AJP - Endo Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 283: E154-E164, 2002. First published March 12, 2002; doi:10.1152/ajpendo.00502.2001
0193-1849/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/1/E154    most recent
00502.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinha-Hikim, I.
Right arrow Articles by Bhasin, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinha-Hikim, I.
Right arrow Articles by Bhasin, S.
Vol. 283, Issue 1, E154-E164, July 2002

Testosterone-induced increase in muscle size in healthy young men is associated with muscle fiber hypertrophy

Indrani Sinha-Hikim1, Jorge Artaza1, Linda Woodhouse1, Nestor Gonzalez-Cadavid1, Atam B. Singh1, Martin I. Lee1, Thomas W. Storer1, Richard Casaburi2, Ruoquing Shen1, and Shalender Bhasin1

1 Division of Endocrinology, Metabolism, and Molecular Medicine, Charles R. Drew University of Medicine and Science, Los Angeles, 90059; and 2 Division of Respiratory and Critical Care Physiology and Medicine, Harbor-University of California at Los Angeles Medical Center, Torrance, California 90509


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Administration of replacement doses of testosterone to healthy hypogonadal men and supraphysiological doses to eugonadal men increases muscle size. To determine whether testosterone-induced increase in muscle size is due to muscle fiber hypertrophy, 61 healthy men, 18-35 yr of age, received monthly injections of a long-acting gonadotropin-releasing hormone (GnRH) agonist to suppress endogenous testosterone secretion and weekly injections of 25, 50, 125, 300, or 600 mg testosterone enanthate (TE) for 20 wk. Thigh muscle volume was measured by magnetic resonance imaging (MRI) scan, and muscle biopsies were obtained from vastus lateralis muscle in 39 men before and after 20 wk of combined treatment with GnRH agonist and testosterone. Administration of GnRH agonist plus TE resulted in mean nadir testosterone concentrations of 234, 289, 695, 1,344, and 2,435 ng/dl at the 25-, 50-, 125-, 300-, and 600-mg doses, respectively. Graded doses of testosterone administration were associated with testosterone dose and concentration-dependent increase in muscle volume measured by MRI (changes in vastus lateralis volume, -4, +7, +15, +32, and +48 ml at 25-, 50-, 125-, 300-, and 600-mg doses, respectively). Changes in cross-sectional areas of both type I and II fibers were dependent on testosterone dose and significantly correlated with total (r = 0.35, and 0.44, P < 0.0001 for type I and II fibers, respectively) and free (r = 0.34 and 0.35, P < 0.005) testosterone concentrations during treatment. The men receiving 300 and 600 mg of TE weekly experienced significant increases from baseline in areas of type I (baseline vs. 20 wk, 3,176 ± 186 vs. 4,201 ± 252 µm2, P < 0.05 at 300-mg dose, and 3,347 ± 253 vs. 4,984 ± 374 µm2, P = 0.006 at 600-mg dose) muscle fibers; the men in the 600-mg group also had significant increments in cross-sectional area of type II (4,060 ± 401 vs. 5,526 ± 544 µm2, P = 0.03) fibers. The relative proportions of type I and type II fibers did not change significantly after treatment in any group. The myonuclear number per fiber increased significantly in men receiving the 300- and 600-mg doses of TE and was significantly correlated with testosterone concentration and muscle fiber cross-sectional area. In conclusion, the increases in muscle volume in healthy eugonadal men treated with graded doses of testosterone are associated with concentration-dependent increases in cross-sectional areas of both type I and type II muscle fibers and myonuclear number. We conclude that the testosterone induced increase in muscle volume is due to muscle fiber hypertrophy.

androgen; muscle hypertrophy; satellite cells; mechanism of action


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

TESTOSTERONE ADMINISTRATION in replacement doses to hypogonadal men (9, 12, 26, 43, 46) and in supraphysiological doses to healthy eugonadal men (8, 16, 18, 49) is associated with significant increases in fat-free mass and muscle size. Similarly, testosterone replacement in men infected with the human immunodeficiency virus, who are experiencing weight loss and have low testosterone levels, induces significant gains in lean body mass with concomitant increases in muscle volume (7, 10, 19). We have recently demonstrated that changes in circulating testosterone concentrations, induced by combined administration of gonadotropin-releasing hormone (GnRH) agonist and graded doses of testosterone, are associated with testosterone dose- and concentration-dependent changes in fat-free mass and muscle size (11). However, the mechanisms by which testosterone increases muscle mass are not well understood. We do not know whether testosterone-induced increase in muscle mass is due to muscle fiber hypertrophy, muscle cell hyperplasia, or both. The effects of testosterone administration on muscle fiber size and composition in humans are unknown, and the data from experimental animals are both limited and somewhat contradictory. For instance, in a study by Tucek et al. (45), testosterone treatment of castrated rats led to a 15% increase in the weight of the levator ani muscle; this increase in muscle mass was accompanied by an increase in the size of muscle fibers. Tobin and Joubert (44) reported a significant sex difference in both the number of fibers and their average cross-sectional areas for levator ani muscle and speculated that the higher fiber number and size in the male rats might be related to the higher testosterone levels. However, a recent study (17) did not find any differences in the cross-sectional areas of fast- and slow-twitch fibers between older men and women with vastly different androgen concentrations.

Therefore, the overall objective of the present study was to determine whether testosterone-induced increase in muscle size is due to increase in muscle fiber area or number or both. We treated healthy young men with a long-acting GnRH agonist to suppress their endogenous testosterone production and one of five different doses of testosterone enanthate to create different circulating testosterone concentrations. Muscle biopsies were obtained before and after 20 wk of combined treatment with GnRH agonist and testosterone to determine the morphometric changes in muscle fibers of vastus lateralis muscle. We assessed whether the morphometric changes in the vastus lateralis muscle fibers were correlated with testosterone dose and circulating testosterone concentrations and whether these changes were fiber type specific.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Subjects. This was a double-blind, randomized study. The details of the study design have been previously published (11). Briefly, the participants were 61 healthy eugonadal men, 18-35 yr of age. Each participant provided informed consent approved by the institutional review boards of Charles R. Drew University and Harbor-UCLA Research and Education Institute. Participants were randomly assigned to one of five experimental groups to receive monthly injections of a long-acting GnRH agonist to suppress endogenous testosterone production and weekly injections of 25, 50, 125, 300, or 600 mg of testosterone enanthate for 20 wk. The lowest testosterone dose regimen, 25 mg/wk, was selected because previous studies had shown that this weekly dose of testosterone can maintain sexual function in GnRH antagonist-treated men (35). The selection of the 600-mg weekly regimen was based on the consideration that this was the highest dose of testosterone enanthate that had been shown to be safe and effective in increasing muscle size and strength in healthy eugonadal men in short-term clinical trials (8). The staff of the General Clinical Research Center administered testosterone and GnRH agonist injections to ensure compliance.

Of the 61 men, who were randomized, 54 completed all phases of the study (11). Thus body composition and muscle volume data were available on 54 men. Of these, 39 men underwent pre- and posttreatment muscle biopsies: nine in the 25-mg group, seven in the 50-mg group, eight in the 125-mg group, nine in the 300-mg group, and six in the 600-mg group.

Nutritional intake and exercise stimulus were controlled at the outset of the study, as previously described (11). Two weeks before the initiation of the study, subjects were prescribed a diet standardized for energy intake at 150 kJ · kg-1 · day-1 and protein intake at 1.3 g · kg-1 · day-1. These instructions were reinforced every 4 wk during a meeting with the dietitian, in which subject's actual nutrient intake was verified by analysis of 3-day food records.

Hormone assays. Serum total testosterone was measured by a previously reported radioimmunoassay (7-11). Free testosterone was separated by an equilibrium dialysis procedure and measured by radioimmunoassay (42). The sensitivity of total testosterone assay was 0.6 ng/dl; intra-assay coefficient of variation was 8.2%, and interassay coefficient of variation was 13.2%. For free testosterone assay, the sensitivity was 0.22 pg/ml, and intra- and interassay coefficients of variation were 4.2 and 12.3%.

Quadriceps muscle volume. The volume of the quadriceps muscle group was measured by magnetic resonance imaging (MRI; Signa Horizons LX Scanner, General Electric Medical Systems, Milwaukee, WI) before and after 20 wk of treatment. The software used for data acquisition was Signa MR Scan Assistant, version 8.3. Subjects entered the body coil feet first and lay in a supine position with the heels in a neutral position. MRI scans were obtained for the entire thigh, with the first slice taken at the distal border of the lateral femoral condyle. A total of 17 slices, each of 10 mm thickness, was taken. The thigh muscle volume was then calculated by integrating the transverse slices by use of commercially available software (General Electric Volume Analysis Software, AW version 3.1, Milwaukee, WI). Accuracy of the volume analysis software was determined by scanning and analyzing a phantom cylinder of known dimensions. Duplicate manual tracings were drawn around the outermost edge of the entire thigh (total thigh), the skeletal musculature (to subtract out subcutaneous fat), and the femur (to subtract out femoral bone areas). The quadriceps musculature was measured by manually tracing around the vastus lateralis, vastus medialis, vastus intermedius, and rectus femoris muscles. The middle transverse slice with the largest diameter was used to measure cross-sectional areas of the vastus lateralis. A single individual, who was unaware of the group assignments, performed all of the analyses.

Muscle biopsy and tissue fixation. Percutaneous needle muscle biopsies were obtained from the midbelly of the vastus lateralis muscle in the quadriceps muscle group before and within 5 days after the final testosterone enanthate injection. Each muscle biopsy was divided into two portions; one portion was fixed in 10% formalin and the other in Bouin's fixative. Both formalin- and Bouin's-fixed tissues were oriented on their longitudinal axis and embedded in paraffin and used for light microscopic, morphometric, and immunohistochemical studies. In some individuals, in whom additional muscle tissue was available, the tissue was snap-frozen in liquid nitrogen in a solution of RNAase for subsequent extraction of RNA.

Muscle fiber typing. Muscle fibers in the vastus lateralis were identified as type I and type II fibers by immunohistochemical staining using a mouse monoclonal antibody (clone MY 32, Sigma, St Louis, MO) specific for the heavy chain of fast myosin. This antibody recognizes all subtypes of type II myosin heavy chain (MHC) but does not cross-react with type I MHC (3, 4, 22). Both the formalin- and Bouin's-fixed 6-µm tissue sections were immunostained using the diaminobenzidine tetrahydrochloride-based detection method (Vectastain-Elite ABC kit, Vector Labs). The slides were counterstained with Harris hematoxylin. Tissue sections that were incubated with mouse IgG instead of the primary antibody served as negative controls.

In 19 men in whom sufficient biopsy material was available, we measured the relative mRNA concentrations of human MHC isotypes I, IIa, IIb, and IIx by reverse transcription and polymerase chain reaction (RT-PCR). The concentration of RNA, isolated by TRIzol, was estimated by spectrophotometry and verified by nondenaturing agarose gel electrophoresis, ethidium bromide staining, and densitometry of the 28S and 18S bands. MHC mRNA isotypes were determined by modification of a published procedure (48) for rat MHC isotypes. Briefly, 0.6-1 µg of total RNA was reverse transcribed with poly(dT) primer, and aliquots of this reaction were submitted to PCR utilizing a forward primer within a region identical for the four human MHC subtypes (AAGG CCAAGAAGGCCATCAC) and reverse primers that were specific for MHC I (TCCAGCTCATTCTTCAGCTC), MHC IIa (TGCCTGAAGTTTATCTACCA), MHC IIb (GGTTTGCAATTTGTCCACCA), or MHC IIx (CTTGCAGCTTGTCCACCAGG). A fifth reaction was conducted for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a "housekeeping" gene. PCR conditions for each primer set were optimized utilizing the thermal Robocycler (Stratagene, La Jolla, CA), and the final reaction conditions were standardized at 92°C for 5 min, followed by 25 cycles at 92°C for 1 min, 58°C for 1 min, and 72°C for 1 min and an extension at 72°C for 10 min. The expected amplified DNA fragment sizes were: MHC I, 221 bp, MHC IIa, 360 bp, MHC IIb, 360 bp, MHC IIx, 358 bp, and GAPDH, 1,100 bp. The intensity of the PCR product was determined by densitometry and corrected by the amount of 28S RNA or the intensity of the GAPDH band.

Because our data were derived by using the RT-PCR technique, we considered the possibility that the observed expression might be due to amplification of a closely related mRNA species (perhaps another MHC isoform). To exclude this possibility, we sequenced the product of RT-PCR for IIb mRNA. The sequence was identical to the one reported in the literature and in GenBank for the human MHC type IIb. These data provide unequivocal evidence that MHC isoform IIb mRNA is expressed in vastus lateralis.

Morphometry. The immunohistochemically stained slides were used for morphometric evaluation using an RG-3 grid (square lattice with 121 intersections) in a Leitz Wetzler (HM-LUX) microscope. An observer who was unaware of the group assignments evaluated all the slides. Fiber typing was carried out by directly counting type I and type II muscle fibers in a known area (9,216 × 15 µm2) of tissue sections. We counted >= 500 muscle fibers in each biopsy specimen. The relative abundance of type I and II fibers was expressed as a percentage of the total fiber number.

The cross-sectional area of the muscle fibers (A) was determined by point counting using the equation A = p · µ2, where p is number of points per fiber profile and µ is the distance between two neighboring points, the magnification used being taken into account (3, 41). A minimum of 150 type II fibers and 100 type I fibers was analyzed in each biopsy specimen. The fields were randomly selected to measure the fiber area, and all of the fibers encompassed in those fields were evaluated.

Fiber number was determined by counting each of the fiber types per unit muscle area by use of slides that had been immunostained for MHC (2). We examined a minimum of 10 fields (60,025-µm2 area) in each biopsy. We also counted the number of myonuclei in 20 randomly selected muscle fibers of each type in each sample.

Counting of blood capillaries. Sections from Bouin's-fixed tissues were stained for alkaline phosphatase activity to identify all of the capillaries surrounding the muscle fibers. The capillaries were counted at a total magnification of ×400 by use of a square frame in the eyepiece of the microscope, and expressing the amount as capillary density per unit area [unit area = 600 µm2 (14, 40)]. The fiber-to-capillary ratio was obtained by counting all of the capillaries and fibers in five artifact-free unit areas in each section.

Statistical analyses. All data are presented as means ± SE for each of the five treatment groups. We used one-way ANOVA to compare between-group differences in the change from baseline in each outcome measure. The main outcome measures were change from baseline in muscle fiber number, relative proportion of type I and type II fibers, cross-sectional areas of type I and type II fibers, number of myonuclei per muscle fiber, capillary density, total testosterone, free testosterone, and quadriceps volume. If overall ANOVA revealed significant differences, paired t-tests were used to examine the differences between pre- and posttreatment values in each group. Pearson product-moment correlation coefficients were computed, using linear regression, to evaluate the relationships between serum total and free testosterone concentrations and changes in key outcome measures.

For all statistical analyses, a 0.05 level of significance was used. Sigma-Stat program (SPSS, Chicago, IL) was used for all statistical analyses.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Of the 61 men who enrolled in the study, 54 completed the treatment (11). Thirty-nine of the men who completed the study underwent baseline and posttreatment muscle biopsies: nine in the 25-mg group, seven in the 50-mg group, eight in the 125-mg group, nine in the 300-mg group, and six in the 600-mg group. The five treatment groups did not differ significantly in their baseline characteristics (Tables 1-3).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Baseline characteristics of the participants


                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Serum total and free testosterone concentrations at baseline and during week 16 


                              
View this table:
[in this window]
[in a new window]
 
Table 3.   Quadriceps and vastus lateralis muscle volumes and cross-sectional areas of type I and type II muscle fibers

A detailed description of the hormonal changes in all 61 treated men has been previously published (11). In the 39 men who underwent muscle biopsies and are the subject of this report, serum total and free testosterone concentrations were not significantly different among the five treatment groups at baseline (Table 2). Combined administration of GnRH agonist and graded doses of testosterone enanthate resulted in dose-dependent changes in serum total and free testosterone concentrations. Thus this treatment regimen was effective in creating and maintaining graded levels of serum total and free testosterone concentrations, providing validity to our experimental model.

Mean quadriceps and vastus lateralis muscle volumes, measured by MRI, were not significantly different among the five groups at baseline (Table 3). Combined administration of GnRH agonist and testosterone resulted in dose-dependent changes from baseline in quadriceps and vastus lateralis muscle volumes (Table 3). Administration of 300 (P < 0.005) and 600 mg (P = 0.002) of testosterone enanthate weekly was associated with significant increases in quadriceps volume.

Muscle fiber cross-sectional area. The average cross-sectional areas of type I and II muscle fibers were not significantly different among the five treatment groups at baseline (Table 3). Testosterone treatment was associated with dose- and concentration-dependent increases in the cross-sectional area of both type I and type II fibers (Fig. 1C). The groups receiving 300 and 600 mg of testosterone enanthate experienced a significant increase in cross-sectional area of type I fibers (Figs. 1A and 2). Similarly, men receiving the highest dose of testosterone enanthate demonstrated a significant increase in the cross-sectional area of type II fibers. Figure 2 illustrates the change in muscle fiber cross-sectional area in a representative subject, who received the 600-mg testosterone dose.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.   A: change in cross-sectional areas of type I and type II skeletal muscle fibers before and after 20 wk of treatment with gonadotropin-releasing hormone (GnRH) agonist and graded doses of testosterone. Data are means ± SE. * Significantly different from 0. B: correlation between change in serum total testosterone concentrations during treatment and change in cross-sectional area of type I (top) and type II (bottom) muscle fibers. C: correlation between change in serum free testosterone concentrations during treatment and change in cross-sectional area of type I (top) and type II (bottom) muscle fibers.



View larger version (133K):
[in this window]
[in a new window]
 
Fig. 2.   Cross sections of muscle biopsies before and after 20 wk of treatment in one man treated with GnRH agonist and 600 mg of testosterone enanthate weekly. A and C: baseline sections; B and D: sections obtained after 20 wk of treatment. The magnification is 200-fold in A and B and 1,000-fold in C and D.

The changes in cross-sectional areas of both type I and type II muscle fibers were significantly correlated with total [r = 0.35 (P < 0.005) for type I fibers; r = 0.44 for type II fibers (P < 0.0001)] and free testosterone [r = 0.34 (P < 0.005) for type I muscle fibers; r = 0.35 (P < 0.001) for type II muscle fibers] concentrations during treatment (Table 4; Fig. 1, B and C). The percent increases in mean cross-sectional areas of type I fibers were numerically greater than those in type II fibers in men receiving the 300-mg dose (%increase: 33 ± 6 vs. 24 ± 11 in type I and type II fiber cross-sectional area, respectively, P = 0.190) and the 600-mg dose (%increase: 51 ± 14 vs. 39 ± 13 in type I and type II fibers, respectively, P = 0.384); however, the differences in the increase in mean fiber cross-sectional areas did not achieve statistical significance.

                              
View this table:
[in this window]
[in a new window]
 
Table 4.   Correlations of changes in skeletal muscle fiber morphometric measures with changes in serum total and free testosterone concentrations

Muscle fiber composition. The relative proportions of type I and type II muscle fibers at baseline were not significantly different among the five treatment groups (Fig. 3). Administration of GnRH agonist plus testosterone enanthate did not significantly change the number of type I or type II fibers per unit area in the cross sections that were examined at any of the testosterone doses. Similarly, there was no significant change from baseline in the relative proportion of type I and type II fibers in any treatment group (Fig. 3).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of treatment with GnRH agonist and graded doses of testosterone on relative proportion of type I and type II skeletal muscle fibers in healthy young men. Mean ± SE percent type I and II skeletal muscle fibers in biopsies obtained at baseline before initiation of treatment (pretreatment, filled bars) and after 20 wk of treatment (posttreatment, hatched bars) are shown. The percentage of type I muscle fibers is shown in top, and percentage of type II fibers is shown in bottom. None of the posttreatment values was significantly different from baseline values.

The concentration of mRNAs for MHC isotypes, I, IIa, IIb, and IIx did not significantly change relative to GAPDH mRNA or the amount of 28S RNA (Table 5; Fig. 4).

                              
View this table:
[in this window]
[in a new window]
 
Table 5.   mRNAconcentrations of MHC isotypes I, IIa, IIb, and IIx before and after treatment with graded doses of testosterone in healthy young men



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 4.   Representative electrophoretic gels demonstrating the DNA bands resulting from RT-PCR of mRNAs of myosin heavy chain (MHC) isoforms and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Top gels represent baseline samples from 4 randomly selected men from different treatment groups. Bottom gels represent posttreatment samples from the same subjects.

Myonuclear number. The average number of myonuclei per muscle fiber was not significantly different among the five treatment groups at baseline. Administration of testosterone enanthate was associated with a dose-dependent increase in myonuclear number. In men receiving the 300-mg weekly dose of testosterone enanthate, the mean ± SE myonuclear number increased from 3.2 ± 0.2 to 3.9 ± 0.2 per type I fiber (P = 0.001) and from 3.3 ± 0.2 to 3.7 ± 0.2 per type II fiber (P = 0.118); similarly, myonuclear number increased significantly from 3.4 ± 0.2 to 4.2 ± 0.2 per type I fiber (P = 0.028) and from 2.9 ± 0.3 to 4.2 ± 0.2 per type II fiber (P = 0.017) in men receiving the 600-mg dose (Fig. 5, A and B). The muscle fiber cross-sectional area was significantly correlated with the myonuclear number (Fig. 5B). The number of myonuclei per unit fiber area did not significantly change in any of the treatment groups.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   A: effects of treatment with GnRH agonist and graded doses of testosterone on skeletal muscle fiber myonuclear number in healthy young men. Mean ± SE numbers of myonuclei in muscle fibers in baseline biopsies are shown in filled bars, those in biopsies obtained after 20 wk of treatment in hatched bars. Top: number of myonuclei in type I muscle fibers; bottom: type II muscle fibers. * P = 0.028 vs. baseline; ** P = 0.017; ***P < 0.001. B: correlation between the change in myonuclear number and the change in cross-sectional areas of type I (top) and type II (bottom) muscle fibers.

Blood capillary density. The capillary density, defined as the number of blood capillaries per unit muscle area, was not significantly different among the five treatment groups at baseline (Table 6). The change in capillary density after testosterone treatment was not significantly correlated with testosterone dose or concentration and did not significantly differ among the five groups. The capillary-to-muscle fiber ratio also did not differ among the five groups.

                              
View this table:
[in this window]
[in a new window]
 
Table 6.   Absolute and relative blood capillary density bevore and after treatment with GnRH agonist and graded doses of testosterone


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In healthy young men in whom testicular testosterone production had been suppressed by a GnRH agonist administration of graded doses of testosterone was associated with dose-dependent changes in circulating concentrations of total and free testosterone (11). We have previously reported, using this Leydig cell clamp model, that testosterone dose-dependently increases fat-free mass and muscle size (11). Data presented in this report demonstrate that testosterone-induced gains in muscle size were associated with a significant increase in muscle fiber cross-sectional area. The cross-sectional areas of both type I and type II fibers increased in proportion to testosterone concentrations. The relative proportion of type I and type II fibers did not change significantly. We therefore conclude that testosterone increases skeletal muscle size primarily by inducing muscle fiber hypertrophy.

This study constitutes the first demonstration that androgens induce skeletal muscle fiber hypertrophy in healthy young men. These data generated from skeletal muscle of healthy young men are consistent with data from rat studies that reported an increase in fiber diameter in levator ani muscle of androgen-treated rats (22, 44, 45).

The adaptive response of the skeletal muscle varies with the type of stimulus, the fiber composition of the muscle being studied, and the time point at which the biopsies are taken. For instance, muscle stretch in wing muscles of birds results in an early increase in muscle fiber numbers (2), but the hypertropic and hyperplastic responses of the skeletal muscle have different time courses. In this study, muscle biopsies were obtained only at one time point after testosterone treatment. Also, different muscle groups may respond differently to anabolic stimuli, depending in part on the fiber composition. We studied only one muscle group; we do not know whether these findings can be generalized to other muscle groups with different fiber composition.

As discussed by Allen and Edgerton (1), muscle hypertrophy involves the addition of newly formed myonuclei via the fusion of myogenic cells to the adult myofibers. There is substantial evidence supporting a role for the modulation of myonuclear number during muscle remodeling in response to injury or disease (1, 25). In our study, the myonuclear number increased in direct relation to the increase in muscle fiber diameter. Therefore, it is possible that muscle fiber hypertrophy and increase in myonuclear number were preceded by testosterone-induced increase in satellite cell number and their fusion with muscle fibers. The hypertrophy of levator ani muscle in the female rat induced by exogenous testosterone administration is associated with satellite cell proliferation (32). Muscle remodeling and repair after injury often involve satellite cell replication and recruitment of new stem cells into the myogenic cell lineage (38). The mechanisms by which testosterone might increase satellite cell number are not known. An increase in satellite cell number could occur by an increase in satellite cell replication, inhibition of satellite cell apoptosis, and/or increased differentiation of stem cells into the myogenic lineage. We do not know which of these processes is the site of regulation by testosterone. The hypothesis that testosterone promotes muscle fiber hypertrophy by increasing the number of satellite cells should be further tested. Because of the constraints inherent in obtaining multiple biopsy specimens in humans, the effects of testosterone on satellite cell replication and stem cell recruitment would be more conveniently studied in an animal model.

Although we did not find a significant change in muscle fiber number per unit muscle area in the cross sections that were examined at any dose of testosterone, we recognize that the sampling was limited to a small region, and small but significant changes in muscle fiber number in other regions night have been missed. Additionally, the muscle fibers in the human vastus lateralis muscle do not run the entire length of the muscle; therefore, it is not possible to accurately measure the absolute number of muscle fibers in this muscle. The number of muscle cells that stained for proliferating cell nuclear antigen was too small to permit accurate measurement of change (data not shown).

Testosterone administration did not significantly affect the relative proportion of type I and type II fibers. Other anabolic hormones and interventions have been reported to affect fiber type transition (reviewed in Ref. 36). In the rat, hypothyroidism causes a shift of fast-twitch to slow fibers, whereas hyperthyroidism causes a shift in the opposite direction (29, 33). Analogous effects of thyroid hormone have been demonstrated in human muscles (13, 37). The administration of growth hormone in the rat increases muscle mass and also the relative proportion of type I fibers (5, 6). Testosterone treatment of female rats is associated with a decrease in the percentage of type I fibers in the gastrocnemius, extensor digitorum longus, and soleus muscles (22). High-intensity resistance training in previously untrained men induced an MHC IIb-to-MHC IIa transition (36). Other studies have reported that resistance exercise increases the ratio of type II to type I fiber area in biceps brachii, indicating preferential hypertrophy of type II fibers (31). We did not observe a change in the relative proportion of type I and type II fibers. The mRNA concentrations of type I, IIa, IIB, and IIx MHC isotypes did not change after treatment in any group. Because the number of men in whom tissue was available for these analyses was limited, it is possible that the sample did not have sufficient power to detect small differences in the relative proportions of MHC isotypes.

There are some similarities and many notable differences in the skeletal muscle response to testosterone and resistance exercise training. Both testosterone and resistance exercise training increase the cross-sectional areas of both type I and II fibers (31). Resistance exercise in cats leads to the appearance of split fibers (20), which we did not see in longitudinal sections of the muscle biopsies even at the highest dose of testosterone. It is possible that the fiber splitting previously reported in cats with resistance exercise (20) was the result of mechanical loading of the muscle with relatively heavy loads, a stimulus for muscle fiber change that is not replicated by testosterone administration. Resistance exercise increases the ratio of type II to type I fiber area (31), but testosterone does not affect fiber type transition and induces the hypertrophy of both types I and II fibers. These data suggest that, although testosterone and resistance exercise training both increase muscle size, they likely do so by different mechanisms. We recognize that the effects of resistance exercise training vary with the intensity, mode, and frequency of exercise stimulus; therefore, the comments above may apply only to the specific regimens of resistance exercise that were studied.

In summary, our data demonstrate that the increase in skeletal muscle mass during short-term testosterone administration is associated with dose-dependent increases in muscle fiber cross-sectional area and myonuclear number. The hypothesis that testosterone increases the number of satellite cells, whose fusion with the muscle fibers leads to muscle fiber hypertrophy and increase in myonuclear number, should now be studied.


    ACKNOWLEDGEMENTS

The research support for this project was provided by a research grant from the National Institute of Aging, 1RO1 AG-14369-01. Additional support was provided by Grants 1RO1 DK-59627-01, the Clinical Trials Unit Grant U01 DK-54047, (Research Centers for Minority Institution) Clinical Research Infrastructure Initiative (P20 RR-11145), RCMI grants G12 RR-03026 and U54 RR-14616, and General Clinical Research Center Grant MO1 RR-00425. BioTechnology General provided the testosterone enanthate, and DebioPharm (Geneva, Switzerland) provided the long-acting GnRH agonist for these studies.


    FOOTNOTES

Address for reprint requests and other correspondence: S. Bhasin, UCLA School of Medicine, Div. of Endocrinology, Metabolism, and Molecular Medicine, Charles R. Drew Univ. of Medicine and Science, 1731 E. 120th St., Los Angeles, CA 90059 (E-mail: sbhasin{at}ucla.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published March 12, 2002;10.1152/ajpendo.00502.2001

Received 7 November 2001; accepted in final form 10 March 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Allen, DL, Roy RR, and Edgerton VR. Myonuclear domains in muscle adaptation and disease. Muscle Nerve 22: 1350-1360, 1999[Web of Science][Medline].

2.   Antonio, J, and Gonyea WJ. Progressive stretch overload of skeletal muscle results in hypertrophy before hyperplasia. J Appl Physiol 75: 1263-1271, 1993[Abstract/Free Full Text].

3.   Always, SE, Grumbt WH, Gonyea WJ, and Stray-Gundersen J. Contrasts in muscle and myofibers of elite male and female body builders. J Appl Physiol 67: 24-31, 1989[Abstract/Free Full Text].

4.   Aspnes, LE, Lee CE, Weindruch R, Chung SS, Roecker EB, and Aiken JM. Caloric restriction reduces fiber loss and mitochondrial abnormalities in aged rat muscle. FASEB J 11: 573-581, 1997[Abstract].

5.   Ayling, CM, Moreland BH, Zanelli JM, and Schulster D. Human growth hormone of hypophysectomized rats increases the proportion of type-I fibers in skeletal muscle. J Endocrinol 123: 429-435, 1989[Abstract/Free Full Text].

6.   Ayling, CM, Zanelli JM, Moreland BM, and Schulster D. Effect of human growth hormone injection on the fiber type composition and metabolic activity in a skeletal muscle from normal and hypophysectomized rats. Growth Regul 2: 133-143, 1992.

7.   Bhasin, S, Storer TW, Asbel-Sethi N, Kilbourne A, Hays R, Sinha-Hikim I, Shen R, Arver S, and Beall G. Effects of testosterone replacement with a non-genital, transdermal system, Androderm, in human immunodeficiency virus-infected men with low testosterone levels. J Clin Endocrinol Metab 83: 3155-3162, 1998[Abstract/Free Full Text].

8.   Bhasin, S, Storer TW, Berman N, Callegari C, Clevenger B, Phillips J, Bunnell TJ, Tricker R, Shirazi A, and Casaburi R. The effects of supraphysiologic doses of testosterone on muscle size and strength in normal men. N Engl J Med 335: 1-6, 1996[Abstract/Free Full Text].

9.   Bhasin, S, Storer TW, Berman N, Yarasheski KE, Cleveneger B, and Casaburi RA. A replacement dose of testosterone increases fat-free mass and muscle size in hypogonadal men. J Clin Endocrinol Metab 82: 407-413, 1997[Abstract/Free Full Text].

10.   Bhasin, S, Storer TW, Javanbakht M, Berman N, Yarasheski KE, Phillips J, Dike M, Sinha-Hikim I, Shen R, Hays RD, and Beall G. Testosterone replacement and resistance exercise in HIV-infected men with weight loss and low testosterone levels. JAMA 283: 763-770, 2000[Abstract/Free Full Text].

11.   Bhasin, S, Woodhouse L, Casaburi R, Singh AB, Bhasin D, Berman N, Magliano L, Dzekov C, Dzekov J, Bross R, Phillips J, Sinha-Hikim I, Shen R, and Storer TW. Testosterone dose response relationships in healthy young men. Am J Physiol Endocrinol Metab 281: E1172-E1181, 2001[Abstract/Free Full Text].

12.   Brodsky, IG, Balagopal P, and Nair SK. Effects of testosterone replacement on muscle mass and muscle protein synthesis in hypogonadal men---a clinical research center study. J Clin Endocrinol Metab 81: 3469-3475, 1996[Abstract].

13.   Celsing, F, Blomstrand E, Melichna J, Terrados N, Clausen N, Lins PE, and Jansson E. Effect of hyperthyroidism on fiber-type composition, fiber area, glycogen content and enzyme activity in human skeletal muscle. Clin Physiol 6: 171-181, 1986[Web of Science][Medline].

14.   Deveci, D, Janice MM, and Egginton S. Relationship between capillary angiogenesis, fiber type, and fiber size in chronic systemic hypoxia. Am J Physiol Heart Circ Physiol 281: H241-H252, 2001[Abstract/Free Full Text].

15.   Donalies, M, Cramer M, Ringwald M, and Starzininski-Powitz A. Expression of M-cadherin, a member of the cadeherin multigene family, correlates with differentiation of skeletal muscle cells. Proc Natl Acad Sci USA 88: 8024-8028, 1991[Abstract/Free Full Text].

16.   Forbes, GB, Porta CR, Herr BE, and Griggs RC. Sequence of changes in body composition induced by testosterone and reversal of changes after drug is stopped. JAMA 267: 397-399, 1992[Abstract/Free Full Text].

17.   Frontera, WR, Suh D, Krivickas LS, Hughes VA, Goldstein R, and Roubenoff R. Skeletal muscle fiber quality in older men and women. Am J Physiol Cell Physiol 279: C611-C618, 2000[Abstract/Free Full Text].

18.   Griggs, RC, Kingston W, Jozefowicz RF, Herr BE, Forbes G, and Halliday D. Effect of testosterone on muscle mass and muscle protein synthesis. J Appl Physiol 66: 498-503, 1989[Abstract/Free Full Text].

19.   Grinspoon, S, Corcoran C, Askari H, Schoenfeld D, Wolf L, Burrows B, Walsh M, Hayden D, Parlman K, Anderson E, Basgoz N, and Klibanski A. Effects of androgen administration in men with the AIDS wasting syndrome: a randomized, double-blind, placebo-controlled trial. Ann Intern Med 129: 18-26, 1998[Abstract/Free Full Text].

20.   Gonyea, W, Ericson GC, and Bonde-Petersen F. Skeletal muscle fiber splitting induced by weight-lifting exercise in cats. Acta Physiol Scand 99: 105-109, 1977[Web of Science][Medline].

21.   Hansen-Smith, FM, Blackwell LH, and Joswiak GR. Expression of muscle capillary alkaline phosphatase is affected by hypoxia. J Appl Physiol 73: 776-780, 1992[Abstract/Free Full Text].

22.   Holmang, A, Svedberg J, Jennische E, and Bjorntorp P. Effect of testosterone on muscle insulin sensitivity and morphology in female rats. Am J Physiol Endocrinol Metab 259: E555-E560, 1990[Abstract/Free Full Text].

23.   Joubert, Y, and Tobin C. Testosterone treatment results in quiescent satellite cells being activated and recruited into cell cycle in rat levator ani muscle. Dev Biol 169: 286-294, 1995[Web of Science][Medline].

25.   Kadi, F, and Thornell LE. Concomitant increases in myonuclear and satellite cell content in female trapezius muscle following strength training. Histochem Cell Biol 113: 99-103, 2000[Web of Science][Medline].

26.   Katznelson, L, Finkelstein JS, Schoenfeld DA, Rosenthal DI, Anderson EJ, and Klibanski A. Increase in bone density and lean body mass during testosterone administration in men with acquired hypogonadism. J Clin Endocrinol Metab 81: 4358-4365, 1996[Abstract].

27.   Kelley, G. Mechanical overload and skeletal muscle fiber hyperplasia: a meta analysis. J Appl Physiol 81: 1584-1587, 1996[Abstract/Free Full Text].

28.   Kuzon, WM, Rosenblatt JD, Huebel SC, Leatt P, Plyley MJ, McKee NH, and Jacobs I. Skeletal muscle fiber type, fiber size, and capillary supply in elite soccer players. Int J Sports Med 11: 99-102, 1990[Web of Science][Medline].

29.   Lomax, RB, and Robertson WR. The effects of hypothyroidism and hyperthyroidism on fiber composition and mitochondrial enzyme activities in rat skeletal muscle. J Endocrinol 133: 375, 1992[Abstract/Free Full Text].

30.   Mauras, N, Hayes V, Welch S, Veldhuis J, and Urban R. Testosterone deficiency in young men: marked alterations in whole body protein kinetics, strength and adiposity. J Clin Endocrinol Metab 83: 1886, 1998[Abstract/Free Full Text].

31.   McCall, GE, Byrnes WC, Dickinson A, Pattany PM, and Fleck SJ. Muscle fiber hypertrophy, hyperplasia, and capillary density in college men after resistance training. J Appl Physiol 81: 2004-2012, 1996[Abstract/Free Full Text].

32.   Nnodim, J. Testosterone mediates satellite cell activation in denervated rat levator ani muscle. Anat Rec 263: 19-24, 2001[Medline].

33.   Nwoye, L, and Mommaerts WFHM The effects of thyroid status on some properties of rat fast-twitch muscle. J Muscle Res Cell Motil 2: 307-320, 1981[Web of Science][Medline].

34.   Ohlsson, C, and Jennische E. Effects in skeletal soleus muscle of supraphysiological growth hormone stimulation. Eur J Endocrinol 133: 678-679, 1995[Abstract/Free Full Text].

35.   Pavlou, SN, Brewer K, Farley MG, Linder J, Bastias MC, Rogers BJ, Swift LL, Rivier JE, and Vale WW. Combined administration of a gonadotropin-releasing hormone antagonist and testosterone in men induces reversible azoospermia without loss of libido. J Clin Endocrinol Metab 73: 1360-1369, 1991[Abstract/Free Full Text].

36.   Pette, D, and Staron RS. Mammalian skeletal muscle fiber type transitions. Int Rev Cytol 170: 143-223, 1997[Medline].

37.   Putman, CT, Dusterhoft S, and Pette D. Satellite cell proliferation in low frequency-stimulated fast muscle of hypothyroid rat. Am J Physiol Cell Physiol 279: C682-C690, 2000[Abstract/Free Full Text].

38.   Reimann, J, Irintchev A, and Wering A. Regenerative capacity and the number of satellite cells in soleus muscles of normal and mdx mice. Neuromuscul Disord 10: 276-282, 2000[Web of Science][Medline].

39.   Salviati, G, Betto R, Danieli Betto D, and Zeviani M. Myofibrillar-protein isoforms and sarcoplasmic-reticulum Ca2+-transport activity of single human muscle fibres. Biochem J 224: 215-225, 1984[Web of Science][Medline].

40.   Scarpelli, M, Belardinell IR, and Provinciali L. Quantitative analysis of changes occurring in muscle vastus lateralis in patients with heart failure after low intensity training. Anal Quant Cytol Histol 21: 374-380, 1999[Web of Science][Medline].

41.   Sinha Hikim, AP, Bartke A, and Russell L. Morphometric studies on hamster testis in gonadally active and inactive states: light microscope findings. Biol Reprod 39: 1225-1237, 1988[Abstract].

42.   Sinha-Hikim, I, Arver S, Beall G, Shen S, Guerrero M, Satler F, Shikuma C, Nelson J, Landgren BM, Mazer N, and Bhasin S. The use of a sensitive equilibrium dialysis method for the measurement of free testosterone levels in healthy, cycling women and in human immunodeficiency virus infected men. J Clin Endocrinol Metab 83: 1312-1318, 1998[Abstract/Free Full Text].

43.   Snyder, PJ, Peachey H, Berlin JA, Hannoush P, Haddad G, Dlewati A, Santanna J, Loh L, Lenrow DA, Holmes JH, Kapoor SC, Atkinson LE, and Strom BL. Effects of testosterone replacement in hypogonadal men. J Clin Endocrinol Metab 85: 2670-2677, 2000[Abstract/Free Full Text].

44.   Tobin, C, and Joubert Y. The levator ani of the female rat: a suitable model for studying the effects of testosterone on the development of mammalian muscle. Biol Struct Morphog 1: 28-33, 1988[Medline].

45.   Tucek, S, Kostirova D, and Gutmann E. Testosterone-induced changes of choline acetyl-transferase and cholinesterase activities in rat levator ani muscle. J Neurol Sci 27: 353-362, 1976[Web of Science][Medline].

46.   Wang, C, Swerdloff RS, Iranmanesh A, Dobs A, Snyder PJ, Cunningham G, Matsomoto AM, Weber T, and Berman N. Transdermal testosterone gel improves sexual function, mood, muscle strength, and body composition parameters in hypogonadal men. J Clin Endocrinol Metab 85: 2839-2853, 2000[Abstract/Free Full Text].

47.   Weibel, ER, Taylor CR, and Hoppler H. The concept of symorphosis: a testable hypothesis of structure-function relationship. Proc Natl Acad Sci USA 88: 10357-10361, 1991[Abstract/Free Full Text].

48.   Wright, C, Haddad F, Qin AX, and Baldwin KM. Analysis of myosin heavy chain mRNA expression by RT-PCR. J Appl Physiol 83: 1389-1396, 1997[Abstract/Free Full Text].

49.   Young, NR, Baker HWG, Liu G, and Seeman E. Body composition and muscle strength in healthy men receiving testosterone enanthate for contraception. J Clin Endocrinol Metab 77: 1028-1032, 1993[Abstract].


Am J Physiol Endocrinol Metab 283(1):E154-E164
0193-1849/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. B. S. Harris, E. W. Kelso, W. P. Flatt, H. J. Grill, and T. J. Bartness
Testosterone replacement does not normalize carcass composition in chronically decerebrate male rats
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2009; 296(6): R1687 - R1694.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
J. F. Husak and D. J. Irschick
Steroid use and human performance: lessons for integrative biologists
Integr. Comp. Biol., May 22, 2009; (2009) icp015v1.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Sports. Med.Home page
C Baldari, L Di Luigi, G P Emerenziani, M C Gallotta, P Sgro, and L Guidetti
Is explosive performance influenced by androgen concentrations in young male soccer players?
Br. J. Sports Med., March 1, 2009; 43(3): 191 - 194.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. L. Vingren, W. J. Kraemer, D. L. Hatfield, J. M. Anderson, J. S. Volek, N. A. Ratamess, G. A. Thomas, J.-Y. Ho, M. S. Fragala, and C. M. Maresh
Effect of resistance exercise on muscle steroidogenesis
J Appl Physiol, December 1, 2008; 105(6): 1754 - 1760.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
D. A. King, F. Cordova, and S. M. Scharf
Nutritional Aspects of Chronic Obstructive Pulmonary Disease
Proceedings of the ATS, May 1, 2008; 5(4): 519 - 523.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
W. R. Dayton and M. E. White
Cellular and molecular regulation of muscle growth and development in meat animals
J Anim Sci, April 1, 2008; 86(14_suppl): E217 - E225.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
K. Brauck, C. J Galban, S. Maderwald, B. L Herrmann, and M. E Ladd
Changes in calf muscle elasticity in hypogonadal males before and after testosterone substitution as monitored by magnetic resonance elastography
Eur. J. Endocrinol., June 1, 2007; 156(6): 673 - 678.
[Abstract] [Full Text] [PDF]


Home page
ERRHome page
R. Casaburi
Impacting patient-centred outcomes in COPD: deconditioning
Eur. Respir. Rev., December 1, 2006; 15(99): 42 - 46.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
T. Enoki, Y. Yoshida, J. Lally, H. Hatta, and A. Bonen
Testosterone increases lactate transport, monocarboxylate transporter (MCT) 1 and MCT4 in rat skeletal muscle
J. Physiol., November 15, 2006; 577(1): 433 - 443.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. Troosters, R. Casaburi, R. Gosselink, and M. Decramer
Pulmonary Rehabilitation in Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., July 1, 2005; 172(1): 19 - 38.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. Casaburi, S. Bhasin, L. Cosentino, J. Porszasz, A. Somfay, M. I. Lewis, M. Fournier, and T. W. Storer
Effects of Testosterone and Resistance Training in Men with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., October 15, 2004; 170(8): 870 - 878.
[Abstract] [Full Text] [PDF]


Home page
Am J Sports MedHome page
N. A. Evans
Current Concepts in Anabolic-Androgenic Steroids
Am. J. Sports Med., March 1, 2004; 32(2): 534 - 542.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
S. Bhasin, W. E. Taylor, R. Singh, J. Artaza, I. Sinha-Hikim, R. Jasuja, H. Choi, and N. F. Gonzalez-Cadavid
The Mechanisms of Androgen Effects on Body Composition: Mesenchymal Pluripotent Cell as the Target of Androgen Action
J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2003; 58(12): M1103 - 1110.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
S. Bhasin
Testosterone Supplementation for Aging-Associated Sarcopenia
J. Gerontol. A Biol. Sci. Med. Sci., November 1, 2003; 58(11): M1002 - 1008.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Reisz-Porszasz, S. Bhasin, J. N. Artaza, R. Shen, I. Sinha-Hikim, A. Hogue, T. J. Fielder, and N. F. Gonzalez-Cadavid
Lower skeletal muscle mass in male transgenic mice with muscle-specific overexpression of myostatin
Am J Physiol Endocrinol Metab, October 1, 2003; 285(4): E876 - E888.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
I. Sinha-Hikim, S. M. Roth, M. I. Lee, and S. Bhasin
Testosterone-induced muscle hypertrophy is associated with an increase in satellite cell number in healthy, young men
Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E197 - E205.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. J. Woodhouse, S. Reisz-Porszasz, M. Javanbakht, T. W. Storer, M. Lee, H. Zerounian, and S. Bhasin
Development of models to predict anabolic response to testosterone administration in healthy young men
Am J Physiol Endocrinol Metab, May 1, 2003; 284(5): E1009 - E1017.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/1/E154    most recent
00502.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinha-Hikim, I.
Right arrow Articles by Bhasin, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinha-Hikim, I.
Right arrow Articles by Bhasin, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online