|
|
||||||||
1 Station de Recherches Avicoles, Institut National de la Recherche Agronomique, F-37380 Nouzilly, France; 2 Laboratory for Physiology of Domestic Animals, Department of Animal Production, Katholieke Universiteit Leuven, B-3001 Leuven and 3 Laboratory of Comparative Endocrinology, Katholieke Universiteit Leuven, B-3000 Leuven, Belgium; 4 Département de Biologie, Institute Supérieur de la Gombe, Kinshasa/Gombe, République Démocratique du Congo; 5 Faculdade de Ciencas Agrárias e Veterinárias, Universidade Estadual Paulista-Jaboticabal, Departamento de Zootecnia, Jaboticabal-Sao Paulo, Brazil 14870 - 000
| |
ABSTRACT |
|---|
|
|
|---|
The aim of this
study was to investigate the hormonal regulation of the avian homolog
of mammalian uncoupling protein (avUCP) by studying the impact of
thyroid hormones and insulin on avUCP mRNA expression in chickens
(Gallus gallus). For 3 wk, chicks received either a standard
diet (control group), or a standard diet supplemented with
triiodothyronine (T3; T3 group) or with the thyroid gland
inhibitor methimazole (MMI group). A fourth group received injections
of the deiodinase inhibitor iopanoic acid (IOP group). During the 4th
wk of age, all animals received two daily injections of either human
insulin or saline solution. The results indicate a twofold
overexpression of avUCP mRNA in gastrocnemius muscle of T3 birds and a
clear downregulation (
74%) in MMI chickens compared with control
chickens. Insulin injections had no significant effect on avUCP mRNA
expression in chickens. This study describes for the first time
induction of avUCP mRNA expression by the thermogenic hormone
T3 in chickens and supports a possible involvement of avUCP
in avian thermogenesis.
thyroid hormones; thermogenesis; muscle
| |
INTRODUCTION |
|---|
|
|
|---|
IN MAMMALS, mitochondrial uncoupling proteins (UCPs) are known to uncouple phosphorylation from oxidation and, hence, to be involved in energy metabolism. Brown fat UCP1 has also been reported to be involved in heat production (for review see Ref. 32). The impact of thyroid hormones on UCP expression is well documented (16, 23, 25), and UCP3 could be one mediator of the thermogenic effect of triiodothyronine (T3) in mammalian skeletal muscle (10). However, the implication of UCP3 in thermogenesis in mammals is controversial (17, 33).
As in mammals, T3 has been reported to have a role in thermoregulatory mechanisms in birds by stimulating heat production (9, 34). However, the involvement of uncoupling mechanisms in such regulation is still unclear. A recent study (31) showed that a UCP homolog called avian (av)UCP is expressed in chicken and duckling muscle. The authors suggest that avUCP is structurally close to mammalian UCP2 and UCP3 but that its function could be nearer to that of UCP1 (expressed exclusively in brown adipose tissue) in mammals. Indeed, the avUCP messenger is overexpressed in cases of cold acclimatization in ducklings and in cockerels from the R+ line presenting a high diet-induced thermogenesis (31). Recent results obtained in our laboratory (6) also suggest that the induction of avUCP mRNA expression in cold-exposed chicks is associated with increased plasma T3 concentrations and heat production. Moreover, avUCP mRNA expression has been shown to be inhibited in chickens early conditioned to heat (37), characterized by low plasma T3 concentrations (39). However, the influence of thyroid hormones on avUCP expression in chickens has not previously been clearly demonstrated.
Insulin is also known to increase mRNA expression of UCP1 in brown adipocytes (38) and UCP2 and UCP3 in rat skeletal muscle in vitro (30). It may thus also be suggested that insulin could regulate avUCP expression in chickens.
The aim of the present study was to investigate hormonal regulation of mRNA expression of avUCP, a gene potentially involved in thermogenesis, by insulin, thyroid hormones, and thyroid hormone metabolism inhibitors in chicken muscle.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Experimental design. Forty-eight 1-day-old male broiler chicks (Gallus gallus) from a commercial meat-type line (Ross) were purchased from a local hatchery (Avibel, Zoersel, Belgium) and reared in a temperature-controlled pen. The temperature was set at 30°C for the 1st wk and was gradually lowered by 2°C/wk. The lighting schedule provided 23 h of light each day, and wood shavings were used as litter. Commercial starter feed (see Ref. 4 for diet composition) was provided ad libitum until 7 days of age.
At 7 days of age, animals were randomly allocated to four floor pens and given one of the following treatments (Table 1). Two groups received a commercial grower diet in small pellets. A hypothyroid group (MMI group) received the same commercial diet mixed with 1 g/kg methimazole (Sigma Chemical, St. Louis, MO). This product inhibits the production of thyroid hormones in the thyroid gland (7). A hyperthyroid group (T3 group) received the commercial diet mixed with 1 mg of T3/kg feed (Sigma Chemical). Treatments remained unchanged during the 3rd wk of age, except for one group with the control diet that received two daily subcutaneous injections of 20 mg/kg body wt of iopanoic acid (IOP group; Sigma Chemical). This product is an inhibitor of deiodinase and thyroid hormone metabolism, especially of the conversion of thyroxine (T4) to T3 (9, 29). For the last 5 days of the experiment (week 4), chickens were subjected to their initial treatment, with addition of twice daily intramuscular injections of 0.9% saline solution or 4 U of human insulin/kg body wt (Novo Nordisk, Brussels, Belgium). All groups were fed ad libitum from week 1 to week 4. On day 5 of 4 wk of age (day 26), injections (insulin, saline solution, or iopanoic acid) were planned for birds to be slaughtered 2 h later.
|
Measurements and blood and tissue sampling. Individual body weights and group feed intakes were measured every week. In week 3 for the IOP group only and for all groups in week 4, body weights were measured every 2 days to calculate the amounts of insulin or IOP to be injected. Amounts were calculated from estimated body weights on the nonweighing days.
On the sampling day (day 26), blood was drawn from a brachial vein with a heparinized syringe and collected in ice-cold tubes to check the effects of the thyroid and insulin treatments on plasma T4 and T3 concentrations and glycemia. After the animals were killed by cervical dislocation, part of the liver and gastrocnemius muscles were excised, frozen in liquid nitrogen, and stored at
80°C for further analysis.
Expression of avUCP. avUCP mRNA expression was determined in gastrocnemius muscles by reverse transcription-polymerase chain reaction (RT-PCR). Total RNAs were isolated using an InstaPure kit (Eurogentec, Angers, France) according to the manufacturer's recommendations. RNA concentrations were estimated by measuring the absorbance at 260 nm, and purity was assessed by 260/280-nm absorbance by means of a spectrophotometer (Eppendorf, Hamburg, Germany). For RT-PCR analysis, 1 µg of total RNA was reverse transcribed with 200 U of Superscript II RT (Invitrogen, Cergy-Pontoise, France) in the presence of random hexamer primers (0.5 µg/µl, Promega). RT was carried out in the presence of 0.5 mM dNTP mix (Sigma, St-Quentin Fallavier, France) and human placenta RNAguard RNAse inhibitor (40 U, Amersham Pharmacia Biotech, Les Ulis, France). The reaction was assessed at 25°C for 15 min and at 42°C for 45 min. PCR was carried out on one-tenth of total RT product in the presence of two sets of primers flanking a 321-bp fragment of avUCP (forward: CTCTACGACTCTGTGAAGCA, reverse: TGTGTCCTTGATGAGGTCGTA), and a 148-bp fragment of 18S (forward: CGCGTGCATTTATCAGACCA, reverse: ACCCGTGGTCACCATGGTA). Annealing and extension were carried out at 58 and 72°C, respectively, over 35 cycles followed by 7 min at 72°C. Negative-control RT-PCR with DNA-free water was included in all experiments. PCR products were electrophoresed on a 1% agarose gel containing 0.075 µl/ml Vistra green (Amersham Pharmacia Biotech). The intensity of RT-PCR bands was determined using a STORM apparatus (Molecular Dynamics).
Plasma analysis. Plasma 3,3',5-triiodothyronine (T3) and T4 concentrations were measured by radioimmunoassay as described by Darras et al. (8). Intra-assay coefficients of variation were 4.5 and 5.4% for T3 and T4, respectively. Antisera and T3 and T4 standards were purchased from Byk-Belga (Brussels, Belgium).
Plasma glucose and triglyceride concentrations were determined by use of commercially available kits from Instrumentation Laboratory (Lexington, KY). Free fatty acid concentrations in plasma were measured using kits from Wako Chemicals (Neuss, Germany) modified for use with the Monarch Chemistry System (Instrumentation Laboratories, Zaventem, Belgium). Because glycemia was not depressed in the MMI birds receiving the insulin treatment, insulin concentrations were measured by radioimmunoassay on plasma samples from this group treated with insulin and from all groups treated with saline solution, as described by Simon et al. (35) by use of a guinea pig anti-porcine insulin serum (Ab 27-6, gift of G. Rosselin, Hôpital Saint-Antoine, Paris, France) and chicken insulin as standard. The intra-assay coefficient of variation was 1.7%. All measurements were run in the same assay to avoid interassay variation.Thyroid hormone hepatic concentrations. In normal chickens, liver is the main contributor to plasma T3 through intracellular conversion of T4 to T3 by type I deiodinase. Therefore, the efficiency of the treatment with the deiodinase inhibitor IOP can be evaluated from the effect on intrahepatic T3 and T4 concentrations. Thyroid hormones were extracted from livers by homogenization in methanol, extraction in chloroform-methanol (2:1) and two back-extractions in chloroform-methanol-CaCl2 0.05% (3:49:48) as described by Gordon et al. (18). The extracts were purified on Bio-Rad AG 1 × 2 resin columns and eluted in 70% acetic acid (24, 27). The addition of labeled [125I]T4 and [131I]T3 immediately after homogenization and eluate counting after purification allowed the calculation of an extraction yield, ranging from 50 to 80%, that was used for final calculations. Extracted T3 and T4 concentrations were measured by radioimmunoassay (8).
Statistics. Values for individual body weights and body weight gains for the first period (thyroid treatment weeks 2 and 3) and the second period (thyroid and insulin treatment week 4) were analyzed by one-way ANOVA with the thyroid treatment as main effect (Statview, version 5.0; SAS Institute, Cary, NC), followed by a Student-Newman-Keuls test.
Due to high heterogeneity of variance between groups, the effects of insulin treatment and thyroid treatment on thyroid hormone concentrations, plasma glucose, triglyceride, and free fatty acid concentrations, and avUCP mRNA expression were analyzed by nonparametric tests, including Kruskal-Wallis tests followed by Mann-Whitney tests. Pearson correlation coefficients were calculated between plasma T3 concentrations and avUCP mRNA expressions, between plasma and liver thyroid hormone concentrations, and between avUCP mRNA expressions and plasma free fatty acid concentrations.| |
RESULTS |
|---|
|
|
|---|
Plasma and hepatic thyroid hormone concentrations.
Plasma thyroid hormone concentrations on day 26, after both
thyroid and insulin treatments, are presented in Fig. 1, A
and B. As expected from the
pharmacological treatments, plasma T3 concentrations in
saline-treated chickens were lower in IOP and MMI groups compared with
control birds (1.87 and 0.24 vs. 3.17 pmol/ml; P < 0.01). As expected, the T3 treatment induced a threefold increase in plasma T3 concentrations (P < 0.05) compared with saline-treated birds. Plasma T3
concentrations were significantly affected by insulin treatment in the
control group (P < 0.01) and the MMI group
(P < 0.05): T3 concentrations were
depressed in the insulin-treated control group (2.3 vs. 3.2 pmol/ml),
whereas they were enhanced in the insulin-treated MMI group (0.3 vs.
0.2 pmol/ml). Plasma T3 levels tended to be reduced in the
insulin-treated T3 group compared with the saline-treated T3 group
(
50%, P = 0.10).
|
|
Plasma glucose, free fatty acid, and triglyceride concentrations.
Thyroid treatments did not significantly affect plasma glucose
concentrations in saline-treated chickens, except for IOP birds, which
exhibited slightly lower glycemia than control birds (2.05 vs. 2.63 g/l; Fig. 3). As expected, insulin
treatment decreased glycemia in the control (1.38 vs. 2.63 g/l;
P < 0.0001), IOP (1.01 vs. 2.05 g/l, P < 0.05), and especially in the T3 (0.62 vs. 2.44 g/l,
P < 0.0001) groups. However, glycemia was not affected
by insulin treatment in MMI chickens.
|
|
Expression of avUCP.
avUCP mRNA expression was positively correlated with plasma
T3 concentrations (y = 0.0127x + 0.0421, R2 = 0.4071, P < 0.001). In saline-treated birds, avUCP
mRNA expression was significantly lower in MMI chickens (
74%) and
twice as high in T3 chickens as in control birds (Fig.
4). Treatment with iopanoic acid did not
affect avUCP expression (P = 0.37). avUCP mRNA
expression was eight times higher in T3 than in MMI chickens. Insulin
treatment did not significantly affect avUCP mRNA expression,
irrespective of the thyroid treatment.
|
0.03, P = 0.86) in the
present experiment.
Feed intake and growth.
Overall feed intakes during weeks 2 and 3 of the
experiment were the highest in the control group and the lowest in the
MMI group, these chickens eating 50% less than the control group in week 3. During the 4th wk of the experiment, feed intakes in
birds receiving saline solution injections were 30, 81, 112, and 80 g · day
1 · animal
1
for the MMI, IOP, control, and T3 groups, respectively. Insulin injections reduced feed intakes in MMI, IOP, control, and T3 groups by
32, 9, 22, and 20%, respectively (Table
3).
|
| |
DISCUSSION |
|---|
|
|
|---|
Treatment with T3 or thyroid inhibitors induced clear changes in thyroid status and dramatic changes in avUCP expression in chickens. As expected, the methimazole treatment strongly depressed both plasma and liver T4 and T3 levels as a consequence of the thyroid gland dysfunction (7). The effect of iopanoic acid on T3 concentrations was less pronounced than that of methimazole, probably because of residual production of T3 by the thyroid gland (21, 22). In addition, the iopanoic treatment might not have been strong enough to inhibit deiodinases completely. This is suggested by the similar liver T3 and T4 concentrations in IOP and control chickens. It is likely that total suppression of the peripheral degradation of T4 in IOP birds would have significantly increased its plasma levels compared with control birds (9). Nevertheless, T3 addition in the diet had a clear hyperthyroid effect in T3 chickens, causing a dramatic increase in plasma and liver T3 concentrations and a decline in plasma and liver T4 levels. This is probably a consequence of the negative feedback of plasma T3 on the pituitary release of thyroid-stimulating hormone and, hence, on thyroidal release of T4 (20).
Thyroid treatment clearly affected avUCP mRNA expression in the same
way as plasma T3 concentrations, in view of the high correlation coefficient between both parameters. avUCP mRNA expression was markedly enhanced by T3 treatment, whereas it was
slightly (but nonsignificantly) depressed by IOP and dramatically
depressed by MMI treatment. The poor effect of iopanoic acid on avUCP
mRNA expression might be the result of the moderate decline in plasma T3 concentrations. The results of avUCP gene expression
would have been strengthened by measurements of protein expression by Western blot, but assays made with a heterologous antibody were not
good, and there is still a need for a specific anti-avUCP antibody. The
increase in avUCP mRNA expression in gastrocnemius muscles of
hyperthyroid chickens is consistent with previous results showing the
enhancement of UCP3 mRNA expression in skeletal muscle of
T3-stimulated rats (10, 16, 25). However, the
implication of UCP3 in thermogenesis in mammals is still being debated
(10, 17, 33). Our results are consistent with an
involvement of avUCP in thermogenesis in poultry, as suggested by
Raimbault et al. (31), where glucagon (a thermogenic
hormone) strongly stimulates the expression of this gene. The mRNA
expression of avUCP is also markedly increased in cold-acclimatized
ducklings and in chickens from the R+ energy-inefficient laying strain
(31), both of which present high heat production (1,
11, 14). In contrast, avUCP mRNA expression is reduced in early
heat-conditioned chicks, which exhibit lower internal temperatures than
nonconditioned chicks (37). It is likely that, as in
mammals with UCP1, the enhancement of thermogenesis observed in
T3-treated chickens (9) is partly mediated by
increased expression of avUCP. The enhancement of the avUCP gene
expression, together with the increases in T3
-receptor
mRNA expression,
-oxidation, and cytochrome oxidase activities,
mitochondrial respiration, and ATP synthesis observed by Mouillet
(28) in muscle of ducklings treated with thyroid hormones,
could contribute to the thermogenic action of thyroid hormones in birds.
During the last few years, many studies have focused on the roles of
mammalian uncoupling proteins UCP2 and UCP3 (12, 17, 33).
In particular, Dulloo et al. (12) suggested that UCP3 was
more involved in the regulation of lipids as fuel substrate than in
thermogenesis, and several authors have suggested that UCPs could
facilitate electrophoretic translation of fatty acid RCOO
anions through the mitochondrial internal membrane (15,
36). Indeed, UCP3 mRNA is reported to be upregulated during
fasting, which contradicts a role in maintaining thermogenesis through uncoupling mechanisms. Furthermore, nutritional factors [high-fat diet, lipid infusions, fasting (2, 19, 26)] that
upregulate the expression of this gene in skeletal muscle also
simultaneously enhance plasma free fatty acid levels (17,
40). Evock-Clover et al. (13) recently showed that
fasting and the subsequently increased plasma free fatty acid levels
were correlated with high mRNA expression of avUCP in chicken. However,
in the present study, avUCP mRNA expressions were not correlated with
plasma free fatty acid concentrations, which contradicts a role for
these plasma metabolites in the mediation of the effects of
T3 or of inhibitor of thyroid metabolism on avUCP mRNA
expression in chicken.
In the present experiment, insulin treatment did not significantly affect avUCP mRNA expression either in control or in thyroid-manipulated chickens. This result contrasts with the results observed in mammals, where clear increases in UCP1 mRNA expression were described in brown adipocytes (38) and in UCP2 and UCP3 mRNA expression in rat skeletal muscle in vitro (30). It is possible that the insulin treatment in the present experiment was not strong enough to have clear metabolic effects. However, the results shown in Fig. 3 demonstrate the dramatic effects of insulin treatment on glycemia in control, IOP, and T3 chickens, consistent with the strong effect of insulin in T3-treated birds already observed by Buyse et al. (3). The question of the effect of insulin injections remained for insulin-treated MMI birds that presented glycemia similar to that of saline-treated MMI birds. Yet plasma insulin concentrations measured by radioimmunoassay were more than ten times higher in insulin-treated MMI chickens than in saline-treated MMI birds (665 vs. 43 µU/ml). Thus the absence of effect of insulin in MMI chickens probably results from a resistance to exogenous insulin. Moreover, the present results show that plasma T3 concentrations tended to be reduced after insulin treatment and that glycemia was the most affected by insulin treatment in the T3 group. This is consistent with recent findings suggesting that glucose is a major driving force for the regulation of peripheral T3 formation (5). The interactions between thyroid status and insulin signaling must therefore be further investigated in chicken muscle. Our results suggest that, in chickens in vivo, insulin is not a strong regulator of avUCP mRNA expression. However, it is difficult to know whether a single insulin injection or a physiological insulin infusion would also have resulted in unchanged avUCP mRNA expression.
In conclusion, avUCP mRNA expression was strongly regulated by triiodothyronine and the thyroid gland inhibitor methimazole but not by insulin treatment in our conditions. However, further studies are necessary to demonstrate the role of avUCP in uncoupling mitochondria and the relationship with thyroid hormone status.
| |
ACKNOWLEDGEMENTS |
|---|
We thank G. Nackaerts, C. Borgers, A. Respen, L. Noterdaeme, W. van Ham, F. Voets, G. Reyns, and B. Six in Leuven, and S. Crochet and M. Derouet in Tours for their skilled technical assistance. R. D. Malheiros received a postdoctoral fellowship from Conselho Nacional de Desenvolvimento Científico e Tecnológico, Brazil.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: A. Collin, Station de Recherches Avicoles, Institut National de la Recherche Agronomique, F-37380 Nouzilly, France (E-mail: collin{at}tours.inra.fr).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published December 10, 2002;10.1152/ajpendo.00478.2002
Received 31 October 2002; accepted in final form 2 December 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Barré, H,
Cohen-Adad F,
and
Rouanet JL.
Two daily glucagon injections induce nonshivering thermogenesis in Muscovy ducklings.
Am J Physiol Endocrinol Metab
252:
E616-E620,
1987
2.
Boss, O,
Samec S,
Kuhne F,
Bijlenga P,
Assimacopoulos-Jeannet F,
Seydoux J,
Giacobino JP,
and
Muzzin P.
Uncoupling protein-3 expression in rodent skeletal muscle is modulated by food intake but not by changes in environmental temperature.
J Biol Chem
273:
5-8,
1998
3.
Buyse, J,
Decuypere E,
and
Simon J.
The effect of thyroid hormone status on plasma glucose-insulin interrelationship in broiler chickens.
Reprod Nutr Dev
30:
683-692,
1990[Web of Science][Medline].
4.
Buyse, J,
Janssens GP,
and
Decuypere E.
The effects of dietary L-carnitine supplementation on the performance, organ weights and circulating hormone and metabolite concentrations of broiler chickens reared under a normal or low temperature schedule.
Br Poult Sci
42:
230-241,
2001[Web of Science][Medline].
5.
Buyse, J,
Janssens K,
Van der Geyten S,
Van As P,
Decuypere E,
and
Darras VM.
Pre- and postprandial changes in plasma hormone and metabolite levels and hepatic deiodinase activities in meal-fed broiler chickens.
Br J Nutr
88:
641-653,
2002[Web of Science][Medline].
6.
Collin A, Buyse J, Van As P, Darras VM, Malheiros RD, Moraes
VMB, Reyns GE, Taouis M, and Decuypere E. Cold-induced enhancement
of avian uncoupling protein expression, heat production and
triiodothyronine concentrations in broiler chicks. Gen Comp
Endocrinol. In press.
7.
Cooper, DS.
Antithyroid drugs.
N Engl J Med
311:
1353-1362,
1984[Abstract].
8.
Darras, VM,
Visser TJ,
Berghman LR,
and
Kuhn ER.
Ontogeny of type I and III deiodinase activities in embryonic and posthatch chicks: relationship with changes in plasma triiodothyronine and growth hormone levels.
Comp Biochem Physiol
103A:
131-136,
1992.
9.
Decuypere, E,
Hermans SC,
Michels H,
Kühn ER,
and
Verheyen J.
Thermoregulatory response and thyroid hormone concentrations after cold exposure in young chicks treated with iopanoic acid and saline.
Advan Physiol Sci
33:
291-298,
1981.
10.
De Lange, P,
Lanni A,
Beneduce L,
Moreno M,
Lombardi A,
Silvestri E,
and
Goglia F.
Uncoupling protein-3 is a molecular determinant for the regulation of resting metabolic rate by thyroid hormone.
Endocrinology
142:
3414-3420,
2001
11.
Duchamp, C,
Chatonnet J,
Dittmar A,
and
Barre H.
Increased role of skeletal muscle in the calorigenic response to glucagon of cold-acclimatized ducklings.
Am J Physiol Regul Integr Comp Physiol
265:
R1084-R1091,
1993
12.
Dulloo, AG,
Samec S,
and
Seydoux J.
Uncoupling protein 3 and fatty acid metabolism.
Biochem Soc Trans
129:
785-791,
2001.
13.
Evock-Clover, C,
Poch S,
Richards M,
Ashwell C,
and
McMurtry J.
Expression of an uncoupling protein gene homolog in chickens.
Comp Biochem Physiol A
133:
345-358,
2002.
14.
Gabarrou, J-F,
Geraert PA,
Picard M,
and
Bordas A.
Diet-induced thermogenesis in cockerels is modulated by genetic selection for high or low residual feed intake.
J Nutr
127:
2371-2376,
1997
15.
Garlid, KD,
Jaburek M,
and
Jezek P.
Mechanism of uncoupling protein action.
Biochem Soc Trans
29:
803-806,
2001[Web of Science][Medline].
16.
Gong, DW,
He Y,
Karas M,
and
Reitman M.
Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, beta 3-adrenergic agonists, and leptin.
J Biol Chem
272:
24129-24132,
1997
17.
Gong, DW,
Monemdjou S,
Gavrilova O,
Leon LR,
Marcus-Samuels B,
Chou CJ,
Everett C,
Kozak LP,
Li C,
Deng C,
Harper ME,
and
Reitman ML.
Lack of obesity and normal response to fasting and thyroid hormone in mice lacking uncoupling protein-3.
J Biol Chem
275:
16251-16257,
2000
18.
Gordon, JT,
Crutchfield FL,
Jennings AS,
and
Dratman M.
Preparation of lipid-free tissue extracts for chromatographic determination of thyroid hormones and metabolites.
Arch Biochem Biophys
216:
407-415,
1982[Web of Science][Medline].
19.
Khalfallah, Y,
Fages S,
Laville M,
Langin D,
and
Vidal H.
Regulation of uncoupling protein-2 and uncoupling protein-3 mRNA expression during lipid infusion in human skeletal muscle and subcutaneous adipose tissue.
Diabetes
49:
25-31,
2000[Abstract].
20.
Klandorf, H,
Sharp P,
and
MacLeod MG.
The relationship between heat production and concentrations of plasma thyroid hormones in the domestic hen.
Gen Comp Endocrinol
45:
513-520,
1981[Web of Science][Medline].
21.
Kühn, E,
Decuypere E,
Colen M,
and
Michels H.
Posthatch growth and development of a circadian rhythm for thyroid hormones in chicks incubated at different temperatures.
Poult Sci
61:
540-549,
1982[Web of Science][Medline].
22.
Lam, S-K,
Harvey S,
and
Hall TR.
In vitro release of triiodothyronine and thyroxin from thyroid glands of the domestic fowls (Gallus domesticus).
Gen Comp Endocrinol
63:
178-185,
1986[Web of Science][Medline].
23.
Larkin, S,
Mull E,
Miao W,
Pittner R,
Albrandt K,
Moore C,
Young A,
Denaro M,
and
Beaumont K.
Regulation of the third member of the uncoupling protein family, UCP-3, by cold and thyroid hormone.
Biochem Biophys Res Commun
240:
222-227,
1997[Web of Science][Medline].
24.
Mallol, J,
Obregon MJ,
and
Morreale De Escobar G.
Analytical artifacts in radioimmunoassay of L-thyroxine in human milk.
Clin Chem
28:
1277-1282,
1982
25.
Masaki, T,
Yoshomatsu H,
Kakuma T,
Hidaka S,
Kurokawa M,
and
Sakata T.
Enhanced expression of uncoupling protein 2 gene in rat white adipose tissue and skeletal muscle following chronic treatment with thyroid hormone.
FEBS Lett
418:
323-326,
2000.
26.
Matsuda, J,
Hosoda K,
Itoh H,
Son C,
Doi K,
Tanaka T,
Fukunaga Y,
Inoue G,
Nishimura H,
Yoshimasa Y,
Yamori Y,
and
Nakao K.
Cloning of rat uncoupling protein-3 and uncoupling protein-2 cDNAs: their gene expression in rats fed high-fat diet.
FEBS Lett
418:
200-204,
1997[Web of Science][Medline].
27.
Morreale De Escobar, G,
Pastor R,
Obregon MJ,
Escobar Del,
and
Rey F.
Effects of maternal hypothyroidism on the weight and thyroid hormone content of rat embryonic tissues, before and after onset of fetal thyroid hormone: the role of the myoD gene family.
Bioassays
17:
211-218,
1985.
28.
Mouillet L. Iodothyronines et Métabolisme
Énergétique Chez le Caneton en Croissance au Froid.
PhD Thesis. University Claude Bernard-Lyon I, France, 2000.
29.
Obregon, MJ,
Pascual A,
Mallol J,
Morreale de Escobar G,
and
Escobar del Rey F.
Marked decrease of the effectiveness of T4 dose in iopanoic acid (IOP)-treated rats (Abstract).
Ann Endocrinol (Paris)
40:
A40,
1979.
30.
Pedersen, SB,
Lund S,
Buhl ES,
and
Richelsen B.
Insulin and contraction directly stimulate UCP-2 and UCP-3 mRNA expression in rat skeletal muscle in vitro.
Biochem Biophys Res Commun
283:
19-25,
2001[Web of Science][Medline].
31.
Raimbault, S,
Dridi S,
Denjean F,
Lachuer J,
Couplan E,
Bouillaud F,
Bordas A,
Duchamp C,
Taouis M,
and
Ricquier D.
An uncoupling protein homologue putatively involved in facultative thermogenesis in birds.
Biochem J
353:
441-444,
2001[Web of Science][Medline].
32.
Ricquier, D,
and
Bouillaud F.
The uncoupling protein homologues: UCP1, UCP2, UCP3, StUCP and AtUCP.
Biochem J
345:
161-179,
2000.
33.
Samec, S,
Seydoux J,
and
Dulloo AG.
Role of UCP homologues in skeletal muscles and brown adipose tissue: mediators of thermogenesis or regulators of lipids as fuel substrate?
FASEB J
12:
715-724,
1998
34.
Silva, JE.
Thyroid hormone control of thermogenesis and energy balance.
Thyroid
5:
481-492,
1995[Web of Science][Medline].
35.
Simon, J,
Freychet P,
and
Rosselin G.
Chicken insulin: radioimmunological characterization and enhanced activity in rat fat cells and liver plasma membranes.
Endocrinology
95:
1439-1449,
1974
36.
Skulachev, VP.
Anion carriers in fatty acid-mediated physiological uncoupling.
J Bioenerg Biomembr
31:
431-445,
1999[Web of Science][Medline].
37.
Taouis, M,
De Basilio V,
Mignon-Grasteau S,
Crochet S,
Bouchot C,
Bigot K,
Collin A,
and
Picard M.
Early-age thermal conditioning reduces uncoupling protein messenger RNA expression in pectoral muscle of broiler chicks at seven days of age.
Poult Sci
81:
1640-1643,
2002
38.
Teruel, T,
Valverde AM,
Navarro P,
Benito M,
and
Lorenzo M.
Inhibition of PI 3-kinase and RAS blocks IGF-I and insulin-induced uncoupling protein 1 gene expression in brown adipocytes.
J Cell Physiol
176:
99-109,
1998[Web of Science][Medline].
39.
Uni, Z,
Gal-Garber O,
Geyra A,
Sklan D,
and
Yahav S.
Changes in growth and function of chick small intestine epithelium due to early thermal conditioning.
Poult Sci
80:
438-445,
2001
40.
Weigle, DS,
Selfridge LE,
Schwartz MW,
Seeley RJ,
Cummings DE,
Havel PJ,
Kuijper JL,
and
BeltrandelRio H.
Elevated free fatty acids induce uncoupling protein 3 expression in muscle: a potential explanation for the effect of fasting.
Diabetes
47:
298-302,
1998[Abstract].
This article has been cited by other articles:
![]() |
P. Sharma, W. Bottje, and R. Okimoto Polymorphisms in Uncoupling Protein, Melanocortin 3 Receptor, Melanocortin 4 Receptor, and Pro-Opiomelanocortin Genes and Association with Production Traits in a Commercial Broiler Line Poult. Sci., October 1, 2008; 87(10): 2073 - 2086. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Collin, C. Berri, S. Tesseraud, F. E. R. Rodon, S. Skiba-Cassy, S. Crochet, M. J. Duclos, N. Rideau, K. Tona, J. Buyse, et al. Effects of Thermal Manipulation During Early and Late Embryogenesis on Thermotolerance and Breast Muscle Characteristics in Broiler Chickens Poult. Sci., May 1, 2007; 86(5): 795 - 800. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Criscuolo, M. d. M. Gonzalez-Barroso, Y. L. Maho, D. Ricquier, and F. Bouillaud Avian uncoupling protein expressed in yeast mitochondria prevents endogenous free radical damage Proc R Soc B, April 22, 2005; 272(1565): 803 - 810. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |