|
|
||||||||
Boston University School of Medicine, Boston, Massachusetts 02118
| |
ABSTRACT |
|---|
|
|
|---|
Leptin biosynthesis in adipose cells in vivo is increased by food intake and decreased by food deprivation. However, the mechanism that couples leptin production to food intake remains unknown. We found that addition of leucine to isolated rat adipocytes significantly increased leptin production by these cells, suggesting that postprandial leptin levels may be directly regulated by dietary leucine. The effect of leucine was inhibited by rapamycin and not by actinomycin D. Besides, leucine administration did not increase the amount of leptin mRNA in adipocytes. Therefore, we concluded that leucine activates leptin expression in adipose cells at the level of translation via a mammalian target of rapamycin (mTOR)-mediated pathway. Because leptin is a secreted protein, its biosynthesis is compartmentalized on the endoplasmic reticulum. To analyze mTOR signaling in this subcellular fraction, we separated adipose cells by centrifugation into a heavy membrane fraction that includes virtually all endoplasmic reticulum and the cytosolic extract. Phosphorylation of the major mTOR targets, the ribosomal protein S6 and the translational inhibitor 4E-binding protein (BP)/phosphorylated heat- and acid-stable protein (PHAS)-1, was stimulated by leucine in the cytosolic extract, whereas, in the heavy fraction, S6 was constitutively phosphorylated and leucine only induced phosphorylation of 4E-BP/PHAS-1. We also found that 60-70% of leptin mRNA was stably associated with the heavy fraction, and leucine administration did not change the ratio between compartmentalized and free cytoplasmic leptin mRNA. We suggest that, in adipose cells, a predominant part of leptin mRNA is compartmentalized on the endoplasmic reticulum, and leucine activates translation of these messages via the mTOR/4E-BP/PHAS-1-mediated signaling pathway.
mammalian target of rapamycin
| |
INTRODUCTION |
|---|
|
|
|---|
LEPTIN IS PRODUCED mainly by adipose cells and regulates food intake and whole body energy balance (36). Pursuant to this physiological role, circulating leptin levels rapidly increase after feeding (20) and decrease after food deprivation (9). Because leptin mRNA levels in adipose tissue also follow this pattern (3, 34), it has been generally accepted that leptin expression is controlled at the level of transcription (1). Although this may well be the case, the mechanism that couples food intake, or lack thereof, to leptin production in adipocytes has not yet been elucidated.
Because insulin levels respond to the nutritional status of the body, insulin itself has been suggested as a potential mediator between food intake and leptin production. Indeed, insulin increases leptin production both in vitro and in vivo (summarized in Ref. 1). However, insulin action in isolated rat adipocytes is resistant to actinomycin D, and insulin administration does not change the amount of leptin mRNA in vitro (Ref. 4 and C. Roh and K. V. Kandror, unpublished observation). This suggests that insulin may not regulate or may not exclusively regulate the ob gene expression at the level of transcription.
Alternately, leptin expression may also be regulated at a posttranscriptional level. Mammalian cells possess an important nutrient-sensing pathway that controls protein synthesis at the level of translation. A central player in this pathway is a phosphatidylinositol kinase-related protein kinase called target of rapamycin (mTOR; see Refs. 27, 32, 35). mTOR is activated by free amino acids (13, 32), especially by leucine (23) via a mechanism that is yet unknown. mTOR stimulates translation of stored mRNAs through S6- and/or phosphorylated heat- and acid-stable protein (PHAS)/4E-binding protein (BP)-mediated pathways (27, 32, 35). Both pathways are readily activated by leucine in adipocytes (Refs. 7 and 8 and Fig. 3). We proposed that mTOR may be an appropriate nutrient sensor for leptin expression in adipose cells.
In agreement with this hypothesis, we found that addition of leucine to isolated rat adipocytes significantly stimulated leptin secretion in a rapamycin-sensitive and an actinomycin D-resistant fashion. Thus dietary leucine may increase leptin production via activation of mTOR and subsequent activation of leptin mRNA translation. This mechanism may provide a long-sought-after connection between food intake and leptin levels in blood.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies. Affinity-purified polyclonal antibodies against phosphorylated S6 (Ser235/236), p70 S6 kinase (Thr389), and 4E-BP-1/PHAS-I (Ser65) were from Cell Signaling (Beverly, MA). Affinity-purified polyclonal antibody against p70 S6 kinase was from Upstate Biotechnology (Lake Placid, NY). Polyclonal antibody against 4E-BP-1/PHAS-I was characterized earlier (12). Affinity-purified polyclonal anti-calnexin antibody was from StressGen. Affinity-purified polyclonal anti-calreticulin antibody was from Affinity Bioreagents (Golden, CO).
Isolation and fractionation of rat adipocytes. Adipocytes were isolated from epididymal fat pads of male Sprague-Dawley rats (150-175 g; Taconic) by collagenase digestion (28). All animals had continuous unrestricted access to chow (TAC no. 31) and water. Usually, the fat pads from eight rats were immersed in Krebs-Ringer phosphate (KRP) buffer (12.5 mM HEPES, 120 mM NaCl, 6 mM KCl, 1.2 mM MgSO4, 1 mM CaCl2, 0.6 mM Na2HPO4, 0.4 mM Na2PO4, 2.5 mM D-glucose, and 2% BSA, pH 7.4) prepared with diethylpyrocarbonate (DEPC)-treated sterile water, minced, and subjected to collagenase digestion for 35 min at 37°C with constant shaking at 125 cycles/min. Under these conditions, we obtain 1 ml of adipocytes (1.8-2.0 mg total protein) from one rat. Adipocytes were filtered through a 300-µm nylon mesh (Safar America, Depew, NY), washed three times with KRP, and diluted 1:4 (vol/vol) with KRP. After equilibration for 20 min at 37°C with constant shaking at 25 cycles/min, cells were treated with L-leucine (5 mM; Sigma) and transferred to the incubator with 5% CO2 at 37°C for the indicated times. Cells were treated with rapamycin (100 nM; Biomol) and actinomycin D (4 µM; Sigma) 20 min before leucine administration until the end of the experiment. At the indicated time points, the cell medium was used for leptin analysis (see below), and the cells were washed two times with gradient buffer (100 mM KCl, 10 mM MgCl2, 10 mM HEPES, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 1 µM pepstatin, 1 µM aprotinin, and 10 µM leupeptin, pH 7.4, 25°C) prepared with DEPC-treated sterile water. In some experiments, phosphatase inhibitors (25 mM Na4P2O7, 50 mM NaF, and 5 mM Na3VO4) or DEPC (0.01% final concentration) together with RNAsin (Promega) were included in the buffer. After the second wash, cells in a 80-90% suspension were centrifuged at 14,000 rpm at 4°C for 20 min in a microcentrifuge. The fat layer was removed, and the supernatant and pellet were isolated for further analysis.
Isolation of mRNA and Northern blotting.
Total RNA was extracted from adipose cells or from isolated adipocyte
supernatants and pellets using Tri-Zol LS and Tri-Zol reagent,
respectively. Isolated RNA (10-20 µg) was separated in a 1%
agarose/2% formaldehyde gel in 1× MOPS (pH 7, 10 mM sodium acetate
and 1 mM EDTA) and transferred to a Hybond-N nylon membrane (Amersham)
in 10× saline-sodium citrate (SSC; American Bioanalytical) and 0.05 M
NaOH. After the transfer, the membrane and RNA were auto-cross-linked
using an ultraviolet Stratalinker (Stratagene) and subjected to
hybridization with the radiolabeled leptin DNA probe using ExpressHyb
Hybridization Solution (Clontech) according to the manufacturer's
instructions. Briefly, the blot was prehybridized in hybridization
solution for 30 min at 68°C and hybridized with radiolabeled probes
(2 × 106
counts · min
1 · ml
1)
in fresh hybridization solution for 2 h at 68°C with constant shaking. Next, the blot was washed three times with 2× SSC/0.05% SDS
at room temperature for 20 min each and then two times with 0.1×
SSC/0.1% SDS at 50°C for 30 min each and analyzed in an
Instantimager (Packard). For generating leptin and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probes, corresponding
cDNA (200 ng) was mixed with 5 µl random primers of 6mers (77 µg/ml) and sterile water in a total volume of 24 µl, incubated at
95°C for 3 min, and then placed on ice for 3 min. dNTP mix (5 µl, 1 mM each, without dCTP), 5 µl of 10× Klenow buffer, 5 µl of 0.5 mg/ml BSA, 5 µl [32P]dCTP (NEN), and 1 µl DNA
polymerase (Klenow exo-; New England Biolabs) were added to the
incubation mixture and incubated at 37°C for at least 2 h.
Unincorporated [32P]dCTP was removed by a Nuctrap push
column (Stratagene).
RT-PCR. Total RNA (4-5 µg) was reverse transcribed into cDNA using a random hexamer and RT. cDNA was amplified by PCR using the sense primer TGGCTTTGGTCCTATCTGTCTT (87-108 bp) and the anti-sense primer TCCTCACCAGCCTGCCTTCCC (310-330 bp; see Ref. 36), and the PCR product was subjected to agarose gel electrophoresis.
Immunoisolation of leptin messenger ribonucleoprotein particle with anti-PHAS-1 antibody. Sheep anti-rabbit IgG Dynabeads m-280 (250 µl; Dynal) were washed with gradient buffer and incubated with either nonspecific rabbit IgG (5 µg; Sigma) or rabbit anti-PHAS-1 antibody (5 µg) overnight at 4°C with constant rotation. Unbound antibodies were removed by washing the beads with gradient buffer containing 0.5% Triton X-100. The supernatant of the broken adipocytes was incubated with Triton X-100 (final concentration of 1%) for 30 min at 4°C and centrifuged at 4°C for 20 min at 14,000 rpm. The supernatant was incubated with the beads for 2 h at 4°C with constant rotation. The beads were then washed four times with gradient buffer containing 0.5% Triton X-100, and RNA was eluted using Tri-Zol reagent. Isolated RNA was subjected to RT-PCR.
Gel electrophoresis and Western blotting. Proteins were separated by SDS-PAGE without reducing agents and transferred to an Immobilon-P membrane (Millipore) in 25 mM Tris and 192 mM glycine, pH 8.3. After the transfer, the membrane was blocked with 10% nonfat dry milk in PBS-Tween for 1 h at room temperature. Proteins were visualized with specific antibodies, horseradish peroxidase-conjugated secondary antibodies (Sigma), and an enhanced chemiluminescent substrate kit (NEN) or a SuperSignal West Femto Maximum Sensitivity Substrate (Pierce).
RIA.
Leptin content was determined with a 125I-labeled leptin
RIA kit (Linco) according to the manufacturer's instructions. Each
sample was done in triplicate and counted for the presence of leptin in
a
-counter (Wallac).
Analysis of the secondary structure of mRNA. Secondary structure of leptin mRNA was predicted using "mfold" software by Zucker and Turner (Rensselaer Polytechnic Institute, http://bioinfo.math.rpi.edu/~mfol/rna).
| |
RESULTS |
|---|
|
|
|---|
Figure 1, A and
C, shows that addition of leucine to isolated rat adipocytes
stimulates leptin secretion from these cells. Rapamycin significantly
inhibits the leucine-induced increase in leptin secretion, suggesting
that this effect is mediated by mTOR. At the same time, the effect of
leucine is resistant to 4 µM actinomycin D (Fig. 1, B and
D). Because actinomycin D at this concentration inhibits
transcription in isolated adipocytes by 90-95% (results not
shown), leucine is likely to stimulate leptin expression at a
posttranscriptional level. To confirm this observation, we isolated RNA
from leucine-treated and nontreated adipose cells and analyzed the
levels of leptin and GAPDH mRNA by Northern blotting. In agreement with
previous studies (6), Fig. 2
shows a gradual decrease in leptin mRNA levels in isolated adipocytes.
Interestingly, a similar phenomenon was previously reported for GLUT4
mRNA (10). These changes are likely to be caused by
disturbance of as yet unknown regulatory mechanisms upon dissociation
of fat tissue into individual cells. In any case, leucine
administration does not increase leptin mRNA levels in primary
adipocytes in comparison with control (Fig. 2).
|
|
Leptin contains an NH2-terminal signal sequence
(36) that is typical of proteins synthesized in the rough
endoplasmic reticulum (ER). To analyze mTOR signaling in this
subcellular fraction, primary rat adipocytes were broken open by
centrifugation at 14,000 rpm for 20 min in a microfuge
(18). Under these conditions, heavy subcellular
organelles, including the ER, are recovered in the pellet (Fig.
3A and Ref. 18),
whereas free ribosomes and mRNP remain in the supernatant (data not
shown). In agreement with previously published results (7,
8), leucine administration to adipocytes causes an increase in
phosphorylation of the ribosomal protein S6 and of the translational
repressor 4E-BP/PHAS-1 (Fig. 3B). Both effects are likely to
be mediated by mTOR, since addition of rapamycin completely blocks
phosphorylation of these proteins. Interestingly, a leucine-induced
increase in phosphorylation of 4E-BP/PHAS-1 is detectable in both the
heavy fraction and cytosol. In contrast, phosphorylation of S6 in
response to leucine is observed only in the cytosolic fraction. In the
heavy fraction, S6 is constitutively phosphorylated irrespective of
leucine treatment. These results indicate that ER-associated ribosomes
that continuously synthesize secreted proteins contain phosphorylated
S6. Leucine-induced activation of mTOR signaling is readily detectable
even after 4 h of incubation with leucine (Fig. 3C).
These data are consistent with the dynamics of leptin secretion (Fig.
1) and suggest that stimulation of leptin expression by leucine
requires a sustained activation of translation of leptin mRNA.
|
Activation of leptin expression at the level of translation can be
accounted for by recruitment of leptin mRNA from the cytosol on ER
membranes or by activation of translation of leptin mRNA already
associated with the ER. Thus we isolated RNA separately from the heavy
fraction and from cytosol of broken adipocytes and determined the
levels of leptin mRNA in both fractions by Northern blot (Fig.
4) and by RT-PCR (data not shown). We
found that 60-70% of leptin mRNA in the cell was associated with
the heavy ER-containing fraction, whereas 30-40% of leptin
message was recovered in the cytosol where it was stored in the form of 80S mRNP particles (data not shown). Leucine administration to adipocytes did not cause a significant redistribution of leptin mRNA
between the cytosol and the ER-containing heavy fraction (Fig. 4,
A and B).
|
To confirm this result, we performed immunoprecipitation of leptin mRNA
from the cytosolic extract of adipose cells with an anti-PHAS-1
antibody. We found that leptin mRNA was specifically immunoprecipitated
with this antibody but not with nonspecific IgG (Fig.
5). This result shows that the
translational repressor PHAS-1 is associated with leptin mRNA, probably
via an interaction with the cap-binding initiation factor eukaryotic
initiation factor (eIF)-4E. In agreement with data shown in Fig. 4,
leucine administration did not significantly change the amount of
PHAS-1-associated leptin mRNA in the cytosol. Thus correct
compartmentalization of leptin mRNA in the cell may be required for its
expression and regulation, as previously shown for a variety of other
transcripts (17). We were unable to directly determine if
translation of compartmentalized leptin mRNA is regulated by PHAS
because extraction of this mRNA from the heavy pellet requires high
salt treatment that leads to dissociation of mRNA-binding proteins.
|
| |
DISCUSSION |
|---|
|
|
|---|
We show here that leptin production in isolated rat adipocytes is increased two- to threefold by leucine within 2-4 h (Fig. 1). In live rats, plasma leptin levels also rise 2.5- to 3-fold within 3 h after food intake (20). Therefore, the leucine-induced increase in leptin secretion may account for the effect observed in vivo and thus may provide a direct connection between food intake and plasma leptin levels. Leucine does not increase the amount of leptin mRNA and, also, demonstrates its effect in the presence of the transcriptional inhibitor actinomycin D (Figs. 1B and 2). For these reasons, we believe that leucine stimulates leptin expression at a posttranscriptional level. It has been shown previously that actinomycin D alone may increase leptin secretion from isolated rat adipocytes (4, 6). This unusual effect of actinomycin D may, for example, be attributed to a putative short-lived inhibitor of leptin expression that can be downregulated by actinomycin D. We have not detected a stimulatory effect of actinomycin D on leptin production (Fig. 1). This may be explained by different experimental conditions, such as a higher concentration of actinomycin D, used in our experiments. Also, we measured leptin production in actinomycin D-treated adipocytes after 4 h of incubation, whereas the stimulatory effect of the inhibitor may become readily detectable only after 24 h (6).
In any case, we found that the effect of leucine on leptin expression is sensitive to rapamycin and, therefore, is likely to be mediated by the mTOR pathway. This observation is consistent with several previously described effects. In particular, it has been known for several years that leptin expression in adipocytes depends on energy metabolism (25) and correlates very well with the level of intracellular ATP (19). Because mTOR may represent an ATP sensor in the cell (5), it may mediate the effect of ATP on leptin expression. In addition, there is a strong correlation between adipocyte size and the amount of leptin produced by the cell (reviewed in Ref. 1). Because mTOR regulates cell growth (32, 35), this correlation suggests that mTOR may be involved in both adipocyte growth and leptin expression.
mTOR exerts its biological effects via phosphorylation of ribosomal protein S6 and of the repressor 4E-BP/PHAS, which represent two independent pathways of translational control in the cell (27). The first mechanism is thought to involve expression of messages with a 5'-terminal oligopyrimidine tract, and the second mechanism is thought to be required for initiation of translation of mRNAs with double-stranded regions in the 5'-untranslated region (UTR). Translation of such mRNAs depends on the recruitment of the RNA helicase eIF-4A that, in conjunction with its protein cofactor eIF-4B, unwinds inhibitory secondary structures in the 5'-UTR, allowing the 40S ribosomal subunit to slide toward the 3'-terminus of mRNA until the initiation codon is located (11). RNA helicase eIF-4A is recruited to the initiation complex by the scaffolding protein eIF-4G, which, in turn, interacts with the cap-binding protein eIF-4E. Binding of eIF-4G and the translational repressor 4E-BP/PHAS to eIF-4E is mutually exclusive. Phosphorylation of 4E-BP/PHAS by mTOR causes its dissociation from eIF-4E, thus allowing for the interaction with eIF-4G and initiation of translation (11).
Although leucine administration to rat adipocytes activates both S6-
and 4E-BP/PHAS-mediated pathways (Fig. 3B; see also Refs. 7 and 8), translation of leptin mRNA is more likely
controlled by phosphorylation of 4E-BP/PHAS. First, leptin mRNA lacks a
5'-terminus oligopyrimidine tract but contains predicted hairpins in
the 5'-UTR (Fig. 6). Second, repressed
leptin mRNA in the cytosol is associated with PHAS-1 (Fig. 5). Third,
S6 is constitutively highly phosphorylated in the ER-associated
ribosomes that translate leptin mRNA, and leucine does not seem to have
any additional effect on phosphorylation of S6 in this fraction (Fig.
3B).
|
Approximately two-thirds of leptin mRNA is associated with the heavy membrane fraction, and only one-third is found in the cytosol in a form of 80S mRNP. We have shown that the cytosolic pool of leptin mRNA is not regulated by leucine (Figs. 4 and 5). Thus compartmentalization of leptin mRNA may be required for its expression and translational regulation. Based on our preliminary fractionation experiments, we suggest that, in adipocytes, the major pool of leptin mRNA is associated with the ER. Usually, intracellular localization of mRNA is defined by the 3'-UTR (17). Leptin mRNA has a long 3'-UTR with multiple structural elements (36) that may include a localization signal. Studies are in progress to further explore specific compartmentalization of leptin mRNA in the cell.
Because insulin is known to activate the mTOR pathway in adipocytes (21, 22, 26), we propose that the previously described effects of insulin on leptin expression (reviewed in Ref. 1) may be mediated, at least in part, by mTOR (also see Ref. 4). Although our results indicate that mTOR regulates leptin expression primarily at a posttranscriptional level, we do not exclude the possibility that, in vivo, this pathway may also be involved in the regulation of transcription of the ob gene. Experiments are in progress to test this hypothesis.
In any case, regulation of leptin production in adipose cells is controlled at several levels. In addition to transcriptional (reviewed in Ref. 1) and translational (current study) control, leptin release from adipose cells is regulated at the level of secretion. We and others have previously shown that adipose cells possess a regulatable pool of presynthesized leptin (2, 4, 30, 31, 33) that is compartmentalized in specialized insulin- and serum-regulated secretory vesicles (30, 31). We believe that a multilevel structure of leptin regulation allows for accurate adjustment of leptin secretion to match the nutritional needs of the body and for maintenance of energy homeostasis in the mammalian organism.
In particular, translational regulation of leptin mRNA by leucine via
mTOR may provide a direct connection between food intake and
postprandial leptin levels and thus may be essential for the formation
of the satiety signal. Moreover, the involvement of mTOR in the
regulation of leptin expression may help to establish a link between
insulin resistance and obesity. First, normal insulin-stimulated glucose flux in adipocytes may be required for maintaining
intracellular ATP levels and, hence, mTOR activity and normal leptin
expression. Second, the major protein in insulin-responsive
GLUT4-containing vesicles is a transmembrane leucine aminopeptidase
called insulin-regulated aminopeptidase or placental aminopeptidase
(15, 16, 29). Upon insulin administration, it is
translocated to the plasma membrane and may create a pool of free
leucine required for mTOR activation (Fig.
7). This pathway could be of particular
significance upon consumption of a carbohydrate-rich meal that may not
sufficiently increase amino acid levels in the bloodstream. In insulin
resistance, both glucose uptake and aminopeptidase translocation are
impaired (24). This may lead to "underregulation" of
the mTOR pathway, the uncoupling of leptin secretion from food intake,
and, eventually, to obesity. Thus, in addition to its direct role in
blood glucose clearance, the insulin-regulated glucose transport
machinery may have other regulatory functions. In particular, in fat,
it may provide a feedback device that controls metabolic homeostasis in
the body via mTOR-mediated production of leptin and, possibly, other
secreted products (Fig. 7).
|
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. John C. Lawrence, Jr., for the generous gift of antibodies and Anne Chau for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
This work was supported by National Institutes of Health Grants AG-00115 (to C. Roh), DK-52057 (to K. V. Kandror), and DK-56736 (to K. V. Kandror) and by a research grant from the American Diabetes Association (to K. V. Kandror).
Address for reprint requests and other correspondence: K. V. Kandror, Boston Univ. School of Medicine, Dept. of Biochemistry, K124D, 715 Albany St., Boston, MA 02118 (E-mail: kandror{at}biochem.bumc.bu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published October 1, 2002;10.1152/ajpendo.00230.2002
Received 24 May 2002; accepted in final form 24 September 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ahima, RS,
and
Flier JS.
Leptin.
Annu Rev Physiol
62:
413-437,
2000[Web of Science][Medline].
2.
Barr, VA,
Malide D,
Zarnowski MJ,
Taylor SI,
and
Cushman SW.
Insulin stimulates both leptin secretion and production by rat white adipose tissue.
Endocrinology
138:
4463-4472,
1997
3.
Becker, DJ,
Ongemba LN,
Brichard V,
Henquin JC,
and
Brichard SM.
Diet- and diabetes-induced changes of ob gene expression in rat adipose tissue.
FEBS Lett
371:
324-328,
1995[Web of Science][Medline].
4.
Bradley, RL,
and
Cheatham B.
Regulation of ob gene expression and leptin secretion by insulin and dexametasone in rat adipocytes.
Diabetes
48:
272-278,
1999[Abstract].
5.
Dennis, PB,
Jaeschke A,
Saitoh M,
Fowler B,
Kozma SC,
and
Thomas G.
Mammalian TOR: a homeostatic ATP sensor.
Science
294:
1102-1105,
2001
6.
Fain, JN,
and
Bahouth SW.
Stimulation of leptin release by actinomycin D in rat adipocytes.
Biochem Pharmacol
55:
1309-1314,
1998[Web of Science][Medline].
7.
Fox, HL,
Kimball SR,
Jefferson LS,
and
Lynch CJ.
Amino acids stimulate phosphorylation of p70S6k and organization of rat adipocytes into multicellular clusters.
Am J Physiol Cell Physiol
274:
C206-C213,
1998
8.
Fox, HL,
Pham PT,
Kimball SR,
Jefferson LS,
and
Lynch CJ.
Amino acid effects on translational repressor 4E-BP1 are mediated primarily by L-leucine in isolated adipocytes.
Am J Physiol Cell Physiol
275:
C1232-C1238,
1998
9.
Frederich, RC,
Lollmann B,
Hamann A,
Napolitano-Rosen A,
Kahn BB,
Lowell BB,
and
Flier JS.
Expression of ob mRNA and its encoded protein in rodents. Impact of nutrition and obesity.
J Clin Invest
96:
1658-1663,
1995[Web of Science][Medline].
10.
Gerrits, PM,
Olson AL,
and
Pessin JE.
Regulation of the GLUT4/muscle-fat glucose transporter mRNA in adipose tissue of insulin-deficient diabetic rats.
J Biol Chem
268:
640-644,
1993
11.
Gingras, AC,
Raught B,
and
Sonenberg N.
Regulation of translation initiation by FRAP/mTOR.
Genes Dev
15:
807-826,
2001
12.
Hu, C,
Pang S,
Kong X,
Velleca M,
and
Lawrence JC, Jr.
Molecular cloning and tissue distribution of PHAS-I, an intracellular target for insulin and growth factors.
Proc Natl Acad Sci USA
91:
3730-3734,
1994
13.
Jefferson, LS,
and
Kimball SR.
Amino acid regulation of gene expression.
J Nutr
131:
2460S-2467S,
2001
14.
Kandror, KV,
and
Pilch PF.
Compartmentalization of protein traffic in insulin-sensitive cells.
Am J Physiol Endocrinol Metab
271:
E1-E14,
1996
15.
Kandror, KV,
Yu L,
and
Pilch PF.
The major protein of GLUT4-containing vesicles, gp160, has aminopeptidase activity.
J Biol Chem
269:
30777-30780,
1994
16.
Keller, SR,
Scott HM,
Mastick CC,
Aebersold R,
and
Lienhard G.
Cloning and characterization of a novel insulin-regulated membrane aminopeptidase from GLUT4 vesicles.
J Biol Chem
270:
23612-23618,
1995
17.
Kloc, M,
Zearfoss NR,
and
Etkin LD.
Mechanisms of subcellular mRNA localization.
Cell
108:
533-544,
2002[Web of Science][Medline].
18.
Kupriyanova, TA,
Kandror V,
and
Kandror KV.
Isolation and characterization of the two major intracellular Glut4 storage compartments.
J Biol Chem
277:
9133-9138,
2002
19.
Levy, JR,
Gyarmati J,
Lesko JM,
Adler RA,
and
Stevens W.
Dual regulation of leptin secretion: intracellular energy and calcium dependence of regulated pathway.
Am J Physiol Endocrinol Metab
278:
E892-E901,
2000
20.
Levy, JR,
LeGall-Salmon E,
Santos M,
Pandak WM,
and
Stevens W.
Effect of enteral versus parenteral nutrition on leptin gene expression and release into the circulation.
Biochem Biophys Res Commun
237:
98-102,
1997[Web of Science][Medline].
21.
Lin, TA,
Kong X,
Haystead TA,
Pause A,
Belsham G,
Sonenberg N,
and
Lawrence JC, Jr.
PHAS-I as a link between mitogen-activated protein kinase and translation initiation.
Science
266:
653-656,
1994
22.
Lin, TA,
Kong X,
Saltiel AR,
Blackshear PJ,
and
Lawrence JC, Jr.
Control of PHAS-I by insulin in 3T3-L1 adipocytes. Synthesis, degradation, and phosphorylation by a rapamycin-sensitive and mitogen-activated protein kinase-independent pathway.
J Biol Chem
270:
18531-18538,
1995
23.
Lynch, CJ.
Role of leucine in the regulation of mTOR by amino acids: revelations from structure-activity studies.
J Nutr
131:
861S-865S,
2001
24.
Maianu, L,
Keller SR,
and
Garvey WT.
Adipocytes exhibit abnormal subcellular distribution and translocation of vesicles containing glucose transporter 4 and insulin-regulated aminopeptidase in type 2 diabetes mellitus: implications regarding defects in vesicle trafficking.
J Clin Endocrinol Metab
86:
5450-5456,
2001
25.
Mueller, WM,
Gregoire FM,
Stanhope KL,
Mobbs CV,
Mizuno TM,
Warden CH,
Stern JS,
and
Havel PJ.
Evidence that glucose metabolism regulates leptin secretion from cultured rat adipocytes.
Endocrinology
139:
551-558,
1998
26.
Pause, A,
Belsham GJ,
Gingras AC,
Donze O,
Lin TA,
Lawrence JC, Jr,
and
Sonenberg N.
Insulin-dependent stimulation of protein synthesis by phosphorylation of a regulator of 5'-cap function.
Nature
371:
762-767,
1994[Medline].
27.
Raught, B,
Gingras A-C,
and
Sonenberg N.
The target of rapamycin (TOR) proteins.
Proc Natl Acad Sci USA
98:
7037-7044,
2001
28.
Rodbell, M.
Metabolism of isolated fat cells. I. Effects of hormones on glucose metabolism and lipolysis.
J Biol Chem
239:
375-385,
1964
29.
Rogi, T,
Tsujimoto M,
Nakazato H,
Mizutani S,
and
Tomoda Y.
Human placental leucine aminopeptidase/oxytocinase. A new member of type II membrane-spanning zinc metalloprotease family.
J Biol Chem
271:
56-61,
1996
30.
Roh, C,
Roduit R,
Thorens B,
Fried S,
and
Kandror KV.
Lipoprotein lipase and leptin are accumulated in different secretory compartments in rat adipocytes.
J Biol Chem
276:
35990-35994,
2001
31.
Roh, C,
Thoidis G,
Farmer SR,
and
Kandror KV.
Identification and characterization of leptin-containing intracellular compartment in rat adipose cells.
Am J Physiol Endocrinol Metab
279:
E893-E899,
2000
32.
Rohde, J,
Heitman J,
and
Cardenas ME.
The TOR kinases link nutrient sensing to cell growth.
J Biol Chem
276:
9583-9586,
2001
33.
Russell, CD,
Ricci MR,
Brolin RE,
Magill E,
and
Fried SK.
Regulation of the leptin content of obese human adipose tissue.
Am J Physiol Endocrinol Metab
280:
E399-E404,
2001
34.
Saladin, R,
De Vos P,
Guerre-Millo M,
Leturque A,
Girard J,
Staels B,
and
Auwerx J.
Transient increase in obese gene expression after food intake or insulin administration.
Nature
377:
527-529,
1995[Medline].
35.
Schmelzle, T,
and
Hall MN.
TOR, a central controller of cell growth.
Cell
103:
253-262,
2000[Web of Science][Medline].
36.
Zhang, Y,
Proenca R,
Maffei M,
Barone M,
Leopold L,
and
Friedman JM.
Positional cloning of the mouse obese gene and its human homologue.
Nature
372:
425-432,
1994[Medline].
This article has been cited by other articles:
![]() |
M.-J. Lee and S. K. Fried Integration of hormonal and nutrient signals that regulate leptin synthesis and secretion Am J Physiol Endocrinol Metab, June 1, 2009; 296(6): E1230 - E1238. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Avruch, X. Long, S. Ortiz-Vega, J. Rapley, A. Papageorgiou, and N. Dai Amino acid regulation of TOR complex 1 Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E592 - E602. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pattaranit and H. A. van den Berg Mathematical models of energy homeostasis J R Soc Interface, October 6, 2008; 5(27): 1119 - 1135. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Miyamoto, Y. Yasui, T. Tanaka, H. Ohigashi, and A. Murakami Suppressive effects of nobiletin on hyperleptinemia and colitis-related colon carcinogenesis in male ICR mice Carcinogenesis, May 1, 2008; 29(5): 1057 - 1063. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. She, C. Van Horn, T. Reid, S. M. Hutson, R. N. Cooney, and C. J. Lynch Obesity-related elevations in plasma leucine are associated with alterations in enzymes involved in branched-chain amino acid metabolism Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1552 - E1563. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Lee, Y. Wang, M. R. Ricci, S. Sullivan, C. D. Russell, and S. K. Fried Acute and chronic regulation of leptin synthesis, storage, and secretion by insulin and dexamethasone in human adipose tissue Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E858 - E864. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Lee and S. K. Fried Multilevel regulation of leptin storage, turnover, and secretion by feeding and insulin in rat adipose tissue J. Lipid Res., September 1, 2006; 47(9): 1984 - 1993. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lynch, B. Gern, C. Lloyd, S. M. Hutson, R. Eicher, and T. C. Vary Leucine in food mediates some of the postprandial rise in plasma leptin concentrations Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E621 - E630. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Cammisotto, Y. Gelinas, Y. Deshaies, and L. J. Bukowiecki Regulation of leptin secretion from white adipocytes by insulin, glycolytic substrates, and amino acids Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E166 - E171. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chung, J. M. Brown, M. B. Sandberg, and M. McIntosh Trans-10,cis-12 CLA increases adipocyte lipolysis and alters lipid droplet-associated proteins: role of mTOR and ERK signaling J. Lipid Res., May 1, 2005; 46(5): 885 - 895. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Kim and J. Chen Regulation of Peroxisome Proliferator-Activated Receptor-{gamma} Activity by Mammalian Target of Rapamycin and Amino Acids in Adipogenesis Diabetes, November 1, 2004; 53(11): 2748 - 2756. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Chelikani, D. H. Keisler, and J. J. Kennelly Response of Plasma Leptin Concentration to Jugular Infusion of Glucose or Lipid Is Dependent on the Stage of Lactation of Holstein Cows J. Nutr., December 1, 2003; 133(12): 4163 - 4171. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lynch, B. Halle, H. Fujii, T. C. Vary, R. Wallin, Z. Damuni, and S. M. Hutson Potential role of leucine metabolism in the leucine-signaling pathway involving mTOR Am J Physiol Endocrinol Metab, October 1, 2003; 285(4): E854 - E863. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |