|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Division of Endocrinology, Metabolism, and Molecular Medicine, Charles R. Drew University of Medicine and Science, Los Angeles, 90059; and 2 Division of Respiratory and Critical Care Physiology and Medicine, Harbor-University of California at Los Angeles Medical Center, Torrance, California 90509
| |
ABSTRACT |
|---|
|
|
|---|
Administration
of replacement doses of testosterone to healthy hypogonadal men and
supraphysiological doses to eugonadal men increases muscle size. To
determine whether testosterone-induced increase in muscle size is due
to muscle fiber hypertrophy, 61 healthy men, 18-35 yr of age,
received monthly injections of a long-acting gonadotropin-releasing
hormone (GnRH) agonist to suppress endogenous testosterone secretion
and weekly injections of 25, 50, 125, 300, or 600 mg testosterone
enanthate (TE) for 20 wk. Thigh muscle volume was measured by magnetic
resonance imaging (MRI) scan, and muscle biopsies were obtained from
vastus lateralis muscle in 39 men before and after 20 wk of combined
treatment with GnRH agonist and testosterone. Administration of GnRH
agonist plus TE resulted in mean nadir testosterone concentrations of 234, 289, 695, 1,344, and 2,435 ng/dl at the 25-, 50-, 125-, 300-, and
600-mg doses, respectively. Graded doses of testosterone administration were associated with testosterone dose and concentration-dependent increase in muscle volume measured by MRI (changes in vastus lateralis volume,
4, +7, +15, +32, and +48 ml at 25-, 50-, 125-, 300-, and
600-mg doses, respectively). Changes in cross-sectional areas of both
type I and II fibers were dependent on testosterone dose and
significantly correlated with total (r = 0.35, and
0.44, P < 0.0001 for type I and II fibers,
respectively) and free (r = 0.34 and 0.35, P < 0.005) testosterone concentrations during
treatment. The men receiving 300 and 600 mg of TE weekly experienced
significant increases from baseline in areas of type I (baseline vs. 20 wk, 3,176 ± 186 vs. 4,201 ± 252 µm2,
P < 0.05 at 300-mg dose, and 3,347 ± 253 vs.
4,984 ± 374 µm2, P = 0.006 at
600-mg dose) muscle fibers; the men in the 600-mg group also had
significant increments in cross-sectional area of type II (4,060 ± 401 vs. 5,526 ± 544 µm2, P = 0.03) fibers. The relative proportions of type I and type II fibers did
not change significantly after treatment in any group. The myonuclear
number per fiber increased significantly in men receiving the 300- and
600-mg doses of TE and was significantly correlated with testosterone
concentration and muscle fiber cross-sectional area. In conclusion, the
increases in muscle volume in healthy eugonadal men treated with graded
doses of testosterone are associated with concentration-dependent
increases in cross-sectional areas of both type I and type II muscle
fibers and myonuclear number. We conclude that the testosterone induced
increase in muscle volume is due to muscle fiber hypertrophy.
androgen; muscle hypertrophy; satellite cells; mechanism of action
| |
INTRODUCTION |
|---|
|
|
|---|
TESTOSTERONE ADMINISTRATION in replacement doses to hypogonadal men (9, 12, 26, 43, 46) and in supraphysiological doses to healthy eugonadal men (8, 16, 18, 49) is associated with significant increases in fat-free mass and muscle size. Similarly, testosterone replacement in men infected with the human immunodeficiency virus, who are experiencing weight loss and have low testosterone levels, induces significant gains in lean body mass with concomitant increases in muscle volume (7, 10, 19). We have recently demonstrated that changes in circulating testosterone concentrations, induced by combined administration of gonadotropin-releasing hormone (GnRH) agonist and graded doses of testosterone, are associated with testosterone dose- and concentration-dependent changes in fat-free mass and muscle size (11). However, the mechanisms by which testosterone increases muscle mass are not well understood. We do not know whether testosterone-induced increase in muscle mass is due to muscle fiber hypertrophy, muscle cell hyperplasia, or both. The effects of testosterone administration on muscle fiber size and composition in humans are unknown, and the data from experimental animals are both limited and somewhat contradictory. For instance, in a study by Tucek et al. (45), testosterone treatment of castrated rats led to a 15% increase in the weight of the levator ani muscle; this increase in muscle mass was accompanied by an increase in the size of muscle fibers. Tobin and Joubert (44) reported a significant sex difference in both the number of fibers and their average cross-sectional areas for levator ani muscle and speculated that the higher fiber number and size in the male rats might be related to the higher testosterone levels. However, a recent study (17) did not find any differences in the cross-sectional areas of fast- and slow-twitch fibers between older men and women with vastly different androgen concentrations.
Therefore, the overall objective of the present study was to determine whether testosterone-induced increase in muscle size is due to increase in muscle fiber area or number or both. We treated healthy young men with a long-acting GnRH agonist to suppress their endogenous testosterone production and one of five different doses of testosterone enanthate to create different circulating testosterone concentrations. Muscle biopsies were obtained before and after 20 wk of combined treatment with GnRH agonist and testosterone to determine the morphometric changes in muscle fibers of vastus lateralis muscle. We assessed whether the morphometric changes in the vastus lateralis muscle fibers were correlated with testosterone dose and circulating testosterone concentrations and whether these changes were fiber type specific.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Subjects. This was a double-blind, randomized study. The details of the study design have been previously published (11). Briefly, the participants were 61 healthy eugonadal men, 18-35 yr of age. Each participant provided informed consent approved by the institutional review boards of Charles R. Drew University and Harbor-UCLA Research and Education Institute. Participants were randomly assigned to one of five experimental groups to receive monthly injections of a long-acting GnRH agonist to suppress endogenous testosterone production and weekly injections of 25, 50, 125, 300, or 600 mg of testosterone enanthate for 20 wk. The lowest testosterone dose regimen, 25 mg/wk, was selected because previous studies had shown that this weekly dose of testosterone can maintain sexual function in GnRH antagonist-treated men (35). The selection of the 600-mg weekly regimen was based on the consideration that this was the highest dose of testosterone enanthate that had been shown to be safe and effective in increasing muscle size and strength in healthy eugonadal men in short-term clinical trials (8). The staff of the General Clinical Research Center administered testosterone and GnRH agonist injections to ensure compliance.
Of the 61 men, who were randomized, 54 completed all phases of the study (11). Thus body composition and muscle volume data were available on 54 men. Of these, 39 men underwent pre- and posttreatment muscle biopsies: nine in the 25-mg group, seven in the 50-mg group, eight in the 125-mg group, nine in the 300-mg group, and six in the 600-mg group. Nutritional intake and exercise stimulus were controlled at the outset of the study, as previously described (11). Two weeks before the initiation of the study, subjects were prescribed a diet standardized for energy intake at 150 kJ · kg
1 · day
1 and protein
intake at 1.3 g · kg
1 · day
1. These
instructions were reinforced every 4 wk during a meeting with the
dietitian, in which subject's actual nutrient intake was verified by
analysis of 3-day food records.
Hormone assays. Serum total testosterone was measured by a previously reported radioimmunoassay (7-11). Free testosterone was separated by an equilibrium dialysis procedure and measured by radioimmunoassay (42). The sensitivity of total testosterone assay was 0.6 ng/dl; intra-assay coefficient of variation was 8.2%, and interassay coefficient of variation was 13.2%. For free testosterone assay, the sensitivity was 0.22 pg/ml, and intra- and interassay coefficients of variation were 4.2 and 12.3%.
Quadriceps muscle volume. The volume of the quadriceps muscle group was measured by magnetic resonance imaging (MRI; Signa Horizons LX Scanner, General Electric Medical Systems, Milwaukee, WI) before and after 20 wk of treatment. The software used for data acquisition was Signa MR Scan Assistant, version 8.3. Subjects entered the body coil feet first and lay in a supine position with the heels in a neutral position. MRI scans were obtained for the entire thigh, with the first slice taken at the distal border of the lateral femoral condyle. A total of 17 slices, each of 10 mm thickness, was taken. The thigh muscle volume was then calculated by integrating the transverse slices by use of commercially available software (General Electric Volume Analysis Software, AW version 3.1, Milwaukee, WI). Accuracy of the volume analysis software was determined by scanning and analyzing a phantom cylinder of known dimensions. Duplicate manual tracings were drawn around the outermost edge of the entire thigh (total thigh), the skeletal musculature (to subtract out subcutaneous fat), and the femur (to subtract out femoral bone areas). The quadriceps musculature was measured by manually tracing around the vastus lateralis, vastus medialis, vastus intermedius, and rectus femoris muscles. The middle transverse slice with the largest diameter was used to measure cross-sectional areas of the vastus lateralis. A single individual, who was unaware of the group assignments, performed all of the analyses.
Muscle biopsy and tissue fixation. Percutaneous needle muscle biopsies were obtained from the midbelly of the vastus lateralis muscle in the quadriceps muscle group before and within 5 days after the final testosterone enanthate injection. Each muscle biopsy was divided into two portions; one portion was fixed in 10% formalin and the other in Bouin's fixative. Both formalin- and Bouin's-fixed tissues were oriented on their longitudinal axis and embedded in paraffin and used for light microscopic, morphometric, and immunohistochemical studies. In some individuals, in whom additional muscle tissue was available, the tissue was snap-frozen in liquid nitrogen in a solution of RNAase for subsequent extraction of RNA.
Muscle fiber typing. Muscle fibers in the vastus lateralis were identified as type I and type II fibers by immunohistochemical staining using a mouse monoclonal antibody (clone MY 32, Sigma, St Louis, MO) specific for the heavy chain of fast myosin. This antibody recognizes all subtypes of type II myosin heavy chain (MHC) but does not cross-react with type I MHC (3, 4, 22). Both the formalin- and Bouin's-fixed 6-µm tissue sections were immunostained using the diaminobenzidine tetrahydrochloride-based detection method (Vectastain-Elite ABC kit, Vector Labs). The slides were counterstained with Harris hematoxylin. Tissue sections that were incubated with mouse IgG instead of the primary antibody served as negative controls.
In 19 men in whom sufficient biopsy material was available, we measured the relative mRNA concentrations of human MHC isotypes I, IIa, IIb, and IIx by reverse transcription and polymerase chain reaction (RT-PCR). The concentration of RNA, isolated by TRIzol, was estimated by spectrophotometry and verified by nondenaturing agarose gel electrophoresis, ethidium bromide staining, and densitometry of the 28S and 18S bands. MHC mRNA isotypes were determined by modification of a published procedure (48) for rat MHC isotypes. Briefly, 0.6-1 µg of total RNA was reverse transcribed with poly(dT) primer, and aliquots of this reaction were submitted to PCR utilizing a forward primer within a region identical for the four human MHC subtypes (AAGG CCAAGAAGGCCATCAC) and reverse primers that were specific for MHC I (TCCAGCTCATTCTTCAGCTC), MHC IIa (TGCCTGAAGTTTATCTACCA), MHC IIb (GGTTTGCAATTTGTCCACCA), or MHC IIx (CTTGCAGCTTGTCCACCAGG). A fifth reaction was conducted for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a "housekeeping" gene. PCR conditions for each primer set were optimized utilizing the thermal Robocycler (Stratagene, La Jolla, CA), and the final reaction conditions were standardized at 92°C for 5 min, followed by 25 cycles at 92°C for 1 min, 58°C for 1 min, and 72°C for 1 min and an extension at 72°C for 10 min. The expected amplified DNA fragment sizes were: MHC I, 221 bp, MHC IIa, 360 bp, MHC IIb, 360 bp, MHC IIx, 358 bp, and GAPDH, 1,100 bp. The intensity of the PCR product was determined by densitometry and corrected by the amount of 28S RNA or the intensity of the GAPDH band. Because our data were derived by using the RT-PCR technique, we considered the possibility that the observed expression might be due to amplification of a closely related mRNA species (perhaps another MHC isoform). To exclude this possibility, we sequenced the product of RT-PCR for IIb mRNA. The sequence was identical to the one reported in the literature and in GenBank for the human MHC type IIb. These data provide unequivocal evidence that MHC isoform IIb mRNA is expressed in vastus lateralis.Morphometry.
The immunohistochemically stained slides were used for morphometric
evaluation using an RG-3 grid (square lattice with 121 intersections)
in a Leitz Wetzler (HM-LUX) microscope. An observer who was unaware of
the group assignments evaluated all the slides. Fiber typing was
carried out by directly counting type I and type II muscle fibers in a
known area (9,216 × 15 µm2) of tissue sections. We
counted
500 muscle fibers in each biopsy specimen. The relative
abundance of type I and II fibers was expressed as a percentage of the
total fiber number.
Counting of blood capillaries. Sections from Bouin's-fixed tissues were stained for alkaline phosphatase activity to identify all of the capillaries surrounding the muscle fibers. The capillaries were counted at a total magnification of ×400 by use of a square frame in the eyepiece of the microscope, and expressing the amount as capillary density per unit area [unit area = 600 µm2 (14, 40)]. The fiber-to-capillary ratio was obtained by counting all of the capillaries and fibers in five artifact-free unit areas in each section.
Statistical analyses. All data are presented as means ± SE for each of the five treatment groups. We used one-way ANOVA to compare between-group differences in the change from baseline in each outcome measure. The main outcome measures were change from baseline in muscle fiber number, relative proportion of type I and type II fibers, cross-sectional areas of type I and type II fibers, number of myonuclei per muscle fiber, capillary density, total testosterone, free testosterone, and quadriceps volume. If overall ANOVA revealed significant differences, paired t-tests were used to examine the differences between pre- and posttreatment values in each group. Pearson product-moment correlation coefficients were computed, using linear regression, to evaluate the relationships between serum total and free testosterone concentrations and changes in key outcome measures.
For all statistical analyses, a 0.05 level of significance was used. Sigma-Stat program (SPSS, Chicago, IL) was used for all statistical analyses.| |
RESULTS |
|---|
|
|
|---|
Of the 61 men who enrolled in the study, 54 completed the
treatment (11). Thirty-nine of the men who completed the
study underwent baseline and posttreatment muscle biopsies: nine in the
25-mg group, seven in the 50-mg group, eight in the 125-mg group, nine
in the 300-mg group, and six in the 600-mg group. The five treatment
groups did not differ significantly in their baseline
characteristics (Tables 1-3).
|
|
|
A detailed description of the hormonal changes in all 61 treated men has been previously published (11). In the 39 men who underwent muscle biopsies and are the subject of this report, serum total and free testosterone concentrations were not significantly different among the five treatment groups at baseline (Table 2). Combined administration of GnRH agonist and graded doses of testosterone enanthate resulted in dose-dependent changes in serum total and free testosterone concentrations. Thus this treatment regimen was effective in creating and maintaining graded levels of serum total and free testosterone concentrations, providing validity to our experimental model.
Mean quadriceps and vastus lateralis muscle volumes, measured by MRI, were not significantly different among the five groups at baseline (Table 3). Combined administration of GnRH agonist and testosterone resulted in dose-dependent changes from baseline in quadriceps and vastus lateralis muscle volumes (Table 3). Administration of 300 (P < 0.005) and 600 mg (P = 0.002) of testosterone enanthate weekly was associated with significant increases in quadriceps volume.
Muscle fiber cross-sectional area.
The average cross-sectional areas of type I and II muscle fibers
were not significantly different among the five treatment groups at
baseline (Table 3). Testosterone treatment was associated with dose-
and concentration-dependent increases in the cross-sectional area of both type I and type II fibers (Fig.
1C). The groups receiving 300 and 600 mg of testosterone enanthate experienced a significant increase
in cross-sectional area of type I fibers (Figs. 1A and 2). Similarly, men receiving the highest
dose of testosterone enanthate demonstrated a significant increase in
the cross-sectional area of type II fibers. Figure 2 illustrates the
change in muscle fiber cross-sectional area in a representative
subject, who received the 600-mg testosterone dose.
|
|
|
Muscle fiber composition.
The relative proportions of type I and type II muscle fibers at
baseline were not significantly different among the five treatment groups (Fig. 3). Administration of GnRH
agonist plus testosterone enanthate did not significantly change the
number of type I or type II fibers per unit area in the cross sections
that were examined at any of the testosterone doses. Similarly, there
was no significant change from baseline in the relative proportion of
type I and type II fibers in any treatment group (Fig. 3).
|
|
|
Myonuclear number.
The average number of myonuclei per muscle fiber was not significantly
different among the five treatment groups at baseline. Administration
of testosterone enanthate was associated with a dose-dependent increase
in myonuclear number. In men receiving the 300-mg weekly dose of
testosterone enanthate, the mean ± SE myonuclear number increased
from 3.2 ± 0.2 to 3.9 ± 0.2 per type I fiber
(P = 0.001) and from 3.3 ± 0.2 to 3.7 ± 0.2 per type II fiber (P = 0.118); similarly, myonuclear
number increased significantly from 3.4 ± 0.2 to 4.2 ± 0.2 per type I fiber (P = 0.028) and from 2.9 ± 0.3 to 4.2 ± 0.2 per type II fiber (P = 0.017) in men
receiving the 600-mg dose (Fig. 5,
A and B). The muscle fiber
cross-sectional area was significantly correlated with the myonuclear
number (Fig. 5B). The number of myonuclei per unit fiber
area did not significantly change in any of the treatment groups.
|
Blood capillary density.
The capillary density, defined as the number of blood capillaries per
unit muscle area, was not significantly different among the five
treatment groups at baseline (Table 6).
The change in capillary density after testosterone treatment was not
significantly correlated with testosterone dose or concentration and
did not significantly differ among the five groups. The
capillary-to-muscle fiber ratio also did not differ among the five
groups.
|
| |
DISCUSSION |
|---|
|
|
|---|
In healthy young men in whom testicular testosterone production had been suppressed by a GnRH agonist administration of graded doses of testosterone was associated with dose-dependent changes in circulating concentrations of total and free testosterone (11). We have previously reported, using this Leydig cell clamp model, that testosterone dose-dependently increases fat-free mass and muscle size (11). Data presented in this report demonstrate that testosterone-induced gains in muscle size were associated with a significant increase in muscle fiber cross-sectional area. The cross-sectional areas of both type I and type II fibers increased in proportion to testosterone concentrations. The relative proportion of type I and type II fibers did not change significantly. We therefore conclude that testosterone increases skeletal muscle size primarily by inducing muscle fiber hypertrophy.
This study constitutes the first demonstration that androgens induce skeletal muscle fiber hypertrophy in healthy young men. These data generated from skeletal muscle of healthy young men are consistent with data from rat studies that reported an increase in fiber diameter in levator ani muscle of androgen-treated rats (22, 44, 45).
The adaptive response of the skeletal muscle varies with the type of stimulus, the fiber composition of the muscle being studied, and the time point at which the biopsies are taken. For instance, muscle stretch in wing muscles of birds results in an early increase in muscle fiber numbers (2), but the hypertropic and hyperplastic responses of the skeletal muscle have different time courses. In this study, muscle biopsies were obtained only at one time point after testosterone treatment. Also, different muscle groups may respond differently to anabolic stimuli, depending in part on the fiber composition. We studied only one muscle group; we do not know whether these findings can be generalized to other muscle groups with different fiber composition.
As discussed by Allen and Edgerton (1), muscle hypertrophy involves the addition of newly formed myonuclei via the fusion of myogenic cells to the adult myofibers. There is substantial evidence supporting a role for the modulation of myonuclear number during muscle remodeling in response to injury or disease (1, 25). In our study, the myonuclear number increased in direct relation to the increase in muscle fiber diameter. Therefore, it is possible that muscle fiber hypertrophy and increase in myonuclear number were preceded by testosterone-induced increase in satellite cell number and their fusion with muscle fibers. The hypertrophy of levator ani muscle in the female rat induced by exogenous testosterone administration is associated with satellite cell proliferation (32). Muscle remodeling and repair after injury often involve satellite cell replication and recruitment of new stem cells into the myogenic cell lineage (38). The mechanisms by which testosterone might increase satellite cell number are not known. An increase in satellite cell number could occur by an increase in satellite cell replication, inhibition of satellite cell apoptosis, and/or increased differentiation of stem cells into the myogenic lineage. We do not know which of these processes is the site of regulation by testosterone. The hypothesis that testosterone promotes muscle fiber hypertrophy by increasing the number of satellite cells should be further tested. Because of the constraints inherent in obtaining multiple biopsy specimens in humans, the effects of testosterone on satellite cell replication and stem cell recruitment would be more conveniently studied in an animal model.
Although we did not find a significant change in muscle fiber number per unit muscle area in the cross sections that were examined at any dose of testosterone, we recognize that the sampling was limited to a small region, and small but significant changes in muscle fiber number in other regions night have been missed. Additionally, the muscle fibers in the human vastus lateralis muscle do not run the entire length of the muscle; therefore, it is not possible to accurately measure the absolute number of muscle fibers in this muscle. The number of muscle cells that stained for proliferating cell nuclear antigen was too small to permit accurate measurement of change (data not shown).
Testosterone administration did not significantly affect the relative proportion of type I and type II fibers. Other anabolic hormones and interventions have been reported to affect fiber type transition (reviewed in Ref. 36). In the rat, hypothyroidism causes a shift of fast-twitch to slow fibers, whereas hyperthyroidism causes a shift in the opposite direction (29, 33). Analogous effects of thyroid hormone have been demonstrated in human muscles (13, 37). The administration of growth hormone in the rat increases muscle mass and also the relative proportion of type I fibers (5, 6). Testosterone treatment of female rats is associated with a decrease in the percentage of type I fibers in the gastrocnemius, extensor digitorum longus, and soleus muscles (22). High-intensity resistance training in previously untrained men induced an MHC IIb-to-MHC IIa transition (36). Other studies have reported that resistance exercise increases the ratio of type II to type I fiber area in biceps brachii, indicating preferential hypertrophy of type II fibers (31). We did not observe a change in the relative proportion of type I and type II fibers. The mRNA concentrations of type I, IIa, IIB, and IIx MHC isotypes did not change after treatment in any group. Because the number of men in whom tissue was available for these analyses was limited, it is possible that the sample did not have sufficient power to detect small differences in the relative proportions of MHC isotypes.
There are some similarities and many notable differences in the skeletal muscle response to testosterone and resistance exercise training. Both testosterone and resistance exercise training increase the cross-sectional areas of both type I and II fibers (31). Resistance exercise in cats leads to the appearance of split fibers (20), which we did not see in longitudinal sections of the muscle biopsies even at the highest dose of testosterone. It is possible that the fiber splitting previously reported in cats with resistance exercise (20) was the result of mechanical loading of the muscle with relatively heavy loads, a stimulus for muscle fiber change that is not replicated by testosterone administration. Resistance exercise increases the ratio of type II to type I fiber area (31), but testosterone does not affect fiber type transition and induces the hypertrophy of both types I and II fibers. These data suggest that, although testosterone and resistance exercise training both increase muscle size, they likely do so by different mechanisms. We recognize that the effects of resistance exercise training vary with the intensity, mode, and frequency of exercise stimulus; therefore, the comments above may apply only to the specific regimens of resistance exercise that were studied.
In summary, our data demonstrate that the increase in skeletal muscle mass during short-term testosterone administration is associated with dose-dependent increases in muscle fiber cross-sectional area and myonuclear number. The hypothesis that testosterone increases the number of satellite cells, whose fusion with the muscle fibers leads to muscle fiber hypertrophy and increase in myonuclear number, should now be studied.
| |
ACKNOWLEDGEMENTS |
|---|
The research support for this project was provided by a research grant from the National Institute of Aging, 1RO1 AG-14369-01. Additional support was provided by Grants 1RO1 DK-59627-01, the Clinical Trials Unit Grant U01 DK-54047, (Research Centers for Minority Institution) Clinical Research Infrastructure Initiative (P20 RR-11145), RCMI grants G12 RR-03026 and U54 RR-14616, and General Clinical Research Center Grant MO1 RR-00425. BioTechnology General provided the testosterone enanthate, and DebioPharm (Geneva, Switzerland) provided the long-acting GnRH agonist for these studies.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: S. Bhasin, UCLA School of Medicine, Div. of Endocrinology, Metabolism, and Molecular Medicine, Charles R. Drew Univ. of Medicine and Science, 1731 E. 120th St., Los Angeles, CA 90059 (E-mail: sbhasin{at}ucla.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published March 12, 2002;10.1152/ajpendo.00502.2001
Received 7 November 2001; accepted in final form 10 March 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Allen, DL,
Roy RR,
and
Edgerton VR.
Myonuclear domains in muscle adaptation and disease.
Muscle Nerve
22:
1350-1360,
1999[Web of Science][Medline].
2.
Antonio, J,
and
Gonyea WJ.
Progressive stretch overload of skeletal muscle results in hypertrophy before hyperplasia.
J Appl Physiol
75:
1263-1271,
1993
3.
Always, SE,
Grumbt WH,
Gonyea WJ,
and
Stray-Gundersen J.
Contrasts in muscle and myofibers of elite male and female body builders.
J Appl Physiol
67:
24-31,
1989
4.
Aspnes, LE,
Lee CE,
Weindruch R,
Chung SS,
Roecker EB,
and
Aiken JM.
Caloric restriction reduces fiber loss and mitochondrial abnormalities in aged rat muscle.
FASEB J
11:
573-581,
1997[Abstract].
5.
Ayling, CM,
Moreland BH,
Zanelli JM,
and
Schulster D.
Human growth hormone of hypophysectomized rats increases the proportion of type-I fibers in skeletal muscle.
J Endocrinol
123:
429-435,
1989
6.
Ayling, CM,
Zanelli JM,
Moreland BM,
and
Schulster D.
Effect of human growth hormone injection on the fiber type composition and metabolic activity in a skeletal muscle from normal and hypophysectomized rats.
Growth Regul
2:
133-143,
1992.
7.
Bhasin, S,
Storer TW,
Asbel-Sethi N,
Kilbourne A,
Hays R,
Sinha-Hikim I,
Shen R,
Arver S,
and
Beall G.
Effects of testosterone replacement with a non-genital, transdermal system, Androderm, in human immunodeficiency virus-infected men with low testosterone levels.
J Clin Endocrinol Metab
83:
3155-3162,
1998
8.
Bhasin, S,
Storer TW,
Berman N,
Callegari C,
Clevenger B,
Phillips J,
Bunnell TJ,
Tricker R,
Shirazi A,
and
Casaburi R.
The effects of supraphysiologic doses of testosterone on muscle size and strength in normal men.
N Engl J Med
335:
1-6,
1996
9.
Bhasin, S,
Storer TW,
Berman N,
Yarasheski KE,
Cleveneger B,
and
Casaburi RA.
A replacement dose of testosterone increases fat-free mass and muscle size in hypogonadal men.
J Clin Endocrinol Metab
82:
407-413,
1997
10.
Bhasin, S,
Storer TW,
Javanbakht M,
Berman N,
Yarasheski KE,
Phillips J,
Dike M,
Sinha-Hikim I,
Shen R,
Hays RD,
and
Beall G.
Testosterone replacement and resistance exercise in HIV-infected men with weight loss and low testosterone levels.
JAMA
283:
763-770,
2000
11.
Bhasin, S,
Woodhouse L,
Casaburi R,
Singh AB,
Bhasin D,
Berman N,
Magliano L,
Dzekov C,
Dzekov J,
Bross R,
Phillips J,
Sinha-Hikim I,
Shen R,
and
Storer TW.
Testosterone dose response relationships in healthy young men.
Am J Physiol Endocrinol Metab
281:
E1172-E1181,
2001
12.
Brodsky, IG,
Balagopal P,
and
Nair SK.
Effects of testosterone replacement on muscle mass and muscle protein synthesis in hypogonadal men
a clinical research center study.
J Clin Endocrinol Metab
81:
3469-3475,
1996[Abstract].
13.
Celsing, F,
Blomstrand E,
Melichna J,
Terrados N,
Clausen N,
Lins PE,
and
Jansson E.
Effect of hyperthyroidism on fiber-type composition, fiber area, glycogen content and enzyme activity in human skeletal muscle.
Clin Physiol
6:
171-181,
1986[Web of Science][Medline].
14.
Deveci, D,
Janice MM,
and
Egginton S.
Relationship between capillary angiogenesis, fiber type, and fiber size in chronic systemic hypoxia.
Am J Physiol Heart Circ Physiol
281:
H241-H252,
2001
15.
Donalies, M,
Cramer M,
Ringwald M,
and
Starzininski-Powitz A.
Expression of M-cadherin, a member of the cadeherin multigene family, correlates with differentiation of skeletal muscle cells.
Proc Natl Acad Sci USA
88:
8024-8028,
1991
16.
Forbes, GB,
Porta CR,
Herr BE,
and
Griggs RC.
Sequence of changes in body composition induced by testosterone and reversal of changes after drug is stopped.
JAMA
267:
397-399,
1992
17.
Frontera, WR,
Suh D,
Krivickas LS,
Hughes VA,
Goldstein R,
and
Roubenoff R.
Skeletal muscle fiber quality in older men and women.
Am J Physiol Cell Physiol
279:
C611-C618,
2000
18.
Griggs, RC,
Kingston W,
Jozefowicz RF,
Herr BE,
Forbes G,
and
Halliday D.
Effect of testosterone on muscle mass and muscle protein synthesis.
J Appl Physiol
66:
498-503,
1989
19.
Grinspoon, S,
Corcoran C,
Askari H,
Schoenfeld D,
Wolf L,
Burrows B,
Walsh M,
Hayden D,
Parlman K,
Anderson E,
Basgoz N,
and
Klibanski A.
Effects of androgen administration in men with the AIDS wasting syndrome: a randomized, double-blind, placebo-controlled trial.
Ann Intern Med
129:
18-26,
1998
20.
Gonyea, W,
Ericson GC,
and
Bonde-Petersen F.
Skeletal muscle fiber splitting induced by weight-lifting exercise in cats.
Acta Physiol Scand
99:
105-109,
1977[Web of Science][Medline].
21.
Hansen-Smith, FM,
Blackwell LH,
and
Joswiak GR.
Expression of muscle capillary alkaline phosphatase is affected by hypoxia.
J Appl Physiol
73:
776-780,
1992
22.
Holmang, A,
Svedberg J,
Jennische E,
and
Bjorntorp P.
Effect of testosterone on muscle insulin sensitivity and morphology in female rats.
Am J Physiol Endocrinol Metab
259:
E555-E560,
1990
23.
Joubert, Y,
and
Tobin C.
Testosterone treatment results in quiescent satellite cells being activated and recruited into cell cycle in rat levator ani muscle.
Dev Biol
169:
286-294,
1995[Web of Science][Medline].
25.
Kadi, F,
and
Thornell LE.
Concomitant increases in myonuclear and satellite cell content in female trapezius muscle following strength training.
Histochem Cell Biol
113:
99-103,
2000[Web of Science][Medline].
26.
Katznelson, L,
Finkelstein JS,
Schoenfeld DA,
Rosenthal DI,
Anderson EJ,
and
Klibanski A.
Increase in bone density and lean body mass during testosterone administration in men with acquired hypogonadism.
J Clin Endocrinol Metab
81:
4358-4365,
1996[Abstract].
27.
Kelley, G.
Mechanical overload and skeletal muscle fiber hyperplasia: a meta analysis.
J Appl Physiol
81:
1584-1587,
1996
28.
Kuzon, WM,
Rosenblatt JD,
Huebel SC,
Leatt P,
Plyley MJ,
McKee NH,
and
Jacobs I.
Skeletal muscle fiber type, fiber size, and capillary supply in elite soccer players.
Int J Sports Med
11:
99-102,
1990[Web of Science][Medline].
29.
Lomax, RB,
and
Robertson WR.
The effects of hypothyroidism and hyperthyroidism on fiber composition and mitochondrial enzyme activities in rat skeletal muscle.
J Endocrinol
133:
375,
1992
30.
Mauras, N,
Hayes V,
Welch S,
Veldhuis J,
and
Urban R.
Testosterone deficiency in young men: marked alterations in whole body protein kinetics, strength and adiposity.
J Clin Endocrinol Metab
83:
1886,
1998
31.
McCall, GE,
Byrnes WC,
Dickinson A,
Pattany PM,
and
Fleck SJ.
Muscle fiber hypertrophy, hyperplasia, and capillary density in college men after resistance training.
J Appl Physiol
81:
2004-2012,
1996
32.
Nnodim, J.
Testosterone mediates satellite cell activation in denervated rat levator ani muscle.
Anat Rec
263:
19-24,
2001[Medline].
33.
Nwoye, L,
and
Mommaerts WFHM
The effects of thyroid status on some properties of rat fast-twitch muscle.
J Muscle Res Cell Motil
2:
307-320,
1981[Web of Science][Medline].
34.
Ohlsson, C,
and
Jennische E.
Effects in skeletal soleus muscle of supraphysiological growth hormone stimulation.
Eur J Endocrinol
133:
678-679,
1995
35.
Pavlou, SN,
Brewer K,
Farley MG,
Linder J,
Bastias MC,
Rogers BJ,
Swift LL,
Rivier JE,
and
Vale WW.
Combined administration of a gonadotropin-releasing hormone antagonist and testosterone in men induces reversible azoospermia without loss of libido.
J Clin Endocrinol Metab
73:
1360-1369,
1991
36.
Pette, D,
and
Staron RS.
Mammalian skeletal muscle fiber type transitions.
Int Rev Cytol
170:
143-223,
1997[Medline].
37.
Putman, CT,
Dusterhoft S,
and
Pette D.
Satellite cell proliferation in low frequency-stimulated fast muscle of hypothyroid rat.
Am J Physiol Cell Physiol
279:
C682-C690,
2000
38.
Reimann, J,
Irintchev A,
and
Wering A.
Regenerative capacity and the number of satellite cells in soleus muscles of normal and mdx mice.
Neuromuscul Disord
10:
276-282,
2000[Web of Science][Medline].
39.
Salviati, G,
Betto R,
Danieli Betto D,
and
Zeviani M.
Myofibrillar-protein isoforms and sarcoplasmic-reticulum Ca2+-transport activity of single human muscle fibres.
Biochem J
224:
215-225,
1984[Web of Science][Medline].
40.
Scarpelli, M,
Belardinell IR,
and
Provinciali L.
Quantitative analysis of changes occurring in muscle vastus lateralis in patients with heart failure after low intensity training.
Anal Quant Cytol Histol
21:
374-380,
1999[Web of Science][Medline].
41.
Sinha Hikim, AP,
Bartke A,
and
Russell L.
Morphometric studies on hamster testis in gonadally active and inactive states: light microscope findings.
Biol Reprod
39:
1225-1237,
1988[Abstract].
42.
Sinha-Hikim, I,
Arver S,
Beall G,
Shen S,
Guerrero M,
Satler F,
Shikuma C,
Nelson J,
Landgren BM,
Mazer N,
and
Bhasin S.
The use of a sensitive equilibrium dialysis method for the measurement of free testosterone levels in healthy, cycling women and in human immunodeficiency virus infected men.
J Clin Endocrinol Metab
83:
1312-1318,
1998
43.
Snyder, PJ,
Peachey H,
Berlin JA,
Hannoush P,
Haddad G,
Dlewati A,
Santanna J,
Loh L,
Lenrow DA,
Holmes JH,
Kapoor SC,
Atkinson LE,
and
Strom BL.
Effects of testosterone replacement in hypogonadal men.
J Clin Endocrinol Metab
85:
2670-2677,
2000
44.
Tobin, C,
and
Joubert Y.
The levator ani of the female rat: a suitable model for studying the effects of testosterone on the development of mammalian muscle.
Biol Struct Morphog
1:
28-33,
1988[Medline].
45.
Tucek, S,
Kostirova D,
and
Gutmann E.
Testosterone-induced changes of choline acetyl-transferase and cholinesterase activities in rat levator ani muscle.
J Neurol Sci
27:
353-362,
1976[Web of Science][Medline].
46.
Wang, C,
Swerdloff RS,
Iranmanesh A,
Dobs A,
Snyder PJ,
Cunningham G,
Matsomoto AM,
Weber T,
and
Berman N.
Transdermal testosterone gel improves sexual function, mood, muscle strength, and body composition parameters in hypogonadal men.
J Clin Endocrinol Metab
85:
2839-2853,
2000
47.
Weibel, ER,
Taylor CR,
and
Hoppler H.
The concept of symorphosis: a testable hypothesis of structure-function relationship.
Proc Natl Acad Sci USA
88:
10357-10361,
1991
48.
Wright, C,
Haddad F,
Qin AX,
and
Baldwin KM.
Analysis of myosin heavy chain mRNA expression by RT-PCR.
J Appl Physiol
83:
1389-1396,
1997
49.
Young, NR,
Baker HWG,
Liu G,
and
Seeman E.
Body composition and muscle strength in healthy men receiving testosterone enanthate for contraception.
J Clin Endocrinol Metab
77:
1028-1032,
1993[Abstract].
This article has been cited by other articles:
![]() |
J. F. Husak and D. J. Irschick Steroid use and human performance: Lessons for integrative biologists Integr. Comp. Biol., October 1, 2009; 49(4): 354 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. S. Harris, E. W. Kelso, W. P. Flatt, H. J. Grill, and T. J. Bartness Testosterone replacement does not normalize carcass composition in chronically decerebrate male rats Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2009; 296(6): R1687 - R1694. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Baldari, L Di Luigi, G P Emerenziani, M C Gallotta, P Sgro, and L Guidetti Is explosive performance influenced by androgen concentrations in young male soccer players? Br. J. Sports Med., March 1, 2009; 43(3): 191 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Vingren, W. J. Kraemer, D. L. Hatfield, J. M. Anderson, J. S. Volek, N. A. Ratamess, G. A. Thomas, J.-Y. Ho, M. S. Fragala, and C. M. Maresh Effect of resistance exercise on muscle steroidogenesis J Appl Physiol, December 1, 2008; 105(6): 1754 - 1760. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. King, F. Cordova, and S. M. Scharf Nutritional Aspects of Chronic Obstructive Pulmonary Disease Proceedings of the ATS, May 1, 2008; 5(4): 519 - 523. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. R. Dayton and M. E. White Cellular and molecular regulation of muscle growth and development in meat animals J Anim Sci, April 1, 2008; 86(14_suppl): E217 - E225. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Brauck, C. J Galban, S. Maderwald, B. L Herrmann, and M. E Ladd Changes in calf muscle elasticity in hypogonadal males before and after testosterone substitution as monitored by magnetic resonance elastography Eur. J. Endocrinol., June 1, 2007; 156(6): 673 - 678. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Casaburi Impacting patient-centred outcomes in COPD: deconditioning Eur. Respir. Rev., December 1, 2006; 15(99): 42 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Enoki, Y. Yoshida, J. Lally, H. Hatta, and A. Bonen Testosterone increases lactate transport, monocarboxylate transporter (MCT) 1 and MCT4 in rat skeletal muscle J. Physiol., November 15, 2006; 577(1): 433 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Troosters, R. Casaburi, R. Gosselink, and M. Decramer Pulmonary Rehabilitation in Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., July 1, 2005; 172(1): 19 - 38. [Full Text] [PDF] |
||||
![]() |
R. Casaburi, S. Bhasin, L. Cosentino, J. Porszasz, A. Somfay, M. I. Lewis, M. Fournier, and T. W. Storer Effects of Testosterone and Resistance Training in Men with Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., October 15, 2004; 170(8): 870 - 878. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Evans Current Concepts in Anabolic-Androgenic Steroids Am. J. Sports Med., March 1, 2004; 32(2): 534 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bhasin, W. E. Taylor, R. Singh, J. Artaza, I. Sinha-Hikim, R. Jasuja, H. Choi, and N. F. Gonzalez-Cadavid The Mechanisms of Androgen Effects on Body Composition: Mesenchymal Pluripotent Cell as the Target of Androgen Action J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2003; 58(12): M1103 - 1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bhasin Testosterone Supplementation for Aging-Associated Sarcopenia J. Gerontol. A Biol. Sci. Med. Sci., November 1, 2003; 58(11): M1002 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Reisz-Porszasz, S. Bhasin, J. N. Artaza, R. Shen, I. Sinha-Hikim, A. Hogue, T. J. Fielder, and N. F. Gonzalez-Cadavid Lower skeletal muscle mass in male transgenic mice with muscle-specific overexpression of myostatin Am J Physiol Endocrinol Metab, October 1, 2003; 285(4): E876 - E888. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sinha-Hikim, S. M. Roth, M. I. Lee, and S. Bhasin Testosterone-induced muscle hypertrophy is associated with an increase in satellite cell number in healthy, young men Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E197 - E205. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Woodhouse, S. Reisz-Porszasz, M. Javanbakht, T. W. Storer, M. Lee, H. Zerounian, and S. Bhasin Development of models to predict anabolic response to testosterone administration in healthy young men Am J Physiol Endocrinol Metab, May 1, 2003; 284(5): E1009 - E1017. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |