AJP - Endo Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 282: E1055-E1061, 2002; doi:10.1152/ajpendo.00554.2001
0193-1849/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sreekumar, R.
Right arrow Articles by Nair, K. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sreekumar, R.
Right arrow Articles by Nair, K. S.
Vol. 282, Issue 5, E1055-E1061, May 2002

Impact of high-fat diet and antioxidant supplement on mitochondrial functions and gene transcripts in rat muscle

R. Sreekumar, J. Unnikrishnan, A. Fu, J. Nygren, K. R. Short, J. Schimke, R. Barazzoni, and K. Sreekumaran Nair

Endocrinology Division, Mayo Clinic, Rochester, Minnesota 55905


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

High-fat diets are reported to increase oxidative stress in a variety of tissues, whereas antioxidant supplementation prevents many diseases attributed to high-fat diet. Rodent skeletal muscle mitochondrial DNA has been shown to be a potential site of oxidative damage. We hypothesized that the effects of a high-fat diet on skeletal muscle DNA functions would be attenuated or partially reversed by antioxidant supplementation. Gene expression profiling and measurement of mitochondrial ATP production capacity were performed in skeletal muscle from male rats after feeding one of three diets (control, high-fat diet with or without antioxidants) for 36 wk. The high-fat diet altered transcript levels of 18 genes of 800 surveyed compared with the control-fed rats. Alterations included reduced expression of genes involved in free-radical scavenging and tissue development and increased expression of stress response and signal transduction genes. The magnitude of these alterations due to high-fat diet was reduced by antioxidant supplementation. Real-time PCR measurements confirmed the changes in transcript levels of cytochrome c oxidase subunit III and superoxide dismutase-1 and -2 noted by microarray approach. Mitochondrial ATP production was unaltered by dietary changes or antioxidant supplemention. It is concluded that the high-fat diet increases the transcription of genes involved in stress response but reduces those of free-radical scavenger enzymes, resulting in reduced DNA repair/metabolism (increased DNA damage). Antioxidants partially prevent these changes. Mitochondrial functions in skeletal muscle remain unaltered by the dietary intervention due to many adaptive changes in gene transcription.

antioxidants; gene expression; mitochondrial adenosine triphosphate production


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A HIGH-FAT DIET HAS BEEN REPORTED to adversely affect the health of human and animal species (7, 23, 25, 26). It has been reported that high levels of unsaturated fat increase fat-mediated oxidative stress and decrease antioxidative enzyme activity (22). A high-fat diet has been reported to increase atherogenesis (23, 24) and impairs glucose metabolism in rat skeletal muscle, which is the major site of insulin-stimulated glucose disposal (10). Feeding a high-fat diet to rodents has been shown to cause whole body and skeletal muscle insulin resistance (9, 32), hyperinsulinemia, and hyperglycemia (12) and, if continued for a longer period, could lead to the development of diabetes (26). An increased incidence of cancer with high-fat diet has been reported in experimental animals (30). In contrast, there are various reports indicating the beneficial effects of antioxidant supplementation in preventing cancer (3) and cardiovascular disease (19). It implies that oxidative damage and its consequences may result in many chronic health problems that are attributed to a high-fat diet. It has been proposed that mitochondrial DNA is especially susceptible to reactive oxygen species (ROS) damage (29).

We hypothesized that a high-fat diet would alter the transcription of genes involved in many body functions, especially those involved in ROS scavenging and mitochondrial ATP production. The purpose of this study was to determine the impact of a high-fat diet on rat skeletal muscle gene expression and mitochondrial function. We also determined whether these changes could be prevented or attenuated by antioxidant (vitamins A and E and selenium) supplementation.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Animals and experimental protocol. Male Sprague-Dawley rats were purchased from Harlan (Indianapolis, IN) at ~10 wk of age and were maintained on a standard chow diet for 2 wk. The following experiments were started after the animals were in our facility for 2 wk and lasted for an additional 36 wk. Animals were randomly assigned to one of the following dietary groups (n = 6 animals/group). The control group (Control) diet consisted of AIN-93G (Dyets, Bethlehem, PA), with protein (15%), fat (25%), and carbohydrate (60%), methionine (3 g/kg), mineral mix (50 g/kg), and vitamin mix (1 g/kg). Adequate amounts of selenium (1.24 g/kg) and DL-alpha -tocopherol acetate (0.05 g/kg) were included. For the high-fat diet group (HFD), the high-fat diet consisted of the same antioxidant content as the control diet but was supplemented with additional calories in the form of whole-milk powder and sweetener. The final composition of this diet was protein (20%), fat (60%), and carbohydrate (20%), with the same amount of vitamins and minerals. For the group having a high-fat diet supplemented with antioxidants (HFD+AO), the diet received by the HFD group was supplemented with additional antioxidants (8,000 IU vitamin A, 300 IU vitamin E, and 0.5 mg/kg selenium).

Throughout the experiment, animals were individually housed in wire-bottom cages in a controlled environment (12:12 h light-dark cycle, 20-22°C, 50-60% relative humidity). At the end of the study period, rats were injected with an intraperitoneal overdose of pentobarbital sodium. The gastrocnemius muscle was then quickly removed. One portion (60-70 mg) was kept in saline-soaked gauze on ice for mitochondrial studies, whereas the remainder of the muscle was immediately frozen in isopentane, cooled to the temperature of liquid nitrogen, and stored at -80°C until analysis.

Analysis of gene transcripts. To determine the muscle gene transcript profile in HFD and HFD+AO groups, the relative abundance of mRNAs in these two groups was compared with that of the control group by use of high-density oligonucleotide microarrays containing probes for ~800 genes (U34 array; Affymetrix, Santa Clara, CA).

GeneChip expression probe array. GeneChip expression probe arrays contain collections of pairs of probes for each of the mRNAs being analyzed (16). Each probe pair consists of a 25-mer that is perfectly complementary (referred to as a perfect match, or PM) to a subsequence of a particular message and a companion 25-mer that is identical except for a single base difference in the central position. The mismatch (MM) probe of each pair serves as an internal control for hybridization specificity. The analysis of PM-MM pairs allows low-intensity hybridization patterns from mRNAs to be sensitively and accurately recognized in the presence of cross-hybridization signals.

RNA isolation. Total RNA was isolated from frozen muscle tissue (gastrocnemius) by using TRIzol reagent (Life Technologies, Gaithersburg, MD), which was further purified using an affinity resin column (RNeasy; Qiagen, Chatsworth, CA). Total RNA thus isolated was converted to cDNA by use of the Superscript cDNA synthesis kit (GIBCO-BRL, Gaithersburg, MD). Double-stranded cDNA was then purified by phase lock gel (Eppendorf, Westbury, NY) with phenol-chloroform extraction (17).

Sample preparation, fragmentation, array hybridization, and scanning. The purified cDNA was used as a template for the in vitro transcription reaction for the synthesis of biotinylated cRNA with the use of RNA transcript labeling reagent (Affymetrix). This labeled cRNA was fragmented and hybridized onto the U34 array as described (17). Briefly, appropriate amounts of fragmented cRNA and control oligonucleotide B2 were added along with control cRNA (BioB, BioC, BioD), herring sperm DNA, and BSA to the hybridization buffer. The hybridization mixture was heated at 99°C for 5 min followed by incubation at 45°C for 5 min before the sample was injected into the microarray. Then, the hybridization was carried out at 45°C for 16 h with mixing on a rotisserie at 60 rpm. After hybridization, the solutions were removed, and the arrays were washed and stained with streptavidinphycoerythrin (Molecular Probes, Eugene, OR). After washes, probe arrays were scanned using the Hewlett-Packard GeneChip system confocal scanner (17). The quality of the fragmented biotin-labeled cRNA in each experiment was evaluated before being hybridized onto the U34 expression array by both gel electrophoresis and hybridizing (fraction of the sample) onto a test-2 array and analysis as a measure of quality control. For the gene transcript analysis by the high-density microarrays, we used the pooled muscle samples (120 mg) from six rats in each group (~20 mg from each rat).

Data analysis. GeneChip 3.0 (Affymetrix) was used to scan and quantitatively analyze the scanned image. Once the probe array had been scanned, GeneChip software automatically calculated intensity values for each probe cell and made a presence or absence call for each mRNA. Algorithms in the software used probe cell intensities to calculate an average intensity for each set of probe pairs representing a gene that directly correlated with the amount of mRNA. Spotfire (Spotfire, Cambridge, MA) and Microsoft Excel were also used for data analysis. Expression patterns for each group (HFD and HFD+AO) were compared with those of the control group. When the difference between two different RNA samples was assessed, the fold changes from side-by-side experiments on the same lot of microarrays were compared directly. In this analysis, we considered gene transcripts altered at least twofold and the average difference intensity >= 1,000 as significant to remove the false-positive as well as low-abundance genes. These genes were classified into different groups according to their metabolic function (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Comparison of gene transcript patterns between control and HFD groups

RNA isolation and cDNA synthesis for real-time PCR. Total RNA was extracted from skeletal muscle tissue (~10 mg) of each rat by the TRIzol method (Life Technologies). One microgram of total RNA from each rat and the pooled (1 µg of total RNA from each rat in the same group was pooled) were separately treated with DNase (Life Technologies) and then reverse transcribed using the TaqMan Reverse Transcription Reagents (PE Biosystems, Foster City, CA) according to the manufacturer's instructions for real-time PCR.

Real-time PCR. Primers and probes were selected for cytochrome c oxidase (COX) III, superoxide dimutase (SOD)-1, and SOD-2 by means of the Primer Express software (PE Biosystems). The details about the real-time PCR method have been described elsewhere (1).

The following primer and probe sequences were used. 28S (GenBank accession no. V01270) forward primer: TGGGAATGCAGCCCAAAG, reverse primer: CCTTACGGTACTTGTTGGCTATCG, probe: TGGTAAACTCCATCTAAGGCTAAATACCGGCA; SOD-1 (GenBank accession no. Y00404) forward primer: GCGGTCCAGCGGATGA, reverse primer: GTCCTTTCCAGCAGCCACAT, probe: GCCCAGGTCTCCAACATGCCT; SOD-2 (GenBank accession no. Y00497) forward primer: CACGACCCACTGCAAGGAA, reverse primer: GCGTGCTCCCACACATCA, probe: ACAGGCCTTATTCCACTGCTGGG; COX III (GenBank accession no. J01435) forward primer: GAAGCCGCAGCATGATACTG, reverse primer: TTTTTTTTTTTTTTTTTTTTTTTTTAGGATC, probe: CACTTCGTAGATGTAGTTTGACTATTCCTATACGT. The probes for SOD-1 and SOD-2 genes were designed to span exon boundaries to ensure no amplification of contaminating DNA. Because the mitochondrial genome does not contain introns, the reverse primer for COX III was designed to target several of the final nucleotides specific to COX III as well as a string of the poly(A)+ tail that is present only in the mRNA.

We applied this highly sensitive and reproducible real-time PCR method (1) to quantify COX III, SOD-1, and SOD-2 mRNA. The signal for 28S ribosomal RNA was used to normalize against differences in RNA isolation and RNA degradation and in the efficiencies of the reverse transcription and PCR reactions. All samples were run in triplicate and were quantitated by normalizing the COX III, SOD-1, and SOD-2 signals with the 28S signal. The final quantitation was achieved by a relative standard curve. We measured the transcript levels of these three genes individually before pooling from each of these six rats and after pooling the total RNA, and both experiments gave the same results.

Northern blot analysis of uncoupling proteins-2 and -3. cDNA probes for uncoupling protein (UCP)-2, UCP-3, and 28S rRNA transcripts were generated by RT-PCR amplification from control and HFD rat muscle total RNA. Primers for the UCP-2 probe corresponded to nucleotides 467-490 (forward) and 1196-1205 (reverse, PCR product of 746 bp) of the rat UCP-2 sequence (GenBank accession no. AB010743). Primers for the UCP-3 probe corresponded to nucleotides 235-254 (forward) and 980-1003 (reverse, PCR product of 768 bp) of the rat UCP-3 sequence (GenBank accession no. U92069). Primers for the 28S rRNA probe corresponded to nucleotides 4203-4222 (forward) and 4370-4389 (reverse, PCR product 186 bp) of the rat ribosomal RNA genome (GenBank accession no. V01270). Amplification products were cloned into the TA-plasmid vector (TA Cloning kit; Invitrogen), as previously described (2). Total RNA isolation, Northern blotting, and hybridization to UCP-2, UCP-3, and 28S probes (in that order) were performed as described (2). Resulting images were quantified by laser densitometry (Ultroscan; Pharmacia), and UCP bands were normalized to the corresponding 28S rRNA band.

Mitochondrial ATP production rate. Mitochondria were purified from skeletal muscle, and ATP production was determined using a bioluminescence technique as previously described (21, 31). Mitochondrial suspensions diluted in ATP-monitoring reagent (AMR; formula SL; BioThema, Dalarö, Finland) were added to cuvettes containing AMR, substrate, and ADP. The substrates added (in mM final concentration) were 1) 1 pyruvate plus 1 malate, 2) 1 palmitoyl-L-carnitine plus 1 malate, 3) 10 alpha -ketoglutarate, or 4) 1 pyruvate plus 0.05 palmitoyl-L-carnitine plus 1 malate plus 10 alpha -ketoglutarate, with additional blank tubes used for measuring background. ATP production for all reactions was monitored simultaneously at 25°C with an automated routine in a BioOrbit 1251 luminometer (BioOrbit Oy, Turku, Finland). Internal calibration of each reaction cuvette was performed by addition of an ATP standard. Citrate synthase activity was measured in mitochondria and tissue homogenates as previously described (21) and used to calculate the ATP production rate.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Body weight. We measured the body weight of 12-wk-old rats (395 ± 0.2 g) just before the start of the various feeding programs and randomized six rats each into three different groups (control, HFD, and HFD+AO). At the conclusion of the 36-wk study, the HFD (730 ± 21.6 g) and HFD+AO (769 ± 24.3 g) animals had similar body weights and were heavier than the control (626 ± 24.6 g) animals (P < 0.01).

Gene transcript levels. Comparisons were made between control animals and animals from the two intervention groups (HFD and HFD+AO). Alterations in gene transcripts involving several functions were identified (Table 1). Of 800 genes whose expression pattern we monitored using high-density oligonucleotide microarrays, 18 (up-arrow 8 and down-arrow 10) and 19 (up-arrow 10 and down-arrow 9) gene transcripts were altered at least twofold in HFD and HFD+AO rats, respectively, compared with the controls.

Of the 18 altered gene transcripts in the HFD group, 28% were mediators of DNA repair/damage/free-radical scavenger function, 17% each were involved in signal transduction/cell proliferation and stress response/chaperone function, and 10% were associated with cell growth/adhesion (HFD column, Table 1). The remaining 28% were involved in energy metabolism (NADH dehydrogenase), ion pump [Na+/K+-activated ATP phosphohydrolase (Na+-K+-ATPase) alpha 1-subunit], iron transport (transferrin receptor), sulfur metabolism (hydroxysteroid sulfotransferase), and unknown function (serum amyloid A).

Of the 18 gene transcripts found altered in HFD rats, 4 were completely normalized and 12 were partially normalized by antioxidant supplementation for 36 wk (Table 1). Stress-inducible chaperone mitochondrial GrpE, chaperonin 60, and DnaJ-like protein (RDJ1), all involved in stress response/chaperone function, and NADH dehydrogenase, involved in energy metabolism, are the four genes whose expression was normalized. Twelve transcripts partially normalized, including growth arrest and DNA damage-inducible gene (GADD)45, DNA polymerase-alpha , Cu-Zn SOD, glutathione peroxidase I, Mn-SOD, Ras-related protein, protein kinase, hydroxysteroid sulfotransferase, vascular endothelial cell growth factor, vascular cell adhesion molecule-1, transferrin receptor, and Na+-K+-ATPase alpha 1-subunit. In addition, antioxidant supplementation increased the transcript levels of four additional genes [glutathione-S-transferase, NADH-ubiquinone oxidoreductase, glucose-regulated protein, and heat shock protein (HSP)E7I], which were normal in the HFD group, whereas serum amyloid A protein showed a further increase with antioxidant supplementation.

We validated three of the gene transcript expression levels using the real-time PCR approach (Fig. 1). The real-time PCR analysis also showed that, in HFD animals, SOD-1 and SOD-2 mRNA levels were reduced compared with control animals, which was in agreement with the microarray data. In HFD+AO animals, SOD-1 and SOD-2 gene transcript levels by real-time PCR were higher than in HFD animals, as was also shown by microarray analysis.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1.   Real-time PCR data (mRNA levels) of cytochrome c oxidase (COX) III (A), superoxide dismutase (SOD)-1 (B), and SOD-2 (C) from control, high-fat diet (HFD), and HFD supplemented with antioxidants (HFD+AO). Values are means ± SE. The relative levels of SOD-1 and SOD-2 transcripts were lower in HFD animals than in the controls (P < 0.01). SOD-1 and SOD-2 transcripts were higher in HFD+AO than in HFD (P < 0.05).

UCP-2 and UCP-3 expression. UCP-2 transcript levels were higher in HFD rats (2.73 ± 0.35) than in controls (1.80 ± 0.2; P < 0.05), whereas no significant difference in UCP-3 transcripts was observed between HFD (4.72 ± 1.50) and the control (5.61 ± 0.99) rats. UCP-2 and UCP-3 transcripts were not measured in HFD+AO animals.

Mitochondrial ATP production and citrate synthase activity. As shown in Table 2, mitochondrial ATP production rates and citrate synthase activity were not different among the groups.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Mitochondrial ATP production rate and citrate synthase activity in gastrocnemius muscle of control, HFD, and HFD + AO rats


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The focus of the current study was to determine the effect of high-fat diet on gene transcript profiles and mitochondrial function in skeletal (gastrocnemius) muscle of rats. To determine whether changes in gene transcript profiles could be attenuated or prevented by supplementation with antioxidants, we measured gene transcript profiles in skeletal muscle from animals that were kept on a high-fat diet and antioxidant supplements. Skeletal muscle is a major organ involved in oxidation of circulating fatty acids and a potential site of ROS damage. The microarray approach provides an opportunity to examine this important issue in a global manner. We also confirmed the findings of the microarray approach by measuring transcript levels of three genes (COX III, SOD-1, and SOD-2) by performing real-time PCR. In addition, the study demonstrated that mitochondrial ATP production is maintained at the same level irrespective of the changes in diet.

The most striking aspect of the data set is that ~28% of the genes that had altered expression in the HFD group are mediators of DNA damage/repair/free-radical scavenger function. There was a markedly increased expression of the GADD45 gene in the HFD group, and its expression declined with antioxidant supplementation. Hollander et al. (11) and Jackman et al. (14) have shown that GADD45a null mice generated by gene targeting exhibited several phenotypes characteristic of mice deficient in p53, including genomic instability, increased radiation carcinogenesis, and a low frequency of exencephaly. It has been shown previously that, in aging rat muscle, the transcript level of GADD45 is increased (15). Of interest, the magnitude of increase in GADD45 transcript level was attenuated by the addition of antioxidants to the high-fat diet, suggesting that the alteration induced by the high-fat diet is partly due to oxidative damage by ROS. Gene transcript levels of ROS scavengers such as SOD-1, SOD-2, and glutathione peroxidase were significantly decreased in HFD rats along with the DNA repair enzyme DNA polymerase-alpha . Both SOD and glutathione-S-transferase have been shown to play a protective role against oxidative damage in various tissues by neutralizing ROS (28, 33). In the present study, 36 wk of antioxidant supplementation actually improved the expression levels of several genes involved in free-radical scavenging function along with SOD and glutathione S-transferase. Removal of the ROS by SOD and of hydrogen peroxide by catalase and glutathione peroxidase prevent formation of the very reactive hydroxyl radical, which is postulated to be responsible for much of the cellular damage. Antioxidant supplementation for 36 wk partially prevented the alterations in expression of these genes.

The high-fat diet also resulted in alterations in the expression of genes involved in cell proliferation/signal transduction such as mitogen-activated protein kinase (MAPK)-1 (up-arrow ), Ras-related protein (up-arrow ), and protein kinase (down-arrow ). Antioxidant supplementation did not alter the transcript levels of MAPK and protein kinase, whereas Ras-related protein mRNA level was improved. The Ras-MAPK pathway transduces the mitogenic signals initiated by growth factors and has been implicated in mammary cancer promotion in rats fed a high-fat diet (30). Another interesting observation was the upregulation of several genes involved in stress response in HFD rats, suggesting an increased oxidative stress associated with these animals. This includes heat shock protein 70 (HSP70), stress-inducible protein GrpE, RDJ1, and chaperonin 60. The antioxidant supplement with the high-fat diet normalized all of these gene expression abnormalities except for HSP70 (which remained upregulated).

Analysis of gene transcript levels in HFD animals also revealed no alterations in genes involved in energy metabolism except NADH dehydrogenase, which was downregulated 2.1-fold in this group compared with the controls. NADH dehydrogenase is part of complex I in the mitochondrial electron transport system and is involved in oxidative phosphorylation. In HFD+AO rats, only one gene involved in energy metabolism, NADH-ubiquinone oxidoreductase, showed alteration (upregulation) among the 800 genes we surveyed. The lack of change in multiple genes of the mitochondrial oxidative phosphorylation pathways may explain why the diets had no effect on ATP production.

Several genes involved in tissue development/growth or cell adhesion function were altered in both of these groups of animals. Cell adhesion represents a process that is vital in immune function and inflammation, and it has been reported that antioxidants regulate cell adhesion by modulating specific signal transduction pathways (20). These include vascular endothelial cell growth factor and vascular cell adhesion molecule-1. The expression of vascular endothelial cell growth factor and vascular cell adhesion molecule-1 were 11.8 and 9.3-fold lower, respectively, in HFD rats compared with the controls. In the HFD+AO group, expression of both of these genes was also reduced compared with controls (Table 1). However, the magnitude of the reduction was less than one-half that in the HFD group, suggesting that antioxidants may have had a significant protective effect on the pathways leading to transcription of these genes.

Na+-K+-ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na+ and K+ ions across the plasma membrane. Because these gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle, the enzyme plays an essential role in cellular physiology. It is composed of two subunits, a large catalytic subunit (alpha ) and a smaller glycoprotein subunit (beta ) of unknown function. In the HFD group (down-arrow 3.6), as well as in the HFD+AO group (down-arrow 2.0), rats showed a decline in Na+-K+-ATPase alpha 1-subunit transcript level, with a slight improvement in the HFD+AO group.

To validate the observations in the microarray experiment, we measured the gene transcript levels of COX III, SOD-1, and SOD-2 using real-time PCR (Fig. 1). The gene transcript level of COX III, a mitochondrial-encoded subunit of cytochrome c oxidase, was decreased 23 and 15%, respectively, in HFD and HFD+AO rats compared with the controls. Similarly, the gene transcript levels of SOD-1 (down-arrow 63% HFD, down-arrow 24% HFD+AO) and SOD-2 (down-arrow 67% HFD, down-arrow 23% HFD+AO) also showed a decline in mRNA levels in the HFD groups. The decrease in transcript levels of SOD-1 and SOD-2 in HFD animals compared with the control animals (P < 0.01) and the increase in these transcript levels in HFD+AO animals compared with HFD animals (P < 0.05) were significant.

Of interest, it was also noted that mRNA levels of UCP-2 were higher in HFD rats, whereas UCP-3 mRNA levels were similar in HFD animals compared with the control animals. Four weeks of high-fat diet feeding have been shown to increase UCP-3 mRNA (18) and protein expression (5) in skeletal muscle. In contrast, Corbalan et al. (6) have shown that the gastrocnemius UCP-3 mRNA levels were significantly reduced in rats fed a cafeteria diet compared with lean animals. The combination of the low-fat diet received by the control group and the shorter duration of the study could very well explain the difference in result between our present study and these studies (6, 18). There is increasing experimental evidence to indicate that these UCPs are involved in proton leak and regulation (or modulation) of thermogenesis (2, 4, 8, 13, 27). High fat intake appears to promote uncoupling of oxidative phosphorylation, thus allowing possible proton leak. In HFD rats, muscle mitochondrial ATP production and enzyme activity (citrate synthase) were not different from those in control rats. The upregulation of UCP-2 mRNA in HFD rats suggests that proton leak in skeletal muscle of these animals may be increased. This could potentially limit the ability of mitochondria to generate ATP. Because no change in ATP production capacity was observed in this study, however, other potential scenarios must be considered. One possibility is that the UCP-2 mRNAs were not translated in proportion to the rate of gene transcription; another is that the protein produced was not fully functional due to some modifications. There also exists the possibility that uncoupling was offset by other, undetected changes in the mitochondrial oxidation pathway that resulted in maintenance of ATP production. These hypotheses will have to be confirmed by more direct studies.

In summary, the changes in several gene transcripts induced by high-fat diet and antioxidant intervention are demonstrated in the present experiment (Table 3). The transcriptional downregulation of genes involved in the free-radical scavenger process by high-fat diet suggests that increased oxidative stress/damage occurred in rats maintained on a high-fat diet. The antioxidant supplementation modestly improved these gene transcript levels. The transcriptional activation of stress response genes that process damaged or misfolded proteins during the feeding period suggests a central role for protein modifications associated with feeding diets with different caloric values. Mitochondrial ATP production capacity was maintained in HFD rats despite increased expression of UCP-2.

                              
View this table:
[in this window]
[in a new window]
 
Table 3.   Global view of gene transcript changes in HFD and HFD + AO rats


    ACKNOWLEDGEMENTS

We are grateful to Jane Kahl, Dawn Morse, Deborah Rasmussen, and Becca Kurup for technical support.


    FOOTNOTES

This work was supported by National Institutes of Health Grant R01 AG-09531, a David Murdock Professorship (K. S. Nair), and the Mayo Foundation. K. R. Short was supported by a Postdoctoral Training Award (T32-DK-07352) from the National Research Service.

Address for reprint requests and other correspondence: K. S. Nair, Mayo Clinic & Foundation, 200 1st St. SW, Rm 5-194 Joseph, Rochester, MN 55905 (E-mail: nair.sree{at}mayo.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpendo.00554.2001

Received 19 December 2001; accepted in final form 7 January 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Balagopal, P, Schimke JC, Ades PA, Adey DB, and Nair KS. Age effect on transcript levels and synthesis rate of muscle MHC and response to resistance exercise. Am J Physiol Endocrinol Metab 280: E203-E208, 2001[Abstract/Free Full Text].

2.   Barazzoni, R, and Nair KS. Changes in uncoupling protein-2 and -3 expression in aging rat skeletal muscle, liver, and heart. Am J Physiol Endocrinol Metab 280: E413-E419, 2001[Abstract/Free Full Text].

3.   Block, G, Patterson B, and Subar A. Fruit, vegetables, and cancer prevention: a review of the epidemiological evidence. Nutr Cancer 18: 1-29, 1992[ISI][Medline].

4.   Clapham, JC, Arch JRS, Chapman H, Haynes A, Lister C, Moore GBT, Piercy V, Carter SA, Lehner I, Smith SA, Beeley LJ, Godden RJ, Herrity N, Skehel M, Changani KK, Hockings PD, Reid DG, Squires SM, Hatcher J, Trail B, Latcham J, Rastan S, Harper AJ, Cadenas S, Buckingham JA, Brand MD, and Abuin A. Mice overexpressing human uncoupling protein-3 in skeletal muscle are hyperphagic and lean. Nature 406: 415-418, 2000[Medline].

5.   Chou, CJ, Cha MC, Jung DW, Boozer CN, Hashim SA, and Sunyer XP. High-fat diet feeding elevates skeletal muscle uncoupling protein 3 levels but not its activity in rats. Obes Res 9: 313-319, 2001[ISI][Medline].

6.   Corbalan, MS, Margareto J, Martinez JA, and Marti A. High fat feeding reduced muscle uncoupling protein 3 expression in rats. J Physiol Biochem 55: 67-72, 1999[ISI][Medline].

7.   Ghosh, P, Bitsanis D, Ghebremeskel K, Crawford MA, and Poston L. Abnormal aortic fatty acid composition and small artery function in offspring of rats fed a high-fat diet in pregnancy. J Physiol (Lond) 533: 815-822, 2001[Abstract/Free Full Text].

8.   Gong, DW, Monemdjous S, Gavrilova O, Leon LR, Marcus SB, Chou CJ, Everett C, Kozak LP, Li C, Deng C, Harper ME, and Reitman ML. Lack of obesity and normal response to fasting and thyroid hormone in mice lacking uncoupling protein-3. J Biol Chem 275: 16251-16257, 2000[Abstract/Free Full Text].

9.   Han, DH, Hansen PA, Host HH, and Holloszy JO. Insulin resistance of muscle glucose transport in rats fed a high-fat diet: a reevaluation. Diabetes 46: 1761-1767, 1997[Abstract].

10.   Hansen, PA, Han DH, Marshall BA, Nolte LA, Chen MM, Mueckler M, and Holloszy JO. A high-fat diet impairs stimulation of glucose transport in muscle. J Biol Chem 273: 26157-26163, 1998[Abstract/Free Full Text].

11.   Hollander, TM, Sheikh MS, Bulavin DV, Lundgren K, Augeri HL, Shehee R, Molinaro TA, Kim KE, Tolosa E, Ashwell JD, Rosenberg MP, Zhan Q, Salguero PMF, Morgan WF, Deng CX, and Fornace AJ. Genomic instability in Gadd45a-deficient mice. Nat Genet 23: 176-184, 1999[ISI][Medline].

12.   Ikemoto, S, Thompson KS, Takahashi M, Itakura H, Lane MD, and Ezaki O. High-fat diet induced hyperglycemia: prevention by low level expression of a glucose transporter (GLUT4) minigene in transgenic mice. Proc Natl Acad Sci USA 92: 3096-3099, 1995[Abstract/Free Full Text].

13.   Jaburek, M, Varecha M, Gimeno RE, Dembski M, Jezek P, Zhang M, Burn P, Tartaglia LA, and Garlid KD. Transport function and regulation of mitochondrial uncoupling proteins 2 and 3. J Biol Chem 274: 26003-26007, 1999[Abstract/Free Full Text].

14.   Jackman, J, Alamo IJ, and Fornace AJJ Genotoxic stress confers preferential and coordinate messenger RNA stability on the five gadd genes. Cancer Res 54: 5656-5662, 1994[Abstract/Free Full Text].

15.   Lee, CK, Klopp RG, Weindruch R, and Prolla TA. Gene expression profile of aging and its retardation by caloric restriction. Science 285: 1390-1393, 1999[Abstract/Free Full Text].

16.   Lockhart, DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, and Brown EL. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat Biotechnol 14: 1675-1680, 1996[ISI][Medline].

17.   Mahadevappa, M, and Warrington JA. A high-density probe array sample preparation method using 10- to 100-fold fewer cells. Nat Biotechnol 17: 1134-1136, 1999[ISI][Medline].

18.   Matsuda, J, Hosoda K, Itoh H, Son C, Doi K, Tanaka T, Fukunaga Y, Inoue G, Nishimura H, Yoshimasa Y, Yamori Y, and Nakao K. Cloning of rat uncoupling protein-3 and uncoupling protein-2 cDNAs: their gene expression in rats fed high-fat diet. FEBS Lett 418: 200-204, 1997[ISI][Medline].

19.   Rozewicka, L, Wiszniewska BB, Wojcicki J, Samochowiec L, and Krasowska B. Protective effect of selenium and vitamin E against changes induced in heart vessels of rabbits fed chronically on a high-fat diet. Kitasato Arch Exp Med 64: 183-192, 1991[Medline].

20.   Sen, CK, and Roy S. Antioxidant regulation of cell adhesion. Med Sci Sports Exerc 33: 377-381, 2001[ISI][Medline].

21.   Short, KR, Nygren J, Barazzoni R, Levine J, and Nair KS. T3 increases mitochondrial ATP production in oxidative muscle despite increased expression of UCP2 and -3. Am J Physiol Endocrinol Metab 280: E761-E769, 2001[Abstract/Free Full Text].

22.   Slim, RM, Toborek M, Watkins BA, Boissonneault GA, and Hennig B. Susceptibility to hepatic oxidative stress in rabbits fed different animal and plant fats. J Am Coll Nutr 15: 289-294, 1996[Abstract].

23.   Steinberg, D. Antioxidants and atherosclerosis. A current assessment. Circulation 84: 1420-1425, 1991[Free Full Text].

24.   Steinberg, D. Antioxidants in the prevention of human atherosclerosis. Summary of the Proceedings of a National Heart, Lung, and Blood Institute Workshop: September 5-6, 1991, Bethesda, MD. Circulation 85: 2337-2344, 1992[Free Full Text].

25.   Storlien, LH, Baur LA, Kriketos AD, Pan DA, Cooney GJ, Jenkins AB, Calvert GD, and Campbell LV. Dietary fats and insulin action. Diabetologia 39: 621-631, 1996[ISI][Medline].

26.   Surwit, RS, Kuhn CM, Cochrane C, McCubbin JA, and Feinglos MN. Diet induced type II diabetes in C57BL/6J mice. Diabetes 37: 1163-1167, 1988[Abstract].

27.   Vidal-Ping, AJ, Grujic D, Zhang CY, Hagen T, Boss O, Ido Y, Szczepanik A, Wade J, Mootha V, Cortright R, Muoio DM, and Lowell BB. Energy metabolism in uncoupling protein 3 gene knockout mice. J Biol Chem 275: 16258-16266, 2000[Abstract/Free Full Text].

28.   Vontas, JG, Small GJ, and Hemingway J. Glutathione S-transferases as antioxidant defense agents. Biochem J 357: 65-72, 2001[ISI][Medline].

29.   Wallace, DC. Mitochondrial genetics: a paradigm for aging and degenerative diseases? Science 256: 628-632, 1992[Abstract/Free Full Text].

30.   Wang, Z, Pei H, Kaeck M, and Lu J. Mammary cancer promotion and MAPK activation associated with consumption of a corn oil-based high-fat diet. Nutr Cancer 34: 140-146, 1999[ISI][Medline].

31.   Wibom, R, Lundin A, and Hultman E. A sensitive method for measuring ATP-formation in rat muscle mitochondria. Scand J Clin Lab Invest 50: 143-152, 1990[ISI][Medline].

32.   Wilkes, JJ, Bonen A, and Bell RC. A modified high-fat diet induces insulin resistance in rat skeletal muscle but not adipocytes. Am J Physiol Endocrinol Metab 38: E679-E686, 1998.

33.   Zaken, V, Kohen R, and Ornoy A. Vitamins C and E improve rat embryonic antioxidant defense mechanism in diabetic culture medium. Teratology 64: 33-44, 2001[ISI][Medline].


Am J Physiol Endocrinol Metab 282(5):E1055-E1061
0193-1849/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. R. Short, B. Drew, and C. Leeuwenburgh
Mitochondrial ATP measurements
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2004; 287(1): R243 - R246.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. S. Nair, A. Jaleel, Y. W. Asmann, K. R. Short, and S. Raghavakaimal
Proteomic research: potential opportunities for clinical and physiological investigators
Am J Physiol Endocrinol Metab, June 1, 2004; 286(6): E863 - E874.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
H. Kato and T. Kimura
Evaluation of the Effects of the Dietary Intake of Proteins and Amino Acids by DNA Microarray Technology
J. Nutr., June 1, 2003; 133(6): 2073S - 2077.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sreekumar, R.
Right arrow Articles by Nair, K. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sreekumar, R.
Right arrow Articles by Nair, K. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online