. Resistin reduces insulin-stimulated glucose uptake by decreasing the transport Vmax (V). L6 cells were treated with resistin (50 nM) for 30 min before insulin (100 nM) exposure for an additional 30 min. Transport of 2-DG was determined in the presence of increasing concentrations of 2-DG. Results are means ± SE of 4 different experiments, each performed in triplicate.

 


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 5. Effect of resistin on insulin-stimulated insulin receptor (IR) and insulin receptor substrate (IRS)-1 tyrosine phosphorylation (pTy) and p85 PI 3-kinase association with IRS-1. Serum-starved cells were exposed to resistin (50 nM) for 30 min followed by insulin (10 nM) for 5 min and extracted with HES buffer containing protease and phosphatase inhibitors, as detailed under MATERIALS AND METHODS. Equal amounts of precleared lysate proteins (1 mg) in duplicate were immunoprecipitated (IP) with polyclonal antibodies directed against the IR and IRS-1, followed by separation of the immunoprecipitated proteins on a 7% SDS polyacrylamide gel, and transferred to PVDF membrane. Membranes were probed with anti-phosphotyrosine antibody (A and C) and anti-IR and anti-IRS-1 antibodies (B and E). The bottom portion of IRS-1 IP was probed with anti-p85 phosphatidylinositol (PI) 3-kinase antibody (D). A representative blot from 3 separate experiments is shown. Resistin expression did not affect IR and IRS-1 tyrosine phosphorylation. L6 cells expressing resistin were exposed to 10 nM insulin for 5 min. Cell lysates were immunoprecipitated with the IR and IRS-1 antibodies as detailed above and probed with anti-phosphotyrosine antibody (F and G), p85 PI 3-kinase antibody (H), and anti-IRS-1 antibody (I). A representative autoradiogram is shown. Similar results were obtained in 3 separate experiments.

 


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6. Resistin treatment and expression do not inhibit insulin-mediated PI 3-kinase activation in the IRS-1 immunoprecipitates. A: serum-starved cells were exposed to resistin (50 nM) for 30 min followed by treatment with insulin (10 nM) for 5 min as shown in Fig. 5. Equal amounts of precleared protein lysates (100 µg) were immunoprecipitated with the IRS-1 antibody. The immunoprecipitates were washed extensively and reconstituted in PI 3-kinase assay buffer followed by analysis of PI 3-kinase enzymatic activity using PI as a substrate in the presence of [{alpha}-32P]ATP. At the end of 15 min of incubation at 30°C, the reaction was stopped with HCl (8 M), and phospholipids were extracted and separated by TLC followed by autoradiography. A representative autoradiogram is shown. Similar results were obtained in 3 separate experiments. B: L6 cell lines expressing resistin were exposed to insulin (10 nM) for 5 min, and the IRS-1 immunoprecipitates were examined for PI 3-kinase enzymatic activity as detailed above. A representative autoradiogram is shown. Similar results were obtained in 3 different experiments.

 


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 7. Effect of resistin treatment and expression on Akt phosphorylation. A: serum-starved cells were exposed to resistin and insulin as detailed in Fig. 6A. Equal amounts of lysate proteins in duplicate were subjected to SDS-PAGE followed by immunoblot analysis with phospho-Akt (pAkt) antibody and Akt antibody. B: L6 cell lines expressing resistin were stimulated with insulin, as detailed in Fig. 5. Cells were solubilized in HES-Triton lysis buffer containing phosphatase and protease inhibitors. Equal amounts of lysate proteins (50 µg) in duplicate were subjected to 10% SDS-PAGE, and proteins were transferred to PVDF membranes and probed with anti-pAkt (S308) and Akt antibodies. A representative Western blot from 3 separate experiments is shown. C: linear enhanced chemiluminescence (ECL) signals of pAkt from 4 different experiments were quantitated by densitometric analysis, corrected for Akt protein by dividing the intensity of pAkt signals by that of Akt protein signals, and expressed as a ratio of pAkt to Akt in arbitrary densitometric units (ADU). Results are means ± SE of 4 different experiments. *P < 0.05 vs. basal.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8. Effect of resistin on insulin-stimulated p38 MAPK phosphorylation. A: cells were exposed to resistin (100 nM) for 30 min followed by insulin (10 nM) for 5–30 min and extracted with HES buffer as detailed in Figs. 5, 6, 7, and equal amounts were subjected to SDS-PAGE followed by immunoblot analysis with anti-phospho-p38 MAPK and p38 MAPK antibodies. B: lysates from resistin-expressing cells exposed to insulin for 5–60 min were subjected to SDS-PAGE and immunoblot analysis with anti-phospho-p38 MAPK antibodies. A representative picture from a blot is shown. Similar results were obtained in 3 different experiments.

 

Effect of recombinant resistin on glucose uptake in L6 cells. As shown in Fig. 1, an incubation of L6 cells with recombinant resistin for 30 min dose dependently inhibited the insulin effect on 2-DG. Complete inhibition of the insulin effect on 2-DG was observed between 100 and 500 nM resistin. Resistin alone caused a small decrease (10–14%) in basal glucose uptake at 10 and 50 nM concentrations.

Expression of resistin in L6 cells and its effect on basal and insulin-stimulated 2-DG uptake. The results of Northern and immunoblot analysis of transfected L6 cell lines stably expressing resistin are shown in Fig. 2A. Northern blot analysis of RNA revealed a single 800-bp band that hybridized with a full-length 32P-labeled resistin cDNA (Fig. 2A). Clone 42 revealed the highest resistin mRNA expression compared with the other three clones. RNA from L6 cells expressing empty pcDNA3 vector (L6 Neo control) did not hybridize with the resistin cDNA probe, as evidenced by the absence of an 800-bp band. Western blot analysis of proteins with anti-myc antibody confirmed the results of Northern blot analysis (Fig. 2B). As above, clone 42 revealed the highest expression of c-myc-tagged resistin compared with the other three clones. These clones secreted resistin in the medium, as evidenced by the presence of immunoreactivity with c-myc antibody and resistin antibody (Fig. 2C). The amount of resistin secreted in the medium reflected the intracellular levels of resistin in each clone, with clone 42 releasing the highest levels of resistin in the medium. The amount of resistin secreted in medium was quantitated further using a commercial kit. As shown in Fig. 2C, bottom, clone 42 released modest amounts of recombinant resistin in the conditioned medium that were equivalent to 17 nM, whereas clone 49 released 10.3 nM resistin. Resistin was also present in serum-free medium collected after overnight incubation and after incubation with insulin. However, the amount secreted in serum-free medium was nearly one-third of the conditioned medium (14 and 5.4 nM in clones 42 and 49, respectively). Clone 42, with the highest level of resistin expression, and clone 49, with modest levels of resistin expression, were used for all of the metabolic and insulin signaling studies.

Expression of resistin decreased basal glucose uptake by 25% in clone 42 and by 14% in clone 49 compared with L6 Neo control. Insulin dose-response studies revealed a marked decrease in sensitivity and responsiveness to insulin in resistin-expressing cells (Fig. 2D). In L6 cells transfected with an empty expression vector (L6 Neo control), insulin caused a dose-dependent increase in 2-DG uptake. In contrast, resistin clones 42 and 49 exhibited inhibition of 2-DG uptake in response to 0.1 and 1 nM insulin, as evidenced by reductions in 2-DG uptake below basal values. At 100 nM insulin, clones 42 and 49 exhibited a 90 and 63% inhibition in 2-DG uptake, respectively, compared with L6 Neo control. A half-maximal insulin effect was observed at 2–3 nM insulin in L6 Neo controls, whereas resistin clones showed no increase in 2-DG uptake at this concentration of insulin. Clone 43 also exhibited inhibition in insulin-mediated glucose uptake that was comparable to that of clone 49 (data not shown). Thus, at 100 nM insulin, the potency of resistin's inhibitory effect correlates with the level of expression.

Resistin does not alter GLUT4 translocation to PM in response to insulin. It is well known that insulin-stimulated glucose uptake is mediated by translocation of insulin-sensitive glucose transporters (GLUT4) from the intracellular compartment to the PM and their subsequent activation (6, 21). Therefore, we examined whether resistin affects GLUT4 translocation to the PM in response to insulin in L6-Glut4myc cells that stably express GLUT4 tagged with myc epitope, which is exofacial when GLUT4 is fully inserted in the PM (29). In these cells, Glut4myc is the predominant glucose transporter (29). Therefore, the amount of GLUT4 that is translocated to the PM can easily be detected and quantified by immunological labeling of the myc epitope at the cell surface of intact cells. As shown in Fig. 3A, treatment with different concentrations of resistin did not affect the appearance of GLUT4 at the cell surface after exposure to insulin measured by immunostaining followed by confocal microscopy, nor did it affect the total content of cell surface Glut4myc immunostained and quantitated by colorimetric assay (Fig. 3B). Because measurements were made in the linear part of the curve, the lack of difference in GLUT4 translocation is not because of saturation of the assay. Similar results were obtained in L6 cell lines expressing resistin. Resistin expression did not affect translocation of GLUT4 from the LDM to PM in response to insulin in clones 42 and 49 (Fig. 3C), nor were cellular levels of GLUT1 in the PM altered because of resistin expression (Fig. 3D). These observations suggest that resistin may be decreasing GLUT4 intrinsic activity rather than its translocation.

Resistin lowers the Vmax of basal and insulin-stimulated glucose uptake. It is well known that insulin increases glucose uptake by increasing the Vmax of transport without affecting the Km of the transporters for glucose in adipocytes, skeletal muscle, and L6 cells (23). We performed kinetic analysis of 2-DG uptake in L6 myotubes to determine whether resistin alters the Vmax of the transporters. Glucose uptake was analyzed as a function of the concentration of 2-DG uptake, which displayed a saturation kinetics (Fig. 4). Data were linearized by using the method described by Eadie-Hoftsee, which assumes that hexose transport displays simple hyperbolic kinetics. Incubation with resistin resulted in a 10–16.5% decrease in apparent Vmax under basal conditions (Table 1). Insulin treatment increased the apparent Vmax by 1.8-fold without altering the apparent Km. Preincubation with resistin (50 nM) reduced the apparent Vmax of insulin-mediated 2-DG uptake by 52% (Table 1). The apparent Km was not altered by resistin and insulin treatment. Clones 42 and 49 also exhibited marked reductions in the apparent Vmax under both the basal and insulin-stimulated conditions (Table 1). These results suggest that resistin affects basal and insulin-stimulated glucose uptake by decreasing the intrinsic activity of both GLUT4 and GLUT1 without altering the affinity of the transporter for glucose.


View this table:
[in this window]
[in a new window]
 
Table 1. Vmax and Km values for glucose uptake in L6 cells exposed to acute resistin treatment and resistin-expressing cells

 

Effect of resistin expression on the upstream insulin-signaling components. It is well recognized that insulin's metabolic effects are mediated primarily by the IRS-1/PI 3-kinase arm of the insulin-signaling pathway (20, 24). Binding of insulin to the {beta}-subunit of the IR activates the instrinsic kinase, which autophosphorylates IR and causes tyrosine phosphorylation of its endogenous substrates, IRS-1/2/3/4. The IRS molecule binds to the SH2-containing proteins, for example, p85 subunit of PI 3-kinase, causing activation of p110 catalytic subunit of PI 3-kinase. This in turn activates Akt, leading to activation of downstream signaling events, i.e., glucose uptake and glycogen synthesis. To examine whether resistin interferes with the activation of upstream insulin-signaling components, we examined the IR and IRS-1 tyrosine phosphorylation status and insulin-stimulated IRS-1 association with p85 subunit of PI 3-kinase after exposure of L6 cells to resistin and in L6 cell lines expressing resistin. As seen in Fig. 5, A, C, F, and G, incubation of L6 cells with exogenous resistin (Fig. 5, A and C) and expression (Fig. 5, F and G) of resistin did not alter the extent of IR and IRS-1 tyrosine phosphorylation in response to insulin. Neither p85 PI 3-kinase association with the IRS-1 was affected (Fig. 5, D and H). In addition, the contents of the IR and IRS-1 protein were not affected by incubation with resistin (Fig. 5, B and E) or by resistin expression (Fig. 5I).

Analysis of PI 3-kinase activity in the IRS-1 immunoprecipitates performed on lysates prepared from resistin-exposed, insulin-treated cells revealed no difference between control cells and those incubated with resistin (Fig. 6A). Resistin-expressing cell lines also did not exhibit alterations in PI 3-kinase activation, as evidenced by an equal amount of PI formation in response to insulin stimulation in both clones 42 and 49

(Fig. 6B). We also examined the effect of insulin on Akt phosphorylation. As shown in Fig. 7A, the magnitude of Akt phosphorylation in response to insulin was comparable between controls and those exposed to resistin. Similar results were obtained in resistin-expressing cell lines (Fig. 7B). Thus it appears that resistin did not affect the postreceptor insulin signaling events.

Recent studies from Somwar and colleagues (2325) and Sweeney et al. (28) have shown that p38 MAPK may participate in the regulation of GLUT4 activation by insulin. Because we observed a decrease in the apparent Vmax of insulin-mediated glucose uptake upon incubation with resistin (Fig. 4), we examined the kinetics of p38 MAPK phosphorylation by insulin upon acute exposure to resistin and in resistin-expressing cell lines by Western blot analysis with phosphospecific p38 MAPK antibodies. As shown in Fig. 8, A and B, insulin rapidly increased p38 MAPK phosphorylation in a time-dependent manner, with a maximal phosphorylation occurring at 10 min with a return to basal levels in 20 min. The extent of insulin-stimulated p38 MAPK phosphorylation was comparable in L6 cells exposed to resistin and those treated with insulin alone (Fig. 8A). Similarly, resistin expression did not affect the insulin effect on p38 MAPK phosphorylation in clones 42 and 49 compared with L6 Neo control (Fig. 8B). Of note, basal phospho-p38 MAPK levels in clone 49 are higher than L6 Neo control and clone 42. The reason for this elevation is not known at present.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study demonstrates a direct effect of resistin on insulin-stimulated glucose uptake in L6 skeletal muscle cells. The results of the present study clearly indicate that an acute incubation with recombinant resistin and chronic expression of resistin in L6 cells selectively inhibits insulin-stimulated glucose uptake without impinging on GLUT4 translocation to the PM and the upstream insulin-signaling components that are known to mediate insulin-stimulated glucose uptake. Thus an incubation with resistin and intracellular expression of resistin did not affect the ability of insulin to phosphorylate the IR and one of its substrates, IRS-1; neither did it affect the ability of IRS-1 to associate with the p85 subunit of PI 3-kinase and increase IRS-1-associated PI 3-kinase activity and Akt phosphorylation/activation. However, these studies do not exclude the possibility that resistin may be inhibiting the PI 3-kinase-independent pathways that mediate glucose uptake by insulin, for example, Cbl in the adipocytes (1, 16, 17). Whether or not a similar mechanism is operating in skeletal muscle is not known. In addition, recent evidence suggests that TC10, a member of the Rho family of small G proteins, also participates in insulin-mediated glucose uptake in adipocytes (5). Further studies are needed to examine the role of these proteins.

Previous studies by Steppan et al. (26) have reported impaired glucose tolerance and insulin action in mice injected with resistin. Furthermore, neutralization of resistin with anti-resistin antiserum caused a significant decrease in blood glucose in mice fed with a high-fat diet to create a mouse model of diet-induced obesity and insulin resistance (26). In addition, these authors also demonstrated that an overnight incubation of 3T3-L1 adipocytes with recombinant resistin impaired insulin-stimulated glucose uptake (26). However, the mechanism of resistin-mediated inhibition of glucose uptake was not studied by these authors. Recent in vivo studies by Rajala et al. (15) in rats suggest that resistin may be modulating insulin sensitivity by increasing the hepatic glucose output rather than inducing peripheral insulin resistance. In contrast to these observations, recent studies by Dietze et al. (7) reported that, under the in vitro coculture conditions, resistin was not secreted in substantial amounts. Nonetheless, another factor secreted by fat cells was sufficient to cause insulin resistance. However, it should be noted that these conditions are very different from the secretion of adipokines in vivo. Thus this study shows that, under the conditions used, resistin was not responsible for the insulin resistance observed. It does not rule out that resistin was unable to cause insulin resistance. Our results in skeletal muscle L6 cells extend these observations by demonstrating that resistin-mediated impairment in insulin action is the result of inhibition of insulin-stimulated glucose uptake by the skeletal muscle via reduced catalytic activity of glucose transporters rather than a decrease in the affinity of the transporters and their translocation to the PM.

There are at least three mechanisms by which insulin may modulate the function of the insulin-regulatable glucose transporter GLUT4 in the skeletal muscle and adipose tissue (reviewed in Ref. 32). First, insulin is known to promote translocation of GLUT4 from the preexisting intracellular pool to the PM (6). Second, insulin may increase the intrinsic transport activity of the preexisting GLUT4 proteins at the cell surface either by directly modifying GLUT4 or by its interactions with the other regulatory molecules (8, 32). In addition, insulin is known to upregulate the expression of GLUT4 protein itself by increased biosynthesis, decreased degradation, or both (32). Although these mechanisms are not mutually exclusive, the first model has been studied more extensively (6). Our results suggest that resistin may be interfering with insulin activation of the preexisting GLUT4 protein at the cell surface as well as the GLUT4 that is translocated in response to insulin. Our results are in agreement with the observations of Sweeney et al. (27), who demonstrated that high leptin levels directly inhibit insulin-stimulated glucose uptake in L6 muscle cells despite normal GLUT4 translocation. Furthermore, these authors attributed the inhibitory effects of leptin to a decrease in GLUT4 activation resulting from inhibition of p38 MAPK activation by insulin. In the present study, we did not observe alterations in p38 MAPK phosphorylation by insulin resulting from resistin. Therefore, the observed reductions in the intrinsic activity of glucose transporters and glucose uptake by resistin may not be because of inhibition of p38 MAPK signaling.

Although we observed an inhibition of insulin-stimulated glucose uptake by incubating L6 cells with recombinant resistin and by expressing resistin in L6 cells, which results in resistin secretion in the medium, it is still not clear how resistin might be working in L6 cells or in any cell type. It presumably needs to act on its putative receptor. Attempts to examine binding of resistin to its receptor on the cell surface by using resistin antibody yielded a diffused signal, the intensity of which increased dose dependently with resistin, indicating some interaction with cell surface proteins (data not shown). Further in-depth studies with a good resistin antibody are warranted to clearly identify the putative receptor.

In summary, our results indicate that resistin inhibits insulin-mediated glucose uptake without affecting GLUT4 translocation and insulin-signaling pathways that mediate glucose uptake. The inhibitory effect of resistin may be because of reductions in the intrinsic activity of glucose transporters.


    FOOTNOTES
 

Address for reprint requests and other correspondence: N. Begum, Diabetes Research Laboratory, Winthrop Univ. Hospital, 222 Station Plaza North, Suite 511-B, Mineola, NY 11501 (E-mail: nbegum{at}winthrop.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Baumann CA, Ribon V, Kanzaki M, Thurmond DC, Mora S, Shigematsu S, Bickel PE, Pessin JE, and Saltiel AR. CAP defines a second signaling pathway required for insulin-stimulated glucose transport. Nature 407: 202–207, 2000.[Medline]
  2. Begum N. Phenylarsine oxide inhibits insulin-stimulated protein phosphatase 1 activity and GLUT-4 translocation. Am J Physiol Endocrinol Metab 267: E14–E23, 1994.[Abstract/Free Full Text]
  3. Begum N, Sandu OA, Ito M, Lohmann SM, and Smolenski A. Active Rho kinase (ROK-alpha) associates with insulin receptor substrate-1 and inhibits insulin signaling in vascular smooth muscle cells. J Biol Chem 277: 6214–6222, 2002.[Abstract/Free Full Text]
  4. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254, 1976.[Web of Science][Medline]
  5. Chiang SH, Baumann CA, Kanzaki M, Thurmond DC, Watson RT, Neudauer CL, Macara IG, Pessin JE, and Saltiel AR. Insulin-stimulated GLUT4 translocation requires the CAP-dependent activation of TC10. Nature 410: 944–948, 2001.[Medline]
  6. Cushman SW and Wardzala LJ. Potential mechanism of insulin action on glucose transport in the isolated rat adipose cell. Apparent translocation of intracellular transport systems to the plasma membrane. J Biol Chem 255: 4758–4762, 1980.[Free Full Text]
  7. Dietze D, Koenen M, Rohrig K, Horikoshi H, Haunen H, and Eckel J. Impairment of insulin signaling in human skeletal muscle cells by co-culture with human adipocytes. Diabetes 51: 2369–2376, 2002.[Abstract/Free Full Text]
  8. Hansen PA, Wang W, Marshall BA, Holloszy JO, and Mueckler M. Dissociation of GLUT4 translocation and insulin-stimulated glucose transport in transgenic mice overexpressing GLUT1 in skeletal muscle. J Biol Chem 273: 18173–18179, 1998.[Abstract/Free Full Text]
  9. Holcomb IN, Kabakoff RC, Chan B, Baker TW, Gurney A, Henzel W, Nelson C, Lowman HB, Wright BD, Skelton NJ, Frantz GD, Tumas DB, Peale FV Jr, Shelton DL, and Hebert CC. FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. EMBO J 19: 4046–4055, 2000.[Web of Science][Medline]
  10. Kim KH, Lee K, Moon YS, and Sul HS. A cysteine-rich adipose tissue-specific secretory factor inhibits adipocyte differentiation. J Biol Chem 276: 11252–11256, 2001.[Abstract/Free Full Text]
  11. Lin KH and Cheng SY. An efficient method to purify active eukaryotic proteins from the inclusion bodies in E. coli. Biotechniques 11: 748–752, 1991.[Web of Science][Medline]
  12. Makimura H, Mizuno TM, Bergen H, and Mobbs CV. Adiponectin is stimulated by adrenalectomy in ob/ob mice and is highly correlated with resistin mRNA. Am J Physiol Endocrinol Metab 283: E1266–E1271, 2002.[Abstract/Free Full Text]
  13. Nagaev I and Smith U. Insulin resistance and type 2 diabetes are not related to resistin expression in human fat cells or skeletal muscle. Biochem Biophys Res Commun 285: 561–564, 2001.[Web of Science][Medline]
  14. Ragolia L and Begum N. The effect of modulating the glycogen-associated regulatory subunit of protein phosphatase-1 on insulin action in rat skeletal muscle cells. Endocrinology 138: 2398–2404, 1997.[Abstract/Free Full Text]
  15. Rajala MW, Obici S, Scherer PE, and Rossetti L. Adipose-derived resistin and gut-derived resistin-like molecule-B selectively impair insulin action on glucose production. J Clin Invest 111: 225–230, 2003.[Web of Science][Medline]
  16. Ribon V, Printen JA, Hoffman NG, Kay BK, and Saltiel AR. A novel, multifunctional c-Cbl binding protein in insulin receptor signaling in 3T3-L1 adipocytes. Mol Cell Biol 18: 872–879, 1998.[Abstract/Free Full Text]
  17. Ribon V and Saltiel AR. Insulin stimulates tyrosine phosphorylation of the proto-oncogene product of c-Cbl in 3T3-L1 adipocytes. Biochem J 324: 839–845, 1997.[Medline]
  18. Sandu OA, Ragolia L, and Begum N. Diabetes in the Goto-Kakizaki rat is accompanied by impaired insulin-mediated myosin-bound phosphatase activation and vascular smooth muscle cell relaxation. Diabetes 49: 2178–2189, 2000.[Abstract/Free Full Text]
  19. Savage DB, Sewter CP, Klenk ES, Segal DG, Vidal-Puig A, Considine RV, and O'Rahilly S. Resistin/Fizz3 expression in relation to obesity and peroxisome proliferator-activated receptor-gamma action in humans. Diabetes 50: 2199–2202, 2001.[Abstract/Free Full Text]
  20. Shepherd PR, Withers DJ, and Siddle K. Phosphoinositide 3-kinase: the key switch mechanism in insulin signaling. Biochem J 333: 471–490, 19986.
  21. Simpson F, Whitehead JP, and James DE. GLUT4–at the cross roads between membrane trafficking and signal transduction. Traffic 2: 2–11, 2001.[Web of Science][Medline]
  22. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartnber FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, and Klenk D. Measurement of proteins using bicinchoninic acid. Anal Biochem 150: 76–85, 1985.[Web of Science][Medline]
  23. Somwar R, Kim DY, Sweeney G, Huang C, Niu W, Lador C, Ramlal T, and Klip A. GLUT4 translocation precedes the stimulation of glucose uptake by insulin in muscle cells: potential activation of GLUT4 via p38 mitogen-activated protein kinase. Biochem J 359: 639–649, 2001.[Web of Science][Medline]
  24. Somwar R, Niu W, Kim DY, Sweeney G, Randhawa VK, Huang C, Ramlal T, and Klip A. Differential effects of phosphatidylinositol 3-kinase inhibition on intracellular signals regulating GLUT4 translocation and glucose transport. J Biol Chem 276: 46079–46087, 2001.[Abstract/Free Full Text]
  25. Somwar R, Perreault M, Kapur S, Taha C, Sweeney G, Ramlal T, Kim DY, Keen J, Cote CH, Klip A, and Marette A. Activation of p38 mitogen-activated protein kinase alpha and beta by insulin and contraction in rat skeletal muscle: potential role in the stimulation of glucose transport. Diabetes 49: 1794–1800, 2000.[Abstract]
  26. Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR, Wright CM, Patel HR, Ahima RS, and Lazar MA. The hormone resistin links obesity to diabetes. Nature 409: 307–312, 2001.[Medline]
  27. Sweeney G, Keen J, Somwar R, Konrad D, Garg R, and Klip A. High leptin levels acutely inhibit insulin-stimulated glucose uptake without affecting glucose transporter 4 translocation in L6 rat skeletal muscle cells. Endocrinology 142: 4806–4812, 2001.[Abstract/Free Full Text]
  28. Sweeney G, Somwar R, Ramlal T, Volchuk A, Ueyama A, and Klip A. An inhibitor of p38 mitogen-activated protein kinase prevents insulin-stimulated glucose transport but not glucose transporter translocation in 3T3-L1 adipocytes and L6 myotubes. J Biol Chem 274: 10071–10078, 1999.[Abstract/Free Full Text]
  29. Ueyama A, Yaworsky KL, Wang Q, Ebina Y, and Klip A. GLUT-4myc ectopic expression in L6 myoblasts generates a GLUT-4-specific pool conferring insulin sensitivity. Am J Physiol Endocrinol Metab 277: E572–E578, 1999.[Abstract/Free Full Text]
  30. Wang H, Chu WS, Hemphill C, and Elbein S. Human resistin gene: molecular scanning and evaluation of association with insulin sensitivity and type 2 diabetes in Caucasians. J Clin Endocrinol Metab 87: E2520–E2524, 2002.
  31. Wang Q, Khayat, Z Kishi, K Ebina Y, and Klip A. GLUT4 translocation by insulin in intact muscle cells: detection by a fast and quantitative assay. FEBS Lett 427: 193–197, 1998.[Web of Science][Medline]
  32. Watson RT and Pessin JE. Subcellular compartmentalization and trafficking of the insulin-responsive glucose transporter, Glut-4. Exp Cell Res 271: 75–83, 2001.[Web of Science][Medline]
  33. Way JM, Gorgun CZ, Tong Q, Uysal KT, Brown KK, Harrington WW, Oliver WR Jr, Willson TM, Kliewer SA, and Hotamisligil GS. Adipose tissue resistin expression is severely suppressed in obesity and stimulated by peroxisome proliferator-activated receptor gamma agonists. J Biol Chem 276: 25651–25653, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Reproductive SciencesHome page
D. D. Briana and A. Malamitsi-Puchner
Reviews: Adipocytokines in Normal and Complicated Pregnancies
Reproductive Sciences, October 1, 2009; 16(10): 921 - 937.
[Abstract] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. B. Jorgensen, J. Honeyman, J. S. Oakhill, D. Fazakerley, J. Stockli, B. E. Kemp, and G. R. Steinberg
Oligomeric resistin impairs insulin and AICAR-stimulated glucose uptake in mouse skeletal muscle by inhibiting GLUT4 translocation
Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E57 - E66.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. A. Junkin, D. J. Dyck, K. L. Mullen, A. Chabowski, and A. B. Thrush
Resistin acutely impairs insulin-stimulated glucose transport in rodent muscle in the presence, but not absence, of palmitate
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2009; 296(4): R944 - R951.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M.-J. Lee, H. Lin, C.-W. Liu, M.-H. Wu, W.-J. Liao, H.-H. Chang, H.-C. Ku, Y.-S. Chien, W.-H. Ding, and Y.-H. Kao
Octylphenol stimulates resistin gene expression in 3T3-L1 adipocytes via the estrogen receptor and extracellular signal-regulated kinase pathways
Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1542 - C1551.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Alkhateeb, A. Chabowski, J. F. C. Glatz, J. F. P. Luiken, and A. Bonen
Two phases of palmitate-induced insulin resistance in skeletal muscle: impaired GLUT4 translocation is followed by a reduced GLUT4 intrinsic activity
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E783 - E793.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
F. Haugen, T. Ranheim, N. K. Harsem, E. Lips, A. C. Staff, and C. A. Drevon
Increased plasma levels of adipokines in preeclampsia: relationship to placenta and adipose tissue gene expression
Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E326 - E333.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H.-S. Liu, Y.-H. Chen, P.-F. Hung, and Y.-H. Kao
Inhibitory effect of green tea (-)-epigallocatechin gallate on resistin gene expression in 3T3-L1 adipocytes depends on the ERK pathway
Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E273 - E281.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
M Mitchell, D T Armstrong, R L Robker, and R J Norman
Adipokines: implications for female fertility and obesity
Reproduction, November 1, 2005; 130(5): 583 - 597.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Y.-H. Chen, P.-F. Hung, and Y.-H. Kao
IGF-I downregulates resistin gene expression and protein secretion
Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E1019 - E1027.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Kurlawalla-Martinez, B. Stiles, Y. Wang, S. U. Devaskar, B. B. Kahn, and H. Wu
Insulin Hypersensitivity and Resistance to Streptozotocin-Induced Diabetes in Mice Lacking PTEN in Adipose Tissue
Mol. Cell. Biol., March 15, 2005; 25(6): 2498 - 2510.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
F. Haugen, N. Zahid, K. T. Dalen, K. Hollung, H. I. Nebb, and C. A. Drevon
Resistin expression in 3T3-L1 adipocytes is reduced by arachidonic acid
J. Lipid Res., January 1, 2005; 46(1): 143 - 153.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. W. Rajala, Y. Qi, H. R. Patel, N. Takahashi, R. Banerjee, U. B. Pajvani, M. K. Sinha, R. L. Gingerich, P. E. Scherer, and R. S. Ahima
Regulation of Resistin Expression and Circulating Levels in Obesity, Diabetes, and Fasting
Diabetes, July 1, 2004; 53(7): 1671 - 1679.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
R. R. Banerjee, S. M. Rangwala, J. S. Shapiro, A. S. Rich, B. Rhoades, Y. Qi, J. Wang, M. W. Rajala, A. Pocai, P. E. Scherer, et al.
Regulation of Fasted Blood Glucose by Resistin
Science, February 20, 2004; 303(5661): 1195 - 1198.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/1/E106    most recent
00457.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (70)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moon, B.
Right arrow Articles by Begum, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moon, B.
Right arrow Articles by Begum, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.