AJP - Endo Journal of Neurophysiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 283: E38-E43, 2002. First published March 12, 2002; doi:10.1152/ajpendo.00387.2001
0193-1849/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/1/E38    most recent
00387.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (49)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sreekumar, R.
Right arrow Articles by Nair, K. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sreekumar, R.
Right arrow Articles by Nair, K. S.
Vol. 283, Issue 1, E38-E43, July 2002

Effects of caloric restriction on mitochondrial function and gene transcripts in rat muscle

R. Sreekumar, J. Unnikrishnan, A. Fu, J. Nygren, K. R. Short, J. Schimke, R. Barazzoni, and K. Sreekumaran Nair

Endocrinology Division, Mayo Clinic, Rochester, Minnesota 55905


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Rodent skeletal muscle mitochondrial DNA has been shown to be a potential site of oxidative damage during aging. Caloric restriction (CR) is reported to reduce oxidative stress and prolong life expectancy in rodents. Gene expression profiling and measurement of mitochondrial ATP production capacity were performed in skeletal muscle of male rats after feeding them either a control diet or calorie-restricted diet (60% of control diet) for 36 wk to determine the potential mechanism of the beneficial effects of CR. CR enhanced the transcripts of genes involved in reactive oxygen free radical scavenging function, tissue development, and energy metabolism while decreasing expression of those genes involved in signal transduction, stress response, and structural and contractile proteins. Real-time PCR measurments confirmed the changes in transcript levels of cytochrome-c oxidase III, superoxide dismutase (SOD)1, and SOD2 that were noted by the microarray approach. Mitochondrial ATP production and citrate synthase were unaltered by the dietary changes. We conclude that CR alters transcript levels of several genes in skeletal muscle and that mitochondrial function in skeletal muscle remains unaltered by the dietary intervention. Alterations in transcripts of many genes involved in reactive oxygen scavenging function may contribute to the increase in longevity reported with CR.

rat muscle; microarrays and mitochondrial adenosine 5'-triphosphate production


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

IN LABORATORY RODENTS, caloric restriction (CR) retards several age-dependent physiological and biochemical changes in skeletal muscle, including increased steady-state levels of oxidative damage to lipids, DNA, and proteins (16, 20, 23). This retardation of aging by CR is manifested by a delayed occurrence or complete prevention of a large number of age-associated pathophysiological changes and leads to a 30-50% increase in maximum life span. CR also increases the life span of fish, spiders, rotifers, and other nonmammals (21). Several interrelated and nonexclusive explanations for the mechanism by which CR prolongs the life span in rodents have been proposed. These include decreases in oxidative stress (16), glycation or glycoxidation (7), body temperature, and circulating thyroid hormone levels associated with a hypometabolic state (18), as well as alterations in gene expression (8), protein degradation (14), and neuroendocrine changes (12). Animals with CR also showed higher antioxidative enzyme activity and lower oxidative stress, which significantly retard age-associated changes (16). Because no other intervention has been shown to retard the aging process in mammals, there is a substantial interest in this area, and active research is going on in biological gerontology concerning the mechanism by which CR retards aging in rodents. CR can induce many biological changes as a result of alterations in gene transcripts and protein expression. This makes it difficult to identify those genes or proteins that are actually implicated in the aging process. In the current study, we evaluated the impact of CR on the gene transcript profile of rat skeletal muscle, a metabolically active postmitotic organ reported to be involved in the aging process (5, 11). To evaluate the impact of nutritional intervention on gene transcript level alteration in the gastrocnemius muscle of rats, we used high-density oligonucleotide arrays representing 800 genes (U34 arrays, Affymetrix, Santa Clara, CA). We also tested a hypothesis that CR enhances the efficiency of ATP production.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Animals and experimental protocol. Male Sprague-Dawley rats were purchased from Harlan (Indianapolis, IN) at ~10 wk of age and were maintained on a standard chow diet for 2 wk. The following experiments were started after the animals were in our facility for 2 wk, and they lasted for an additional 36 wk. Animals were randomly assigned to one of two dietary groups (n = 6 animals/group). The control group ate a diet (AIN-93G, Dyets, Bethlehem, PA) consisting of protein (15%), fat (25%), carbohydrate (60%), methionine (3 g/kg), mineral mix (50 g/kg), and vitamin mix (1 g/kg). Adequate amounts of selenium (1.24 g/kg) and DL-alpha -tocopherol acetate (0.05 g/kg) were included. The calorie-restricted group (CR) received the control diet but were limited to 60% of the caloric intake of the control group. Vitamins and minerals in the chow were supplemented so that the average daily intakes were similar to those of the control animals.

Throughout the experiment, animals were individually housed in wire-bottom cages in a controlled environment (12:12-h light-dark cycle, 20-22°C, 50-60% relative humidity). Body weight and food consumption were recorded every 3 days throughout the experiment.

At the end of the study period, rats were injected with an intraperitoneal overdose of pentobarbital sodium. The gastrocnemius muscle was then quickly removed. One portion (60-70 mg) was kept in saline-soaked gauze on ice for mitochondrial studies; the remainder of the muscle was immediately frozen in isopentane cooled to the temperature of liquid nitrogen and stored at -80°C until analysis.

Analysis of gene transcripts. To determine the muscle gene transcript profile in CR groups, the relative abundance of mRNAs in this group was compared with that of the control group by use of high-density oligonucleotide microarrays containing probes for ~800 genes (U34 array, Affymetrix, Santa Clara, CA).

GeneChip expression probe array. GeneChip expression probe arrays contain collections of pairs of probes for each of the mRNAs being analyzed (9). Each probe pair consists of a 25-mer, which is perfectly complementary (referred to as a perfect match, or PM) to a subsequence of a particular message, and a companion 25-mer that is identical except for a single base difference in the central position. The mismatch (MM) probe of each pair serves as an internal control for hybridization specificity. The analysis of PM/MM pairs allows low-intensity hybridization patterns from mRNAs to be sensitively and accurately recognized in the presence of cross-hybridization signals.

RNA isolation. Total RNA was isolated from frozen muscle tissue (gastrocnemius) by use of TRIzol reagent (Life Technologies, Gaithersburg, MD), which was further purified with an affinity resin column (RNeasy, Qiagen, Chatsworth, CA). Total isolated RNA was converted to cDNA by use of the Superscript cDNA synthesis kit (GIBCO-BRL, Gaithersburg, MD). Double-stranded cDNA was then purified by phase lock gel (Eppendorf, Westbury, NY) with phenol-chloroform extraction (10).

Sample preparation, fragmentation, array hybridization, and scanning. The purified cDNA was used as a template for the in vitro transcription reaction for the synthesis of biotinylated cRNA with RNA transcript-labeling reagent (Affymetrix). This labeled cRNA was fragmented and hybridized onto the U34 array as previously described (10). Briefly, appropriate amounts of fragmented cRNA and control oligonucleotide B2 were added along with control cRNA (BioB, BioC, BioD), herring sperm DNA, and BSA to the hybridization buffer. The hybridization mixture was heated at 99°C for 5 min followed by incubation at 45°C for 5 min, before the sample was injected into the microarray. Then the hybridization was carried out at 45°C for 16 h with mixing on a rotisserie at 60 rpm. After hybridization, the solutions were removed, and the arrays were washed and stained with streptavidin-phycoerythrin (Molecular Probes, OR). After the washes, probe arrays were scanned using the Hewlett-Packard GeneChip system confocal scanner (10). The quality of the fragmented biotin-labeled cRNA in each experiment was evaluated before hybridization onto the U34 expression array, by both gel electrophoresis and sample fraction hybridization onto a test-2 array, and was analyzed as a measure of quality control. For the gene transcript analysis with the high-density microarrays, we used the pooled muscle samples (120 mg) from six rats in each group (~20 mg from each rat).

Data analysis. GeneChip 3.0 (Affymetrix) was used to scan and quantitatively analyze the scanned image. Once the probe array had been scanned, GeneChip software automatically calculated intensity values for each probe cell and made a presence or absence call for each mRNA. Algorithms in the software used probe cell intensities to calculate an average intensity for each set of probe pairs representing a gene, which directly correlated with the amount of mRNA. Spotfire (Spotfire, Cambridge, MA) and Microsoft Excel were also used for data analysis. Expression patterns for the CR group were compared with those for the control group. When assessing the difference between two RNA samples, degrees of change from side-by-side experiments on the same lot of microarrays were compared directly. In this analysis, we considered gene transcripts altered at least twofold as well as an average difference intensity >= 1,000 as significant to remove the false-positive and low-abundance genes. These genes were classified into different groups according to their metabolic function (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Gene transcript patterns in CR rats compared with control group rats

RNA isolation and cDNA synthesis for real-time PCR. Total RNA was extracted from skeletal muscle tissue (~10 mg) of each rat by the TRIzol method (Life Technologies). One microgram of total RNA from each rat and pooled RNA (1 µg of total RNA from each rat in the group) were separately treated with DNase (Life Technologies) and then reverse transcribed using the TaqMan Reverse Transcription Reagents (PE Biosystems, Foster City, CA) according to the manufacturer's instructions for real-time PCR.

Real-time PCR. Primers and probes were selected for cytochrome-c oxidase (COX) III, superoxide dismutase (SOD)1, and SOD2 by use of the Primer Express software (PE Biosystems). Details about the real-time PCR method have been described (1).

The following primer and probe sequences were used. 28S (GenBank accession no. V01270) forward primer: TGGGAA- TGCAGCCCAAAG; reverse primer: CCTTACGGTACTTGTT- GGCTATCG; probe: TGGTAAACTCCATCTAAGGCTAAATACCGGCA. SOD 1 (GenBank accession no. Y00404) forward primer: GCGGTCCAGCGGATGA; reverse primer: GTCCTTTCCAGCAGCCACAT; probe: GCCCAGGTCTCCAACATGCCT. SOD2 (GenBank accession no. Y00497) forward primer: CACGACCCACTGCAAGGAA; reverse primer: GCGTGCTCCCACACATCA; probe: ACAGGCCTTATTCCACTGCTGGG. COX III (GenBank accession no. J01435) forward primer: GAAGCCGCAGCATGATACTG; reverse primer: TTTTTTT- TTTTTTTTTTTTTTTTTTAGGATC; probe: CACTTCGTA- GATGTAGTTTGACTATTCCTATACGT. The probes for SOD1 and SOD2 genes were designed to span exon boundaries to ensure no amplification of contaminating DNA. Because the mitochondrial genome does not contain introns, the reverse primer for COX III was designed to target several of the final nucleotides specific to COX III as well as a string of the poly A+ tail that is present only in the mRNA.

We applied this highly sensitive and reproducible real-time PCR method (1) to quantify COX III, SOD1, and SOD2 mRNA. The signal for 28S ribosomal RNA was used to normalize against differences in RNA isolation, RNA degradation, and the efficiencies of the reverse transcription and PCR reactions. All samples were run in triplicate and quantitated by normalizing the COX III, SOD1, and SOD2 signals with the 28S signal. The final quantitation was achieved by a relative standard curve. We measured the transcript levels of these three genes individually both before and after pooling the total RNA from each of the six rats, and both experiments gave the same results.

Northern blot analysis of uncoupling proteins 2 and 3. cDNA probes for uncoupling protein (UCP)-2, UCP-3, and 28S rRNA transcripts were generated by RT-PCR amplification from the total RNA of control and CR rat muscle. Primers for the UCP-2 probe corresponded to nucleotides 467-490 (forward) and 1196-1205 (reverse, PCR product of 746 bp) of the rat UCP-2 sequence (GenBank accession no. AB010743). Primers for the UCP-3 probe corresponded to nucleotides 235-254 (forward) and 980-1003 (reverse, PCR product of 768 bp) of the rat UCP-3 sequence (GenBank accession no. U92069). Primers for the 28S rRNA probe corresponded to nucleotides 4203-4222 (forward) and 4370-4389 (reverse, PCR product 186 bp) of the rat ribosomal RNA genome (GenBank accession no. V01270). Amplification products were cloned into the TA-plasmid vector (TA Cloning kit; Invitrogen) as previously described (3). Total RNA isolation, Northern blotting, and hybridization to UCP-2, UCP-3, and 28S probes (in this order) were performed as described (3). Resulting images were quantified by laser densitometry (Ultroscan; Pharmacia), and UCP bands were normalized to the corresponding 28S rRNA band.

Mitochondrial ATP production rate. Mitochondria were purified from skeletal muscle, and ATP production was determined using a bioluminescent technique previously described (15, 22). Mitochondrial suspensions diluted in ATP-monitoring reagent (AMR, formula SL; BioThema, Dalarö, Finland) were added to cuvettes containing AMR, substrate, and ADP. The substrates added (in mM final concentration) were 1) 1 pyruvate plus 1 malate, 2) 1 pyruvate plus 0.05 palmitoyl-L-carnitine plus 1 malate plus 10 alpha -ketoglutarate (PPKM), 3) 1 palmitoyl-L-carnitine plus 1 malate, or 4) 10 alpha -ketoglutarate, with additional blank tubes used for measuring background. ATP production for all reactions was monitored simultaneously at 25°C with an automated routine in a BioOrbit 1251 luminometer (BioOrbit Oy, Turku, Finland). Internal calibration of each reaction cuvette was performed by addition of an ATP standard. Citrate synthase activity was measured in mitochondria and tissue homogenates, as previously described (15), and used to calculate ATP production rate.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Body weight. We measured the body weight of 12-wk-old rats (395 ± 0.2 g) just before the start of the feeding program and randomization (into control and CR groups) and also at the conclusion of the 36-wk dietary intervention. The CR rats (386 ± 8.9 g) had substantially lower body weight than the control group (626 ± 24.6 g, P < 0.01) at the end of the study.

Gene transcript levels. Comparison of gene transcript levels was made between control and CR animals. Alterations in gene transcripts involving several functions were identified (Table 1). We monitored the expression pattern of 800 genes with high-density oligonucleotide microarrays. In CR rats, 34 (up-arrow 12 and down-arrow 22) gene transcripts were altered at least twofold. These included genes involved in energy metabolism (18%), cell cycle control/growth (15%), stress response/chaperone (9%), free radical scavenging (9%), extracellular matrix protein (9%), and structural (6%), lipid (6%), and protein (6%) metabolism (Table 1).

In addition, CR rats showed a more than twofold decrease in expression of the following genes compared with control animals: Nap1 protein (proteinase,down-arrow 3.3), c-ras-H-1 (unknown function,down-arrow 2.9), porphobilinogen deaminase (heme synthesis, down-arrow 2.7), ST1B1 (unknown function,down-arrow 2.5), cyclophilin B (drug metabolism,down-arrow 2.1), guanosine monophosphate reductase (purine metabolism, down-arrow 2.1), aldose reductase (glucose metabolism, down-arrow 2.3), ATP-sensitive potassium channel-1 (ion channel, down-arrow 3.6) and Ras-related protein (signal transduction, down-arrow 2.1) (Table 1).

We have validated three of the gene transcript expression levels that were altered more than twofold in microarray analysis with the real-time PCR approach (Fig. 1). For each of the three genes (COX III, SOD1, and SOD2), mRNA levels were significantly higher in CR compared with control animals, which is consistent with the microarray data.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1.   Real-time PCR data (mRNA levels) of cytochrome-c oxidase (COX) III, superoxide dismutase (SOD)1, and SOD2 from control and calorie-restricted (CR) rats (means ± SE). The relative transcript levels in CR were higher than those in control animals for all of these genes (P < 0.01).

UCP-2 and UCP-3 expression. UCP-2 transcript levels were similar in CR rats (1.49 ± 0.16) compared with the control (1.80 ± 0.20) group. In contrast, UCP-3 transcript levels were significantly lower in CR (1.30 ± 0.73; P < 0.01) rats compared with the control animals (5.70 ± 0.99).

Mitochondrial ATP production and citrate synthase activity. Mitochondrial ATP production rate and citrate synthase activity were generally not different between the control and CR animals (Table 2). The exception was when palmitoyl carnitine was used as substrate; then the mitochondrial ATP production was higher in the CR than in the control rats.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Mitochondrial ATP production rate and citrate synthase activity in gastrocnemius muscle of control and CR rats


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The current study determined the effect of CR on gene transcript profiles and mitochondrial function in skeletal (gastrocnemius) muscle of rats. It was observed that CR for 36 wk substantially increased the transcript levels of many genes involved in reactive oxygen radical species (ROS) scavenger function and energy metabolism. In contrast, transcript levels of several genes involved in signal transduction, stress response, glucose/lipid metabolism, and structural/contractile function were reduced by CR. We have also confirmed the findings based on the microarray approach by measuring transcripts of three genes (COX III, SOD1, and SOD2) by real-time PCR. CR did not have any major impact on mitochondrial function, specifically the mitochondrial ATP production. Citrate synthase activity was also unchanged.

One of the most interesting results from the current study is that ~9% of the genes that had altered expression in the CR group encode proteins involved in free radical scavenging. The gene transcript levels of several genes involved in the dismutation of ROS, such as SOD1, SOD2, and glutathione peroxidase, were increased in the CR group compared with the control rats. SOD1 is a peroxisomal, and SOD2 is an intramitochondrial, free radical scavenging enzyme that dismutates ROS to hydrogen peroxide and molecular oxygen and is the first line of defense against accumulation of superoxides produced as a byproduct of oxidative phosphorylation. Removal of the superoxide radical by SOD1/SOD2 and hydrogen peroxide by glutathione peroxidase prevents formation of reactive hydroxyl radicals, which are postulated to be responsible for oxidative cellular injury. To test the hypothesis that chronic and unrepaired oxidative damage occurring specifically in motor neurons is a critical causative factor in aging, Parkes et al. (13) generated transgenic Drosophila that expressed human SOD1 specifically in adult motor neurons. These authors showed that overexpression of the SOD1 gene in motor neurons extends normal life span of the animals by <= 40% and rescues the life span of a short-lived SOD-null mutant. Elevated resistance to oxidative stress suggested that the life span extension observed in these flies may be due to enhanced metabolism of ROS. Wang et al. (19) demonstrated in transgenic mice with overexpression of human SOD1 that superoxide is an important mediator of postischemic injury in heart and that increased intracellular SOD1 dramatically protects the heart from this injury (19).

The upregulation of free radical scavenger enzymes, such as Mn-SOD, Cu/Zn SOD, and glutathione peroxidase I, could decrease the amount of ROS present in these muscle tissues and may prevent damage to the mitochondrial DNA in animals maintained on a CR diet. This increased transcription of the ROS scavenger genes could be one of the reasons for increased life expectancy and reduced oxidative damage in CR animals (16). CR potentially is associated not only with reduced ROS production but also with the enhanced expression of ROS scavenger genes, thus reducing oxidative damage to the tissues and prolonging life expectancy in these animals.

The CR was also characterized by the downregulation of transcript levels of genes involved in stress response/chaperone function, such as heat shock protein 70 (Hsp70), stress-inducible protein GrpE, DnaJ-like protein (RDJ1), and chaperonin 60. Heat shock-related proteins, which are thought to be involved in protection of the cytoskeleton during stress situations, were reduced in CR rats, possibly reflecting lesser oxidative stress in these CR animals. In contrast, alpha -crystallin B chain transcript was upregulated and may be representative of a protective effect on the extracellular matrix.

Of note, six genes involved in energy metabolism pathways also had increased transcript levels in the skeletal muscle of CR rats compared with muscle of control rats. These include genes associated with mitochondrial ATP production, such as six subunits of cytochrome-c oxidase (COX I, II, III, IV, Va, and VIII) and NADH dehydrogenase. NADH dehydrogenase is part of complex I, whereas cytochrome-c oxidase forms complex IV in the electron transport system and is involved in mitochondrial oxidative phosphorylation. The upregulation of these genes could increase the capacity and efficiency of electron transport and oxidative phosphorylation in CR animals. Together, these alterations in the expression of genes involved in energy metabolism and mitochondrial function would be expected to increase the skeletal muscle capacity for ATP generation in these CR rats.

However, in CR rats, muscle mitochondrial ATP production (except when palmitoyl carnitine was used as a substrate) and citrate synthase activity values were not different from those in control rats. The capacity to produce ATP was maintained in CR rats despite reduced food intake. Of interest, it was also noted that mRNA levels of UCP-3 were lower in CR rats, whereas UCP-2 mRNA level was similar between CR and control animals. There is increasing experimental evidence to indicate that these UCPs are involved in proton leak (2, 4, 6, 17). It is therefore possible that, in CR rats, proton leak was reduced. In addition, UCP-3 is predominantly expressed in muscle, and its reduced expression in CR rats could be one of the reasons for the decreased body temperature in these animals, as reported by Walford et al. (18).

Several genes involved in tissue development/growth were also altered in CR animals compared with controls. These include vascular endothelial cell growth factor, vascular cell adhesion molecule-1, various cyclin subunits (G and D1), and cyclin-dependent kinase 4 (CDK4). The expression of vascular endothelial cell growth factor was reduced 2.3-fold, and vascular cell adhesion molecule-1 was increased 2.2-fold, respectively, in CR compared with control rats. In CR rats, CDK4 (down-arrow 2.5), cyclin G (up-arrow 2.3), and cyclin D1 (down-arrow 3.7) were altered compared with the controls. In all eukaryotes, the cell cycle is governed by CDKs, whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation-dephosphorylation of serine/threonine or tyrosine residues. Cyclins are molecules that possess a consensus domain called the "cyclin box." In mammalian cells, nine cyclin species have been identified to date, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. The complex formed by CDK4 and the D-type cyclins (D1-D3) is involved in the control of cell proliferation during the G1 phase of cell division. It appears from this study that all of these cell growth and proliferation gene transcripts are substantially influenced by CR.

To validate these observations in the microarray experiment, we measured the gene transcript levels of COX III, SOD1, and SOD2, the expression of which was at least twofold, by use of real-time PCR (Fig. 1). The gene transcript level of COX III, a mitochondrial encoded subunit of cytochrome-c oxidase, was induced 200% (P < 0.01) in CR animals compared with the controls. Also, CR significantly increased the SOD1 (up-arrow 287%) and the SOD2 (up-arrow 163%) gene transcript levels, respectively, compared with the control animals (P < 0.01).

The current study clearly demonstrated that CR has profound effects on transcript levels of several genes in skeletal muscle. The potential impact of these genes on muscle function was not fully evaluated in this study. However, the current study demonstrated that reduced caloric intake had no impact on muscle mitochondrial ATP production. A lack of increased ATP production despite the increase in some mitochondrial respiratory chain gene transcripts may have occurred either because of the lack of similar rate of translation of these transcripts to the corresponding proteins or the lack of increase in one or more rate-limiting enzymes for ATP production. It is not clear from the current study whether all of these mRNA changes are translated into proteins. One way of determining the translation of the gene transcripts is by measuring the synthesis rates of individual proteins. The current technology does not allow such studies. This study, however, provided substantial evidence to support the concept that CR in rodents increases the transcription of genes involved in protection of cells from ROS damage.

In summary, the changes in gene transcripts induced by CR are demonstrated in the current study (Table 3). One key observation is the demonstration that CR in rats results in induction of gene transcripts involved in the free radical scavenger pathway, suggesting less oxidative stress (16). These findings may partially explain the longer life expectancy in CR animals. Additionally, our analysis indicates that CR may maintain the capacity for ATP production by enhancing the expression of the relevant genes. These changes, along with the alterations in UCP-3, may explain an adaptive response that results in ATP production being unaffected by alterations in diet.

                              
View this table:
[in this window]
[in a new window]
 
Table 3.   Global view of gene transcript changes in CR rats


    ACKNOWLEDGEMENTS

We are grateful to Jane Kahl, Dawn Morse, Deborah Rasmussen, and Becca Kurup for technical support.


    FOOTNOTES

This study was supported by National Institute on Aging Grant R01 AG-09531, the David Murdock Professorship (K. S. Nair), and the Mayo Foundation. K. Short was supported by a postdoctoral training National Research Service award and National Institute of Diabetes and Digestive and Kidney Diseases Grant T32-DK-07352.

Address for reprint requests and other correspondence: K. S. Nair, Mayo Clinic & Foundation, 200 1st St. SW, Rm 5-194 Joseph, Rochester, MN 55905 (E-mail: nair.sree{at}mayo.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published March 12, 2002;10.1152/ajpendo.00387.2001

Received 27 August 2001; accepted in final form 1 February 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Balagopal, P, Schimke JC, Ades PA, Adey DB, and Nair KS. Age effect on transcript levels and synthesis rate of muscle MHC and response to resistance exercise. Am J Physiol Endocrinol Metab 280: E203-E208, 2001[Abstract/Free Full Text].

2.   Barazzoni, R, Short KR, and Nair KS. Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver and heart. J Biol Chem 275: 3343-3347, 2000[Abstract/Free Full Text].

3.   Barazzoni, R, and Nair KS. Changes in uncoupling protein-2 and -3 expression in aging rat skeletal muscle, liver, and heart. Am J Physiol Endocrinol Metab 280: E413-E419, 2001[Abstract/Free Full Text].

4.   Clapham, JC, Arch JRS, Chapman H, Haynes A, Lister C, Moore GBT, Piercy V, Carter SA, Lehner I, Smith SA, Beeley LJ, Godden RJ, Herrity N, Skehel M, Changani KK, Hockings PD, Reid DG, Squires SM, Hatcher J, Trail B, Latcham J, Rastan S, Harper AJ, Cadenas S, Buckingham JA, Brand MD, and Abuin A. Mice overexpressing human uncoupling protein-3 in skeletal muscle are hyperphagic and lean. Nature 406: 415-418, 2000[Medline].

5.   Evans, WJ. What is sarcopenia? J Gerontol 50A: 5-8, 1995.

6.   Gong, DW, Monemdjous S, Gavrilova O, Leon LR, Marcus SB, Chou CJ, Everett C, Kozak LP, Li C, Deng C, Harper ME, and Reitman ML. Lack of obesity and normal response to fasting and thyroid hormone in mice lacking uncoupling protein-3. J Biol Chem 275: 16251-16257, 2000[Abstract/Free Full Text].

7.   Kristal, BA, and Yu BP. An emerging hypothesis: synergistic induction of aging by free radicals and maillard reactions. J Gerontol Biol Sci 47: B107-B114, 1992.

8.   Lee, CK, Klopp RG, Weindruch R, and Prolla TA. Gene expression profile of aging and its retardation by caloric restriction. Science 285: 1390-1393, 1999[Abstract/Free Full Text].

9.   Lockhart, DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, and Brown EL. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nature Biotechnol 14: 1675-1680, 1996[Web of Science][Medline].

10.   Mahadevappa, M, and Warrington JA. A high-density probe array sample preparation method using 10- to 100-fold fewer cells. Nature Biotechnol 17: 1134-1136, 1999[Web of Science][Medline].

11.   McCarter, RJ. Age-related changes in skeletal muscle function. Aging Clin Exp Res 2: 27-38, 1990.

12.   Nelson, JF, Karelus K, Bergman MD, and Felicio LS. Neuroendocrine involvement in aging---evidence from studies of reproductive aging and caloric restriction. Neurobiol Aging 16: 837-843, 1995[Web of Science][Medline].

13.   Parkes, TL, Elia AJ, Dicknson D, Hilliker AJ, Phillips JP, and Boulianne GL. Extension of Drosophila lifespan by overexpression of human SOD1 in motor neurons. Nature Genet 19: 171-174, 1998[Web of Science][Medline].

14.   Remmen, VH, Ward WF, Sabia RV, and Richardson A. Gene expression and protein degradation. In: Handbook of Physiology. Aging. Bethesda, MD: Am. Physiol. Soc, 1995, section 11, chapt. 9, p. 171-234.

15.   Short, KR, Nygren J, Barazzoni R, Levine J, and Nair KS. T3 increases mitochondrial ATP production in oxidative muscle despite increased expression of UCP2 and UCP3. Am J Physiol Endocrinol Metab 280: E761-E769, 2001[Abstract/Free Full Text].

16.   Sohal, RS, and Weindruch R. Oxidative stress, caloric restriction, and aging. Science 273: 59-63, 1996[Abstract].

17.   Vidal, PAJ, Grujic D, Zhang CY, Hagen T, Boss O, Ido Y, Szczepanik A, Wade J, Mootha V, Cortright R, Muoio DM, and Lowell BB. Energy metabolism in uncoupling protein-3 gene knockout mice. J Biol Chem 275: 16258-16266, 2000[Abstract/Free Full Text].

18.   Walford, RL, and Spindler SR. The response to calorie restriction in mammals shows features also common to hibernation---a cross-adaptation hypothesis. J Gerontol Biol Sci 52: B179-B183, 1997.

19.   Wang, P, Chen H, Sankarapandi S, Becher MW, Wong PC, and Zweier JL. Overexpression of human copper,zinc superoxide dismutase (SOD1) prevents postischemic injury. Proc Natl Acad Sci USA 95: 4556-4560, 1998[Abstract/Free Full Text].

20.   Weindruch, R. Interventions based on the possibility that oxidative stress contributes to sarcopenia. J Gerontol Series A Biol Sci Med Sci 50: 157-161, 1995.

21.   Weindruch, R, and Walford RL. The Retardation of Aging and Disease by Dietary Restriction. Springfield, IL: CC Thomas, 1988.

22.   Wibom, R, Lundin A, and Hultman E. A sensitive method for measuring ATP-formation in rat muscle mitochondria. Scand J Clin Lab Invest 50: 143-152, 1990[Web of Science][Medline].

23.   Yu, BP. Aging and oxidative stress: modulation by dietary restriction. Free Radic Biol Med 21: 651-668, 1996[Web of Science][Medline].


Am J Physiol Endocrinol Metab 283(1):E38-E43
0193-1849/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
J Gerontol A Biol Sci Med SciHome page
D. T. Hwee and S. C. Bodine
Age-Related Deficit in Load-Induced Skeletal Muscle Growth
J Gerontol A Biol Sci Med Sci, June 1, 2009; 64A(6): 618 - 628.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. T. Hepple, M. Qin, H. Nakamoto, and S. Goto
Caloric restriction optimizes the proteasome pathway with aging in rat plantaris muscle: implications for sarcopenia
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1231 - R1237.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J. Lu, L. Xie, J. Sylvester, J. Wang, J. Bai, R. Baybutt, and W. Wang
Different Gene Expression of Skin Tissues Between Mice with Weight Controlled by Either Calorie Restriction or Physical Exercise
Experimental Biology and Medicine, April 1, 2007; 232(4): 473 - 480.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
L. Fontana and S. Klein
Aging, Adiposity, and Calorie Restriction
JAMA, March 7, 2007; 297(9): 986 - 994.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. D. Seidel, S.-C. Hung, H Lynn Kan, and B Bhaskar Gollapudi
Background Gene Expression in Rat Kidney: Influence of Strain, Gender, and Diet
Toxicol. Sci., November 1, 2006; 94(1): 226 - 233.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
G. Johnson, D. Roussel, J.-F. Dumas, O. Douay, Y. Malthiery, G. Simard, and P. Ritz
Influence of intensity of food restriction on skeletal muscle mitochondrial energy metabolism in rats
Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E460 - E467.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
D. J. Baker, A. C. Betik, D. J. Krause, and R. T. Hepple
No decline in skeletal muscle oxidative capacity with aging in long-term calorically restricted rats: effects are independent of mitochondrial DNA integrity.
J. Gerontol. A Biol. Sci. Med. Sci., July 1, 2006; 61(7): 675 - 684.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
C. E. Finch
A perspective on sporadic inclusion-body myositis: The role of aging and inflammatory processes
Neurology, January 24, 2006; 66(1_suppl_1): S1 - S6.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
P. G. Giresi, E. J. Stevenson, J. Theilhaber, A. Koncarevic, J. Parkington, R. A. Fielding, and S. C. Kandarian
Identification of a molecular signature of sarcopenia
Physiol Genomics, April 14, 2005; 21(2): 253 - 263.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
R. Barazzoni, A. Bosutti, M. Stebel, M. R. Cattin, E. Roder, L. Visintin, L. Cattin, G. Biolo, M. Zanetti, and G. Guarnieri
Ghrelin regulates mitochondrial-lipid metabolism gene expression and tissue fat distribution in liver and skeletal muscle
Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E228 - E235.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. R. Short, B. Drew, and C. Leeuwenburgh
Mitochondrial ATP measurements
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2004; 287(1): R243 - R246.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. Bevilacqua, J. J. Ramsey, K. Hagopian, R. Weindruch, and M.-E. Harper
Effects of short- and medium-term calorie restriction on muscle mitochondrial proton leak and reactive oxygen species production
Am J Physiol Endocrinol Metab, June 1, 2004; 286(5): E852 - E861.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. Drew and C. Leeuwenburgh
Method for measuring ATP production in isolated mitochondria: ATP production in brain and liver mitochondria of Fischer-344 rats with age and caloric restriction
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2003; 285(5): R1259 - R1267.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
H. Kato and T. Kimura
Evaluation of the Effects of the Dietary Intake of Proteins and Amino Acids by DNA Microarray Technology
J. Nutr., June 1, 2003; 133(6): 2073S - 2077.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. Drew, S. Phaneuf, A. Dirks, C. Selman, R. Gredilla, A. Lezza, G. Barja, and C. Leeuwenburgh
Effects of aging and caloric restriction on mitochondrial energy production in gastrocnemius muscle and heart
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2003; 284(2): R474 - R480.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/1/E38    most recent
00387.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (49)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sreekumar, R.
Right arrow Articles by Nair, K. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sreekumar, R.
Right arrow Articles by Nair, K. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online