|
|
||||||||
Endocrinology Division, Mayo Clinic, Rochester, Minnesota 55905
| |
ABSTRACT |
|---|
|
|
|---|
High-fat diets are reported to increase oxidative stress in a variety of tissues, whereas antioxidant supplementation prevents many diseases attributed to high-fat diet. Rodent skeletal muscle mitochondrial DNA has been shown to be a potential site of oxidative damage. We hypothesized that the effects of a high-fat diet on skeletal muscle DNA functions would be attenuated or partially reversed by antioxidant supplementation. Gene expression profiling and measurement of mitochondrial ATP production capacity were performed in skeletal muscle from male rats after feeding one of three diets (control, high-fat diet with or without antioxidants) for 36 wk. The high-fat diet altered transcript levels of 18 genes of 800 surveyed compared with the control-fed rats. Alterations included reduced expression of genes involved in free-radical scavenging and tissue development and increased expression of stress response and signal transduction genes. The magnitude of these alterations due to high-fat diet was reduced by antioxidant supplementation. Real-time PCR measurements confirmed the changes in transcript levels of cytochrome c oxidase subunit III and superoxide dismutase-1 and -2 noted by microarray approach. Mitochondrial ATP production was unaltered by dietary changes or antioxidant supplemention. It is concluded that the high-fat diet increases the transcription of genes involved in stress response but reduces those of free-radical scavenger enzymes, resulting in reduced DNA repair/metabolism (increased DNA damage). Antioxidants partially prevent these changes. Mitochondrial functions in skeletal muscle remain unaltered by the dietary intervention due to many adaptive changes in gene transcription.
antioxidants; gene expression; mitochondrial adenosine triphosphate production
| |
INTRODUCTION |
|---|
|
|
|---|
A HIGH-FAT DIET HAS BEEN REPORTED to adversely affect the health of human and animal species (7, 23, 25, 26). It has been reported that high levels of unsaturated fat increase fat-mediated oxidative stress and decrease antioxidative enzyme activity (22). A high-fat diet has been reported to increase atherogenesis (23, 24) and impairs glucose metabolism in rat skeletal muscle, which is the major site of insulin-stimulated glucose disposal (10). Feeding a high-fat diet to rodents has been shown to cause whole body and skeletal muscle insulin resistance (9, 32), hyperinsulinemia, and hyperglycemia (12) and, if continued for a longer period, could lead to the development of diabetes (26). An increased incidence of cancer with high-fat diet has been reported in experimental animals (30). In contrast, there are various reports indicating the beneficial effects of antioxidant supplementation in preventing cancer (3) and cardiovascular disease (19). It implies that oxidative damage and its consequences may result in many chronic health problems that are attributed to a high-fat diet. It has been proposed that mitochondrial DNA is especially susceptible to reactive oxygen species (ROS) damage (29).
We hypothesized that a high-fat diet would alter the transcription of genes involved in many body functions, especially those involved in ROS scavenging and mitochondrial ATP production. The purpose of this study was to determine the impact of a high-fat diet on rat skeletal muscle gene expression and mitochondrial function. We also determined whether these changes could be prevented or attenuated by antioxidant (vitamins A and E and selenium) supplementation.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Animals and experimental protocol.
Male Sprague-Dawley rats were purchased from Harlan (Indianapolis, IN)
at ~10 wk of age and were maintained on a standard chow diet for 2 wk. The following experiments were started after the animals were in
our facility for 2 wk and lasted for an additional 36 wk. Animals were
randomly assigned to one of the following dietary groups
(n = 6 animals/group). The control group
(Control) diet consisted of AIN-93G (Dyets, Bethlehem, PA), with
protein (15%), fat (25%), and carbohydrate (60%), methionine (3 g/kg), mineral mix (50 g/kg), and vitamin mix (1 g/kg). Adequate
amounts of selenium (1.24 g/kg) and DL-
-tocopherol
acetate (0.05 g/kg) were included. For the high-fat diet
group (HFD), the high-fat diet consisted of the same antioxidant
content as the control diet but was supplemented with additional
calories in the form of whole-milk powder and sweetener. The final
composition of this diet was protein (20%), fat (60%), and
carbohydrate (20%), with the same amount of vitamins and minerals. For
the group having a high-fat diet supplemented with antioxidants
(HFD+AO), the diet received by the HFD group was supplemented with
additional antioxidants (8,000 IU vitamin A, 300 IU vitamin E, and 0.5 mg/kg selenium).
80°C until analysis.
Analysis of gene transcripts. To determine the muscle gene transcript profile in HFD and HFD+AO groups, the relative abundance of mRNAs in these two groups was compared with that of the control group by use of high-density oligonucleotide microarrays containing probes for ~800 genes (U34 array; Affymetrix, Santa Clara, CA).
GeneChip expression probe array. GeneChip expression probe arrays contain collections of pairs of probes for each of the mRNAs being analyzed (16). Each probe pair consists of a 25-mer that is perfectly complementary (referred to as a perfect match, or PM) to a subsequence of a particular message and a companion 25-mer that is identical except for a single base difference in the central position. The mismatch (MM) probe of each pair serves as an internal control for hybridization specificity. The analysis of PM-MM pairs allows low-intensity hybridization patterns from mRNAs to be sensitively and accurately recognized in the presence of cross-hybridization signals.
RNA isolation. Total RNA was isolated from frozen muscle tissue (gastrocnemius) by using TRIzol reagent (Life Technologies, Gaithersburg, MD), which was further purified using an affinity resin column (RNeasy; Qiagen, Chatsworth, CA). Total RNA thus isolated was converted to cDNA by use of the Superscript cDNA synthesis kit (GIBCO-BRL, Gaithersburg, MD). Double-stranded cDNA was then purified by phase lock gel (Eppendorf, Westbury, NY) with phenol-chloroform extraction (17).
Sample preparation, fragmentation, array hybridization, and scanning. The purified cDNA was used as a template for the in vitro transcription reaction for the synthesis of biotinylated cRNA with the use of RNA transcript labeling reagent (Affymetrix). This labeled cRNA was fragmented and hybridized onto the U34 array as described (17). Briefly, appropriate amounts of fragmented cRNA and control oligonucleotide B2 were added along with control cRNA (BioB, BioC, BioD), herring sperm DNA, and BSA to the hybridization buffer. The hybridization mixture was heated at 99°C for 5 min followed by incubation at 45°C for 5 min before the sample was injected into the microarray. Then, the hybridization was carried out at 45°C for 16 h with mixing on a rotisserie at 60 rpm. After hybridization, the solutions were removed, and the arrays were washed and stained with streptavidinphycoerythrin (Molecular Probes, Eugene, OR). After washes, probe arrays were scanned using the Hewlett-Packard GeneChip system confocal scanner (17). The quality of the fragmented biotin-labeled cRNA in each experiment was evaluated before being hybridized onto the U34 expression array by both gel electrophoresis and hybridizing (fraction of the sample) onto a test-2 array and analysis as a measure of quality control. For the gene transcript analysis by the high-density microarrays, we used the pooled muscle samples (120 mg) from six rats in each group (~20 mg from each rat).
Data analysis.
GeneChip 3.0 (Affymetrix) was used to scan and quantitatively analyze
the scanned image. Once the probe array had been scanned, GeneChip
software automatically calculated intensity values for each probe cell
and made a presence or absence call for each mRNA. Algorithms in the
software used probe cell intensities to calculate an average intensity
for each set of probe pairs representing a gene that directly
correlated with the amount of mRNA. Spotfire (Spotfire, Cambridge, MA)
and Microsoft Excel were also used for data analysis. Expression
patterns for each group (HFD and HFD+AO) were compared with those of
the control group. When the difference between two different RNA
samples was assessed, the fold changes from side-by-side experiments on
the same lot of microarrays were compared directly. In this analysis,
we considered gene transcripts altered at least twofold and the average
difference intensity
1,000 as significant to remove the
false-positive as well as low-abundance genes. These genes were
classified into different groups according to their metabolic
function (Table 1).
|
RNA isolation and cDNA synthesis for real-time PCR. Total RNA was extracted from skeletal muscle tissue (~10 mg) of each rat by the TRIzol method (Life Technologies). One microgram of total RNA from each rat and the pooled (1 µg of total RNA from each rat in the same group was pooled) were separately treated with DNase (Life Technologies) and then reverse transcribed using the TaqMan Reverse Transcription Reagents (PE Biosystems, Foster City, CA) according to the manufacturer's instructions for real-time PCR.
Real-time PCR. Primers and probes were selected for cytochrome c oxidase (COX) III, superoxide dimutase (SOD)-1, and SOD-2 by means of the Primer Express software (PE Biosystems). The details about the real-time PCR method have been described elsewhere (1).
The following primer and probe sequences were used. 28S (GenBank accession no. V01270) forward primer: TGGGAATGCAGCCCAAAG, reverse primer: CCTTACGGTACTTGTTGGCTATCG, probe: TGGTAAACTCCATCTAAGGCTAAATACCGGCA; SOD-1 (GenBank accession no. Y00404) forward primer: GCGGTCCAGCGGATGA, reverse primer: GTCCTTTCCAGCAGCCACAT, probe: GCCCAGGTCTCCAACATGCCT; SOD-2 (GenBank accession no. Y00497) forward primer: CACGACCCACTGCAAGGAA, reverse primer: GCGTGCTCCCACACATCA, probe: ACAGGCCTTATTCCACTGCTGGG; COX III (GenBank accession no. J01435) forward primer: GAAGCCGCAGCATGATACTG, reverse primer: TTTTTTTTTTTTTTTTTTTTTTTTTAGGATC, probe: CACTTCGTAGATGTAGTTTGACTATTCCTATACGT. The probes for SOD-1 and SOD-2 genes were designed to span exon boundaries to ensure no amplification of contaminating DNA. Because the mitochondrial genome does not contain introns, the reverse primer for COX III was designed to target several of the final nucleotides specific to COX III as well as a string of the poly(A)+ tail that is present only in the mRNA. We applied this highly sensitive and reproducible real-time PCR method (1) to quantify COX III, SOD-1, and SOD-2 mRNA. The signal for 28S ribosomal RNA was used to normalize against differences in RNA isolation and RNA degradation and in the efficiencies of the reverse transcription and PCR reactions. All samples were run in triplicate and were quantitated by normalizing the COX III, SOD-1, and SOD-2 signals with the 28S signal. The final quantitation was achieved by a relative standard curve. We measured the transcript levels of these three genes individually before pooling from each of these six rats and after pooling the total RNA, and both experiments gave the same results.Northern blot analysis of uncoupling proteins-2 and -3. cDNA probes for uncoupling protein (UCP)-2, UCP-3, and 28S rRNA transcripts were generated by RT-PCR amplification from control and HFD rat muscle total RNA. Primers for the UCP-2 probe corresponded to nucleotides 467-490 (forward) and 1196-1205 (reverse, PCR product of 746 bp) of the rat UCP-2 sequence (GenBank accession no. AB010743). Primers for the UCP-3 probe corresponded to nucleotides 235-254 (forward) and 980-1003 (reverse, PCR product of 768 bp) of the rat UCP-3 sequence (GenBank accession no. U92069). Primers for the 28S rRNA probe corresponded to nucleotides 4203-4222 (forward) and 4370-4389 (reverse, PCR product 186 bp) of the rat ribosomal RNA genome (GenBank accession no. V01270). Amplification products were cloned into the TA-plasmid vector (TA Cloning kit; Invitrogen), as previously described (2). Total RNA isolation, Northern blotting, and hybridization to UCP-2, UCP-3, and 28S probes (in that order) were performed as described (2). Resulting images were quantified by laser densitometry (Ultroscan; Pharmacia), and UCP bands were normalized to the corresponding 28S rRNA band.
Mitochondrial ATP production rate.
Mitochondria were purified from skeletal muscle, and ATP production was
determined using a bioluminescence technique as previously described
(21, 31). Mitochondrial suspensions diluted in
ATP-monitoring reagent (AMR; formula SL; BioThema, Dalarö,
Finland) were added to cuvettes containing AMR, substrate, and ADP. The
substrates added (in mM final concentration) were 1) 1 pyruvate plus 1 malate, 2) 1 palmitoyl-L-carnitine plus 1 malate, 3) 10
-ketoglutarate, or 4) 1 pyruvate plus 0.05 palmitoyl-L-carnitine plus 1 malate plus 10
-ketoglutarate, with additional blank tubes used for measuring
background. ATP production for all reactions was monitored simultaneously at 25°C with an automated routine in a BioOrbit 1251 luminometer (BioOrbit Oy, Turku, Finland). Internal calibration of each
reaction cuvette was performed by addition of an ATP standard. Citrate
synthase activity was measured in mitochondria and tissue homogenates
as previously described (21) and used to calculate the ATP
production rate.
| |
RESULTS |
|---|
|
|
|---|
Body weight. We measured the body weight of 12-wk-old rats (395 ± 0.2 g) just before the start of the various feeding programs and randomized six rats each into three different groups (control, HFD, and HFD+AO). At the conclusion of the 36-wk study, the HFD (730 ± 21.6 g) and HFD+AO (769 ± 24.3 g) animals had similar body weights and were heavier than the control (626 ± 24.6 g) animals (P < 0.01).
Gene transcript levels.
Comparisons were made between control animals and animals from the two
intervention groups (HFD and HFD+AO). Alterations in gene transcripts
involving several functions were identified (Table 1). Of 800 genes
whose expression pattern we monitored using high-density
oligonucleotide microarrays, 18 (
8 and
10) and 19 (
10 and
9) gene transcripts were altered at least twofold in HFD and HFD+AO
rats, respectively, compared with the controls.
1-subunit],
iron transport (transferrin receptor), sulfur metabolism
(hydroxysteroid sulfotransferase), and unknown function (serum amyloid A).
Of the 18 gene transcripts found altered in HFD rats, 4 were completely
normalized and 12 were partially normalized by antioxidant supplementation for 36 wk (Table 1). Stress-inducible chaperone mitochondrial GrpE, chaperonin 60, and DnaJ-like protein (RDJ1), all
involved in stress response/chaperone function, and NADH dehydrogenase, involved in energy metabolism, are the four genes whose expression was
normalized. Twelve transcripts partially normalized,
including growth arrest and DNA damage-inducible gene (GADD)45,
DNA polymerase-
, Cu-Zn SOD, glutathione peroxidase I, Mn-SOD,
Ras-related protein, protein kinase, hydroxysteroid
sulfotransferase, vascular endothelial cell growth factor, vascular
cell adhesion molecule-1, transferrin receptor, and
Na+-K+-ATPase
1-subunit. In
addition, antioxidant supplementation increased the transcript levels
of four additional genes [glutathione-S-transferase, NADH-ubiquinone oxidoreductase, glucose-regulated protein, and heat
shock protein (HSP)E7I], which were normal in the HFD group, whereas
serum amyloid A protein showed a further increase with antioxidant supplementation.
We validated three of the gene transcript expression levels using the
real-time PCR approach (Fig. 1). The
real-time PCR analysis also showed that, in HFD animals, SOD-1 and
SOD-2 mRNA levels were reduced compared with control animals, which was
in agreement with the microarray data. In HFD+AO animals, SOD-1 and
SOD-2 gene transcript levels by real-time PCR were higher than in HFD
animals, as was also shown by microarray analysis.
|
UCP-2 and UCP-3 expression. UCP-2 transcript levels were higher in HFD rats (2.73 ± 0.35) than in controls (1.80 ± 0.2; P < 0.05), whereas no significant difference in UCP-3 transcripts was observed between HFD (4.72 ± 1.50) and the control (5.61 ± 0.99) rats. UCP-2 and UCP-3 transcripts were not measured in HFD+AO animals.
Mitochondrial ATP production and citrate synthase activity.
As shown in Table 2, mitochondrial ATP
production rates and citrate synthase activity were not
different among the groups.
|
| |
DISCUSSION |
|---|
|
|
|---|
The focus of the current study was to determine the effect of high-fat diet on gene transcript profiles and mitochondrial function in skeletal (gastrocnemius) muscle of rats. To determine whether changes in gene transcript profiles could be attenuated or prevented by supplementation with antioxidants, we measured gene transcript profiles in skeletal muscle from animals that were kept on a high-fat diet and antioxidant supplements. Skeletal muscle is a major organ involved in oxidation of circulating fatty acids and a potential site of ROS damage. The microarray approach provides an opportunity to examine this important issue in a global manner. We also confirmed the findings of the microarray approach by measuring transcript levels of three genes (COX III, SOD-1, and SOD-2) by performing real-time PCR. In addition, the study demonstrated that mitochondrial ATP production is maintained at the same level irrespective of the changes in diet.
The most striking aspect of the data set is that ~28% of the genes
that had altered expression in the HFD group are mediators of DNA
damage/repair/free-radical scavenger function. There was a markedly
increased expression of the GADD45 gene in the HFD group, and its
expression declined with antioxidant supplementation. Hollander et al.
(11) and Jackman et al. (14) have shown that GADD45a null mice generated by gene targeting exhibited several phenotypes characteristic of mice deficient in p53, including genomic
instability, increased radiation carcinogenesis, and a low frequency of
exencephaly. It has been shown previously that, in aging rat muscle,
the transcript level of GADD45 is increased (15). Of
interest, the magnitude of increase in GADD45 transcript level was
attenuated by the addition of antioxidants to the high-fat diet,
suggesting that the alteration induced by the high-fat diet is partly
due to oxidative damage by ROS. Gene transcript levels of ROS
scavengers such as SOD-1, SOD-2, and glutathione peroxidase were
significantly decreased in HFD rats along with the DNA repair enzyme
DNA polymerase-
. Both SOD and
glutathione-S-transferase have been shown to play a
protective role against oxidative damage in various tissues by
neutralizing ROS (28, 33). In the present study, 36 wk of
antioxidant supplementation actually improved the expression levels of
several genes involved in free-radical scavenging function along with
SOD and glutathione S-transferase. Removal of the ROS by SOD
and of hydrogen peroxide by catalase and glutathione peroxidase prevent
formation of the very reactive hydroxyl radical, which is postulated to
be responsible for much of the cellular damage. Antioxidant
supplementation for 36 wk partially prevented the alterations in
expression of these genes.
The high-fat diet also resulted in alterations in the expression of
genes involved in cell proliferation/signal transduction such as
mitogen-activated protein kinase (MAPK)-1 (
), Ras-related protein
(
), and protein kinase (
). Antioxidant supplementation did not
alter the transcript levels of MAPK and protein kinase, whereas
Ras-related protein mRNA level was improved. The Ras-MAPK pathway
transduces the mitogenic signals initiated by growth factors and has
been implicated in mammary cancer promotion in rats fed a high-fat diet
(30). Another interesting observation was the upregulation
of several genes involved in stress response in HFD rats, suggesting an
increased oxidative stress associated with these animals. This includes
heat shock protein 70 (HSP70), stress-inducible protein GrpE, RDJ1, and
chaperonin 60. The antioxidant supplement with the high-fat diet
normalized all of these gene expression abnormalities except for HSP70
(which remained upregulated).
Analysis of gene transcript levels in HFD animals also revealed no alterations in genes involved in energy metabolism except NADH dehydrogenase, which was downregulated 2.1-fold in this group compared with the controls. NADH dehydrogenase is part of complex I in the mitochondrial electron transport system and is involved in oxidative phosphorylation. In HFD+AO rats, only one gene involved in energy metabolism, NADH-ubiquinone oxidoreductase, showed alteration (upregulation) among the 800 genes we surveyed. The lack of change in multiple genes of the mitochondrial oxidative phosphorylation pathways may explain why the diets had no effect on ATP production.
Several genes involved in tissue development/growth or cell adhesion function were altered in both of these groups of animals. Cell adhesion represents a process that is vital in immune function and inflammation, and it has been reported that antioxidants regulate cell adhesion by modulating specific signal transduction pathways (20). These include vascular endothelial cell growth factor and vascular cell adhesion molecule-1. The expression of vascular endothelial cell growth factor and vascular cell adhesion molecule-1 were 11.8 and 9.3-fold lower, respectively, in HFD rats compared with the controls. In the HFD+AO group, expression of both of these genes was also reduced compared with controls (Table 1). However, the magnitude of the reduction was less than one-half that in the HFD group, suggesting that antioxidants may have had a significant protective effect on the pathways leading to transcription of these genes.
Na+-K+-ATPase is an integral membrane protein
responsible for establishing and maintaining the electrochemical
gradients of Na+ and K+ ions across the plasma
membrane. Because these gradients are essential for osmoregulation, for
sodium-coupled transport of a variety of organic and inorganic
molecules, and for electrical excitability of nerve and muscle, the
enzyme plays an essential role in cellular physiology. It is composed
of two subunits, a large catalytic subunit (
) and a smaller
glycoprotein subunit (
) of unknown function. In the HFD group
(
3.6), as well as in the HFD+AO group (
2.0), rats showed a
decline in Na+-K+-ATPase
1-subunit transcript level, with a slight improvement in
the HFD+AO group.
To validate the observations in the microarray experiment, we measured
the gene transcript levels of COX III, SOD-1, and SOD-2 using real-time
PCR (Fig. 1). The gene transcript level of COX III, a
mitochondrial-encoded subunit of cytochrome c oxidase, was
decreased 23 and 15%, respectively, in HFD and HFD+AO rats compared
with the controls. Similarly, the gene transcript levels of SOD-1
(
63% HFD,
24% HFD+AO) and SOD-2 (
67% HFD,
23% HFD+AO) also showed a decline in mRNA levels in the HFD groups. The decrease in
transcript levels of SOD-1 and SOD-2 in HFD animals compared with the
control animals (P < 0.01) and the increase in these transcript levels in HFD+AO animals compared with HFD animals (P < 0.05) were significant.
Of interest, it was also noted that mRNA levels of UCP-2 were higher in HFD rats, whereas UCP-3 mRNA levels were similar in HFD animals compared with the control animals. Four weeks of high-fat diet feeding have been shown to increase UCP-3 mRNA (18) and protein expression (5) in skeletal muscle. In contrast, Corbalan et al. (6) have shown that the gastrocnemius UCP-3 mRNA levels were significantly reduced in rats fed a cafeteria diet compared with lean animals. The combination of the low-fat diet received by the control group and the shorter duration of the study could very well explain the difference in result between our present study and these studies (6, 18). There is increasing experimental evidence to indicate that these UCPs are involved in proton leak and regulation (or modulation) of thermogenesis (2, 4, 8, 13, 27). High fat intake appears to promote uncoupling of oxidative phosphorylation, thus allowing possible proton leak. In HFD rats, muscle mitochondrial ATP production and enzyme activity (citrate synthase) were not different from those in control rats. The upregulation of UCP-2 mRNA in HFD rats suggests that proton leak in skeletal muscle of these animals may be increased. This could potentially limit the ability of mitochondria to generate ATP. Because no change in ATP production capacity was observed in this study, however, other potential scenarios must be considered. One possibility is that the UCP-2 mRNAs were not translated in proportion to the rate of gene transcription; another is that the protein produced was not fully functional due to some modifications. There also exists the possibility that uncoupling was offset by other, undetected changes in the mitochondrial oxidation pathway that resulted in maintenance of ATP production. These hypotheses will have to be confirmed by more direct studies.
In summary, the changes in several gene transcripts induced by high-fat
diet and antioxidant intervention are demonstrated in the present
experiment (Table 3). The transcriptional
downregulation of genes involved in the free-radical scavenger process
by high-fat diet suggests that increased oxidative stress/damage
occurred in rats maintained on a high-fat diet. The antioxidant
supplementation modestly improved these gene transcript levels. The
transcriptional activation of stress response genes that process
damaged or misfolded proteins during the feeding period suggests a
central role for protein modifications associated with feeding diets
with different caloric values. Mitochondrial ATP production capacity
was maintained in HFD rats despite increased expression of UCP-2.
|
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Jane Kahl, Dawn Morse, Deborah Rasmussen, and Becca Kurup for technical support.
| |
FOOTNOTES |
|---|
This work was supported by National Institutes of Health Grant R01 AG-09531, a David Murdock Professorship (K. S. Nair), and the Mayo Foundation. K. R. Short was supported by a Postdoctoral Training Award (T32-DK-07352) from the National Research Service.
Address for reprint requests and other correspondence: K. S. Nair, Mayo Clinic & Foundation, 200 1st St. SW, Rm 5-194 Joseph, Rochester, MN 55905 (E-mail: nair.sree{at}mayo.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpendo.00554.2001
Received 19 December 2001; accepted in final form 7 January 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Balagopal, P,
Schimke JC,
Ades PA,
Adey DB,
and
Nair KS.
Age effect on transcript levels and synthesis rate of muscle MHC and response to resistance exercise.
Am J Physiol Endocrinol Metab
280:
E203-E208,
2001
2.
Barazzoni, R,
and
Nair KS.
Changes in uncoupling protein-2 and -3 expression in aging rat skeletal muscle, liver, and heart.
Am J Physiol Endocrinol Metab
280:
E413-E419,
2001
3.
Block, G,
Patterson B,
and
Subar A.
Fruit, vegetables, and cancer prevention: a review of the epidemiological evidence.
Nutr Cancer
18:
1-29,
1992[Web of Science][Medline].
4.
Clapham, JC,
Arch JRS,
Chapman H,
Haynes A,
Lister C,
Moore GBT,
Piercy V,
Carter SA,
Lehner I,
Smith SA,
Beeley LJ,
Godden RJ,
Herrity N,
Skehel M,
Changani KK,
Hockings PD,
Reid DG,
Squires SM,
Hatcher J,
Trail B,
Latcham J,
Rastan S,
Harper AJ,
Cadenas S,
Buckingham JA,
Brand MD,
and
Abuin A.
Mice overexpressing human uncoupling protein-3 in skeletal muscle are hyperphagic and lean.
Nature
406:
415-418,
2000[Medline].
5.
Chou, CJ,
Cha MC,
Jung DW,
Boozer CN,
Hashim SA,
and
Sunyer XP.
High-fat diet feeding elevates skeletal muscle uncoupling protein 3 levels but not its activity in rats.
Obes Res
9:
313-319,
2001[Web of Science][Medline].
6.
Corbalan, MS,
Margareto J,
Martinez JA,
and
Marti A.
High fat feeding reduced muscle uncoupling protein 3 expression in rats.
J Physiol Biochem
55:
67-72,
1999[Web of Science][Medline].
7.
Ghosh, P,
Bitsanis D,
Ghebremeskel K,
Crawford MA,
and
Poston L.
Abnormal aortic fatty acid composition and small artery function in offspring of rats fed a high-fat diet in pregnancy.
J Physiol (Lond)
533:
815-822,
2001
8.
Gong, DW,
Monemdjous S,
Gavrilova O,
Leon LR,
Marcus SB,
Chou CJ,
Everett C,
Kozak LP,
Li C,
Deng C,
Harper ME,
and
Reitman ML.
Lack of obesity and normal response to fasting and thyroid hormone in mice lacking uncoupling protein-3.
J Biol Chem
275:
16251-16257,
2000
9.
Han, DH,
Hansen PA,
Host HH,
and
Holloszy JO.
Insulin resistance of muscle glucose transport in rats fed a high-fat diet: a reevaluation.
Diabetes
46:
1761-1767,
1997[Abstract].
10.
Hansen, PA,
Han DH,
Marshall BA,
Nolte LA,
Chen MM,
Mueckler M,
and
Holloszy JO.
A high-fat diet impairs stimulation of glucose transport in muscle.
J Biol Chem
273:
26157-26163,
1998
11.
Hollander, TM,
Sheikh MS,
Bulavin DV,
Lundgren K,
Augeri HL,
Shehee R,
Molinaro TA,
Kim KE,
Tolosa E,
Ashwell JD,
Rosenberg MP,
Zhan Q,
Salguero PMF,
Morgan WF,
Deng CX,
and
Fornace AJ.
Genomic instability in Gadd45a-deficient mice.
Nat Genet
23:
176-184,
1999[Web of Science][Medline].
12.
Ikemoto, S,
Thompson KS,
Takahashi M,
Itakura H,
Lane MD,
and
Ezaki O.
High-fat diet induced hyperglycemia: prevention by low level expression of a glucose transporter (GLUT4) minigene in transgenic mice.
Proc Natl Acad Sci USA
92:
3096-3099,
1995
13.
Jaburek, M,
Varecha M,
Gimeno RE,
Dembski M,
Jezek P,
Zhang M,
Burn P,
Tartaglia LA,
and
Garlid KD.
Transport function and regulation of mitochondrial uncoupling proteins 2 and 3.
J Biol Chem
274:
26003-26007,
1999
14.
Jackman, J,
Alamo IJ,
and
Fornace AJJ
Genotoxic stress confers preferential and coordinate messenger RNA stability on the five gadd genes.
Cancer Res
54:
5656-5662,
1994
15.
Lee, CK,
Klopp RG,
Weindruch R,
and
Prolla TA.
Gene expression profile of aging and its retardation by caloric restriction.
Science
285:
1390-1393,
1999
16.
Lockhart, DJ,
Dong H,
Byrne MC,
Follettie MT,
Gallo MV,
Chee MS,
Mittmann M,
Wang C,
Kobayashi M,
Horton H,
and
Brown EL.
Expression monitoring by hybridization to high-density oligonucleotide arrays.
Nat Biotechnol
14:
1675-1680,
1996[Web of Science][Medline].
17.
Mahadevappa, M,
and
Warrington JA.
A high-density probe array sample preparation method using 10- to 100-fold fewer cells.
Nat Biotechnol
17:
1134-1136,
1999[Web of Science][Medline].
18.
Matsuda, J,
Hosoda K,
Itoh H,
Son C,
Doi K,
Tanaka T,
Fukunaga Y,
Inoue G,
Nishimura H,
Yoshimasa Y,
Yamori Y,
and
Nakao K.
Cloning of rat uncoupling protein-3 and uncoupling protein-2 cDNAs: their gene expression in rats fed high-fat diet.
FEBS Lett
418:
200-204,
1997[Web of Science][Medline].
19.
Rozewicka, L,
Wiszniewska BB,
Wojcicki J,
Samochowiec L,
and
Krasowska B.
Protective effect of selenium and vitamin E against changes induced in heart vessels of rabbits fed chronically on a high-fat diet.
Kitasato Arch Exp Med
64:
183-192,
1991[Medline].
20.
Sen, CK,
and
Roy S.
Antioxidant regulation of cell adhesion.
Med Sci Sports Exerc
33:
377-381,
2001[Web of Science][Medline].
21.
Short, KR,
Nygren J,
Barazzoni R,
Levine J,
and
Nair KS.
T3 increases mitochondrial ATP production in oxidative muscle despite increased expression of UCP2 and -3.
Am J Physiol Endocrinol Metab
280:
E761-E769,
2001
22.
Slim, RM,
Toborek M,
Watkins BA,
Boissonneault GA,
and
Hennig B.
Susceptibility to hepatic oxidative stress in rabbits fed different animal and plant fats.
J Am Coll Nutr
15:
289-294,
1996[Abstract].
23.
Steinberg, D.
Antioxidants and atherosclerosis. A current assessment.
Circulation
84:
1420-1425,
1991
24.
Steinberg, D.
Antioxidants in the prevention of human atherosclerosis. Summary of the Proceedings of a National Heart, Lung, and Blood Institute Workshop: September 5-6, 1991, Bethesda, MD.
Circulation
85:
2337-2344,
1992
25.
Storlien, LH,
Baur LA,
Kriketos AD,
Pan DA,
Cooney GJ,
Jenkins AB,
Calvert GD,
and
Campbell LV.
Dietary fats and insulin action.
Diabetologia
39:
621-631,
1996[Web of Science][Medline].
26.
Surwit, RS,
Kuhn CM,
Cochrane C,
McCubbin JA,
and
Feinglos MN.
Diet induced type II diabetes in C57BL/6J mice.
Diabetes
37:
1163-1167,
1988[Abstract].
27.
Vidal-Ping, AJ,
Grujic D,
Zhang CY,
Hagen T,
Boss O,
Ido Y,
Szczepanik A,
Wade J,
Mootha V,
Cortright R,
Muoio DM,
and
Lowell BB.
Energy metabolism in uncoupling protein 3 gene knockout mice.
J Biol Chem
275:
16258-16266,
2000
28.
Vontas, JG,
Small GJ,
and
Hemingway J.
Glutathione S-transferases as antioxidant defense agents.
Biochem J
357:
65-72,
2001[Web of Science][Medline].
29.
Wallace, DC.
Mitochondrial genetics: a paradigm for aging and degenerative diseases?
Science
256:
628-632,
1992
30.
Wang, Z,
Pei H,
Kaeck M,
and
Lu J.
Mammary cancer promotion and MAPK activation associated with consumption of a corn oil-based high-fat diet.
Nutr Cancer
34:
140-146,
1999[Web of Science][Medline].
31.
Wibom, R,
Lundin A,
and
Hultman E.
A sensitive method for measuring ATP-formation in rat muscle mitochondria.
Scand J Clin Lab Invest
50:
143-152,
1990[Web of Science][Medline].
32.
Wilkes, JJ,
Bonen A,
and
Bell RC.
A modified high-fat diet induces insulin resistance in rat skeletal muscle but not adipocytes.
Am J Physiol Endocrinol Metab
38:
E679-E686,
1998.
33.
Zaken, V,
Kohen R,
and
Ornoy A.
Vitamins C and E improve rat embryonic antioxidant defense mechanism in diabetic culture medium.
Teratology
64:
33-44,
2001[Web of Science][Medline].
This article has been cited by other articles:
![]() |
K. R. Short, B. Drew, and C. Leeuwenburgh Mitochondrial ATP measurements Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2004; 287(1): R243 - R246. [Full Text] [PDF] |
||||
![]() |
K. S. Nair, A. Jaleel, Y. W. Asmann, K. R. Short, and S. Raghavakaimal Proteomic research: potential opportunities for clinical and physiological investigators Am J Physiol Endocrinol Metab, June 1, 2004; 286(6): E863 - E874. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kato and T. Kimura Evaluation of the Effects of the Dietary Intake of Proteins and Amino Acids by DNA Microarray Technology J. Nutr., June 1, 2003; 133(6): 2073S - 2077. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |