AJP - Endo Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 282: E733-E738, 2002;
0193-1849/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (48)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rogers, S.
Right arrow Articles by Best, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rogers, S.
Right arrow Articles by Best, J. D.
Vol. 282, Issue 3, E733-E738, March 2002

RAPID COMMUNICATION
Identification of a novel glucose transporter-like protein---GLUT-12

Suzanne Rogers1, Maria L. Macheda1, Susan E. Docherty1, Maynard D. Carty2, Michael A. Henderson3, Walter C. Soeller2, E. Michael Gibbs2, David E. James4, and James D. Best1

Departments of 1 Medicine and 3 Surgery, The University of Melbourne, St. Vincent's Hospital Melbourne, Fitzroy, Victoria 3065; 4 Institute for Molecular Bioscience, University of Queensland, St. Lucia, Queensland, Australia 4072; and 2 Department of Cardiovascular Metabolic Diseases, Pfizer Global Research and Development, Pfizer Incorporated, Groton, Connecticut 06340


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Facilitative glucose transporters exhibit variable hexose affinity and tissue-specific expression. These characteristics contribute to specialized metabolic properties of cells. Here we describe the characterization of a novel glucose transporter-like molecule, GLUT-12. GLUT-12 was identified in MCF-7 breast cancer cells by homology to the insulin-regulatable glucose transporter GLUT-4. The GLUT-12 cDNA encodes 617 amino acids, which possess features essential for sugar transport. Di-leucine motifs are present in NH2 and COOH termini at positions similar to the GLUT-4 FQQI and LL targeting motifs. GLUT-12 exhibits 29% amino acid identity with GLUT-4 and 40% to the recently described GLUT-10. Like GLUT-10, a large extracellular domain is predicted between transmembrane domains 9 and 10. Genomic organization of GLUT-12 is highly conserved with GLUT-10 but distinct from GLUTs 1-5. Immunofluorescence showed that, in the absence of insulin, GLUT-12 is localized to the perinuclear region in MCF-7 cells. Immunoblotting demonstrated GLUT-12 expression in skeletal muscle, adipose tissue, and small intestine. Thus GLUT-12 is potentially part of a second insulin-responsive glucose transport system.

facilitative glucose transporter; insulin-responsive tissues; breast cancer


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

FACILITATED TRANSPORT OF GLUCOSE into cells is catalyzed by a family of facilitative-diffusion glucose transporter (GLUT) proteins. Mammalian glucose transporters share considerable amino acid homology. They also contain signatures of transport facilitators that include sugar transporters of other eukaryotes and also prokaryotic species (3, 5). Features include the presence of 12 transmembrane (TM) amphipathic helices with the amino and carboxyl termini facing the cell cytoplasm, a large extracellular loop domain between TM domains 1 and 2, and a large intracellular loop domain between TM domains 6 and 7. There are several conserved amino acid motifs that have functional significance (4).

Until recently, five mammalian GLUT proteins had been identified, each derived from a separate gene and exhibiting unique functional characteristics (19). GLUT-1 is ubiquitously expressed and fulfills basal glucose transport needs in many cell types. GLUT-2 is mainly present in pancreatic beta -cells and hepatocytes, where it plays an important role in transporting glucose to the bloodstream. GLUT-3 is expressed in cells with a high glucose demand, such as neurones. GLUT-4 is expressed in skeletal and cardiac muscle and adipose cells, tissues in which glucose uptake is acutely stimulated by insulin. GLUT-5 is a high-affinity fructose transporter expressed mainly in the small intestine. GLUT-6 is a pseudogene (7), and the identity of GLUT-7 is unclear (8).

Although the list of GLUT family members was considered complete, there have been indications that other transporters exist. In GLUT-4 null mice, certain muscles exhibit a relatively intact glucose transport response to insulin despite the fact that expression of other known GLUTs is not increased (15). Recently the cDNA molecules encoding five new related transporters that have weaker homology to GLUTs 1-5 have been cloned. One isoform has been designated GLUT-X1, GLUT-8, or GLUT-10 by four separate groups (9, 11, 13, 21) and is referred to in this article as GLUT-X1/8. It is expressed abundantly in testis and blastocysts, with lower levels present in a range of adult tissues, including skeletal muscle. Two further isoforms have both been designated GLUT-9 (10, 20). One is predominantly expressed in brain and leukocytes and the other in kidney and liver. The fourth isoform, also designated GLUT-10, has recently been described in liver and pancreas (18). It is referred to as GLUT-10 in this article. GLUT-11 has been described in heart and skeletal muscle (25, and H.-G. Joost, personal communication).

Glucose is an essential energy-yielding substrate for cancer cells, and there are several instances in which known transporters may not account for increased energy demands (27). Our studies were directed at identifying new sugar transporters in breast cancer (23). The work presented here describes the identification in a malignant human breast epithelial cell line and subsequent cloning of a cDNA encoding a novel glucose transporter-like protein. We have designated this molecule as GLUT-12. In normal human adult tissues, GLUT-12 is predominantly expressed in skeletal muscle and fat, supporting the concept that a second insulin-regulatable glucose transporter could be present in these tissues.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. MCF-7 cells were purchased from the American Type Culture Collection and maintained in RPMI 1640 medium with L-glutamine (Life Technologies), 10% fetal bovine serum (FBS) (CSL Biosciences), and 50 nM insulin (Novo Nordisk).

RT-PCR. RNA was extracted with TRIzol (Life Technologies), and 5 µg were reverse transcribed with AMV Reverse Transcriptase and Oligo(dT)15 primers (Promega). PCR with GLUT-4-specific forward primer 1 (TTTGAGATTGGCCCTGGCCCCAT) and reverse primer 2 (GTCRTTCTCATCTGGCCCTAA) was 40 cycles at 94°C for 30 s, at 49°C for 30 s, and at 72°C for 30 s. PCR using GLUT-4-related forward primer 3 (TTTGAGATTGGNCCHGGCCCSAT) and reverse primer 2 utilized touchdown PCR, with the first 5 cycles annealed at 37°C, and the Expand High Fidelity PCR System (Roche Molecular Biochemicals). Products were sequenced with fmol DNA Cycle Sequencing System (Promega). cDNAs were labeled with [alpha -32P]dCTP and the Random Primed DNA labeling kit (Roche Molecular Biochemicals).

Cloning. A whole human embryo cDNA lambda gt10 library was a kind gift from B. Kemp. Plaques (5 × 105) were screened. Hybridization was overnight at 42°C and washes were for 15 min at 42°C in 2 × saline-sodium phosphate-EDTA buffer (SSPE) and 0.1% SDS, for 30 min at 65°C in 1 × SSPE and 0.1% SDS, and for 15 min at room temperature in 0.1 × SSPE and 0.1% SDS. cDNAs were cloned into pBluescript SK+ (Stratagene). 5'-Amplification of cDNA utilized the SMART RACE cDNA Amplification Kit (CLONTECH Laboratories). GLUT-12-specific primer (AACATGTACTTCCAGCCAT) was used, followed by a nested PCR reaction with GLUT-12-specific forward primer (CGAAGTTTTTCCCCACAC) and reverse primer (TATCTGTCTATCAGGACCCCTCCG). Products were cloned into pGEM-T Easy (Promega), transformed into E. coli strain SURE 2 (Stratagene), and sequenced by use of the T7 Sequencing Kit (Amersham Pharmacia Biotech) or by Micromon Sequencing Facility (Melbourne, Australia).

Genomic analysis. A 100-kb human genomic BAC clone was obtained from Genome Systems after probing with a GLUT-12 partial cDNA. Intronic regions were identified using PCR primer pairs based on cDNA sequence. Intron-exon boundaries were sequenced.

Northern blotting. MCF-7 poly(A) RNA was isolated using the Dynabeads mRNA purification kit (Dynal Biotech). RNA was separated by denaturing gel electrophoresis, and membranes were hybridized to the GLUT-12 cDNA. Multi-tissue poly(A) RNA filters Human I 7760-1 and Human II 7759-1 were obtained from Clontech Laboratories. Filters were hybridized to the full-length GLUT-12 cDNA using ExpressHyb hybridization solution (Clontech Laboratories) with final washes of 0.1% standard sodium citrate at 65°C. Filters were exposed overnight on a phosphoimager plate (Fugi Photo Film).

R-1396 rabbit polyclonal antibody. A 16-mer peptide, NKLCGRGQSRQLSPET, was synthesized on the basis of the COOH sequence of GLUT-12, and 2 mg were coupled to 6 mg of N-succinimiyl-3-[2-pyridydithio]propionate-activated keyhole limpet hemocyanin (Pierce Chemical). One injection of 0.5 mg peptide conjugate, emulsified in Freund's complete adjuvant, was followed by three boosts at 2-wk intervals with 0.5 mg peptide conjugate emulsified in Freund's incomplete adjuvant. SulfoLink Coupling Gel (Pierce Chemical) was linked with 2 mg of peptide per 1-ml column. Antibody was eluted with 0.2 M glycine, pH 2.0, and dialyzed against PBS.

Western analysis. Protein was extracted from MCF-7 cells using TRIzol reagent (Life Technologies). R-1396 antiserum (1:500) or affinity-purified antibody (50 µg/ml) was incubated overnight at 4°C. Horseradish peroxidase-linked swine anti-rabbit IgG (Dako) secondary antibody and Lumi-Light chemiluminescent detection (Roche Molecular Biochemicals) were used. Human tissues were prepared by lysing cells in homogenization buffer (250 mM sucrose, 5 mM NaN3, 2 mM EGTA, 10 mM NaHCO3, and 1 mM phenylmethylsulfonyl fluoride). Total membrane samples were prepared by centrifugation at 150,000 g, washed with 1 M KCl, and then solubilized in 10 mM Tris (pH 8.0), 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and 0.1% Triton X-100.

Immunohistochemistry. Slides were incubated overnight in R-1396 or nonimmune rabbit serum in 5% FBS-PBS, 4°C. Washes with 0.1% Tween 20 in PBS were followed by incubation with biotinylated swine anti-rabbit IgG (Dako). Detection utilized the avidin-biotin complex VECTASTAIN (Vecta Laboratories), the chromagen 3,3'-diaminobenzidine (Sigma), and hematoxylin counterstaining.

Immunofluorescence. MCF-7 cells were incubated in RPMI and 2% FBS for 16 h and then in RPMI with 0.2% BSA for 1 h before fixation in 4% paraformaldehyde in RPMI medium. Cells were quenched in 100 mM glycine, permeabilized with 0.1% Triton X-100, and blocked in 2% horse serum. Overnight incubation at 4°C with R-1396 was followed by washing with PBS and incubation for 1 h with Texas Red-X goat anti-rabbit IgG, 5 µg/ml (Molecular Probes).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Identification and cloning of GLUT-12. Northern blots of RNA extracted from the cultured malignant breast epithelial cell line MCF-7 showed that GLUT-1 was abundantly expressed. In addition, the rat GLUT-4 cDNA hybridized under stringent conditions to a transcript of ~2.5 kb (data not shown). RT-PCR using GLUT-4 specific primers did not amplify a product from MCF-7 RNA. In an effort to identify the transcript that labeled with the GLUT-4 probe, we performed degenerate PCR with GLUT-4-related primers. The resulting amplification product of ~350 bp hybridized to the GLUT-4 cDNA by Southern blotting. Sequencing showed 44% identity to human GLUT-4 at the amino acid level in the region spanning TM10 and TM11. An expressed sequence tag clone encompassing this sequence was recorded on the public databases and obtained from Genome Systems [I.M.A.G.E. Consortium (LLNL) Clone ID 43006] (17). The 1.2-kb EST from a human neonatal brain cDNA library was used to screen a human embryo cDNA library. Although homologous to the GLUT family, the positive clones did not contain a complete open reading frame (ORF).

RNA from MCF-7 cells, placenta, and human skeletal muscle was used in the first-strand cDNA 5' rapid amplification of cDNA ends (RACE) reactions. Sequence of four 5' RACE products overlapped that of partial cDNA clones from the whole human embryonic library. A putative translation start site, which conformed exactly to the Kozak consensus, was identified. A full-length cDNA clone was produced by RT-PCR of RNA from MCF-7 cells and primers based on putative 5'- and 3'-untranslated region sequence. The predicted amino acid sequence is shown in Fig. 1. The ORF encodes a 617-amino acid polypeptide with a predicted molecular mass of 66,962 Da.


View larger version (100K):
[in this window]
[in a new window]
 
Fig. 1.   Structure of GLUT-12. Alignment of the GLUT-12 predicted amino acid sequence to GLUTs 4 and 10. Alignment was performed by use of the ClustalW algorithm and shading with Boxshade. Black shading indicates identical residues and gray shading conserved residues. Transmembrane (TM) domains were predicted with the Simple Modular Architecture Research Tool program. Annotated are TM domains, NH2- and COOH-terminal di-leucines, and motifs described in text (*). The nucleotide sequence reported in this paper has been submitted to the GenBank data bank with accession number AY046419.

Characterization of GLUT-12. The structure of the GLUT-12 gene has been determined. There are five exons (Table 1). Significantly, the exon-intron organization of GLUT-12 is strikingly similar to that of GLUT-10 but distinct from GLUTs 1-5. There is high nucleic acid conservation at splice junctions, and interruption of amino acid sequence occurs at almost identical positions.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Sequences of the exon-intron splice junctions of the human GLUT-12 gene

Northern analysis of RNA extracted from MCF-7 cells detected two major GLUT-12 transcripts (Fig. 2A). Northern blotting indicated that GLUT-12 mRNA is most abundant in human heart, skeletal muscle, and prostate, with lower levels in brain, placenta, and kidney (Fig. 2B). GLUT-12-specific R-1396 antiserum and the affinity-purified antibody immunoblotted a protein of average molecular mass 50 kDa by SDS-PAGE (Fig. 2C). A faster migrating species labeled in MCF-7 cells may represent a degradation product. GLUT-12 antiserum immunolabeled a major protein product in human skeletal muscle, adipose tissue, and small intestine. No significant labeling was observed in brain, liver, or kidney (Fig. 2C). GLUT-12 protein was also detected by Western blotting in rat skeletal muscle and fat (data not shown). Skeletal muscle bundles stained intensely with GLUT-12 antiserum by immunohistochemical methods (Fig. 2D).


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of GLUT-12. A: Northern analysis of GLUT-12 transcripts. RNA was extracted from MCF-7 cells. Total (20 µg) and poly(A) (5 µg) RNA was transferred to membrane and hybridized with the GLUT-12 cDNA. B: expression of GLUT-12 mRNA in human tissues. PBL, peripheral blood leukocytes. C: tissue distribution of GLUT-12 protein. Total protein extract (40 µg) from MCF-7 cells was analyzed by SDS-PAGE on a 12% gel. R-1396 antibody was preincubated with 100 µg/ml of noncompetitive peptide (noncomp) or competitive peptide (comp). Crude membranes (25 µg) prepared from adult human tissues were immunoblotted with affinity-purified R-1396 antibody. D: presence of GLUT-12 protein in human skeletal muscle bundles was visualized by immunohistochemical detection using the R-1396 polyclonal antibody (1:300). Control sections were incubated with nonimmune serum (1:150). Original magnification ×200. E: immunofluorescence detection of GLUT-12 in MCF-7 cells. GLUT-12 protein was detected using R-1396 polyclonal antibody (1:300 in 0.2% horse serum). Control cells were incubated with nonimmune serum. A Bio-Rad MCR1024 inverted laser scanning confocal microscope was used, with Lasersharp software. Original magnification ×630.

In the absence of insulin, GLUT-12 was localized to a perinuclear location (Fig. 2E). We have been unable to demonstrate an acute change in the subcellular distribution of GLUT-12 after insulin treatment of MCF-7 cells. However, our preliminary investigations indicate that MCF-7 cells grown continuously in the presence of insulin (50 nM) exhibit a significant redistribution of GLUT-12 to the plasma membrane (data not shown).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Our initial experiments investigated glucose transporter expression in breast cancer. Although the expression of GLUT-4 is normally restricted to acutely insulin-sensitive tissues, variable expression of GLUT-4 in breast cancer has been reported (6). Using RT-PCR, we were unable to confirm the expression of GLUT-4 in MCF-7 cells. Degenerate PCR with primers that included TM10, which is highly conserved among GLUTs, and the variable COOH terminus indicated a potential new member of the GLUT family.

GLUT-12 is homologous to the facilitative glucose transporters, most particularly with 40% amino acid identity to GLUT-10. Homology to all other members of the glucose transporter family is lower, ranging from 29% amino acid identity (GLUT-3, GLUT-4, and GLUT-X1/8) to 21% (GLUT-9). Hydrophobicity plots predict 12 membrane-spanning domains. GLUTs 1-5 and the second designated GLUT-9 possess an N-linked glycosylation site in an extracellular loop between TMs 1 and 2, and glycosylation is thought to be a requirement for glucose transport (2). In contrast, in GLUT-X1/8, the first designated GLUT-9, and GLUT-10, the predicted extracellular domain between TMs 1 and 2 is short, and these isoforms possess a glycosylation site in an exofacial loop between TMs 9 and 10. Membrane-spanning predictions of GLUT-12 indicate the absence of an extracellular domain between TMs 1 and 2 and the presence of an exofacial loop between TMs 9 and 10. Like GLUT-10, the domain is significantly larger than in the other transporters. GLUT-12 possesses several potential sites for N-linked glycosylation in this loop.

The degree of homology, similar predicted protein structures, and highly conserved genomic structures suggest that GLUT-10 and -12 may represent a separate subfamily of transporters. The cytoplasmic NH2 and COOH termini of GLUT-12 are longer than those present in other glucose transporters. The longer cytoplasmic tails, along with the predicted large extracellular loop, denote GLUT-12 as the largest member of the family yet described.

GLUT-12 contains key signatures found in the larger facilitated sugar transporter family. In helix 7, conserved glutamine and tyrosine residues are present. This region is likely to constitute part of the exofacial, substrate-binding site. The QLS motif found in helix 7, which is conserved in GLUTs 1, 3, and 4 (GLUT-1 residues 279-281), is absent from GLUT-12. The absence of this motif is important in the kinetics of fructose transport by GLUTs 2 and 5 (1). Sugar release may be controlled by conformational changes in helices 10 and 11, and mutagenesis of GLUT-1 has shown that Trp388 and Trp412 are critical (12). These residues are also conserved in GLUT-12. Motifs important in membrane topology are also conserved. GRR(K) is present between helices 2 and 3 (3, 24). Between helices 8 and 9, this motif is GSK in GLUT-12. The motif EXXXXXXR between helices 4 and 5 and 10 and 11 (3) is also conserved.

The expression of GLUT-12 in muscle and adipose tissue is of considerable interest, because these tissues play an important role in whole body glucose homeostasis. In particular, glucose metabolism in these tissues is acutely regulated by stimuli such as insulin or exercise (14, 22). GLUT-4 is also expressed at high levels in these tissues and undergoes regulated movement from an intracellular depot to the plasma membrane in response to insulin. In MCF-7 cells, GLUT-12 is localized to a perinuclear region, and we have preliminary evidence that this localization is altered when the cells are grown continuously in the presence of insulin. Studies of GLUT-12 regulation in insulin-sensitive cells will aid in determining whether the GLUT-12 trafficking mechanism is unique. Notably, GLUT-12 possesses di-leucine motifs in the NH2 and COOH termini at regions similar to the FQQI and LL targeting motifs in GLUT-4 (22, 26). The major site of GLUT-4 phosphorylation (Ser488) is adjacent to the di-leucine targeting motif, and sequestration of GLUT-4 is regulated by phosphorylation at this position (16). GLUT-12 contains a potential phosphorylation site at Ser11, adjacent to the NH2-terminal di-leucine.

The finding of a glucose transporter that has shared characteristics with GLUT-4, including a pattern of expression restricted mainly to insulin-sensitive tissues, may have important implications. GLUT-12 could comprise a second insulin-sensitive glucose transport system, as well as regulating glucose utilization in malignancy. Determining the hexose specificity of GLUT-12 will be an important step in elucidating these issues.


    ACKNOWLEDGEMENTS

We thank Matthew Gillespie, Bruce Kemp, Sally Martin, T. John Martin, Timo Meerloo, Tess Rogers, Julie Sharp, Peter Tonoli, and Hong Zhou for their advice and assistance.


    FOOTNOTES

This work was supported by the National Health and Medical Research Council (NHMRC) of Australia, the Diabetes Australia Research Trust, the Eli Lilly Australia Research Grant Programme, and St. Vincent's Hospital Melbourne Research and Grants Committee. D. E. James is the recipient of a Principal NHMRC Research Fellowship.

Address for reprint requests and other correspondence: S. Rogers, The Univ. of Melbourne Dept. of Medicine, St. Vincent's Hospital Melbourne, Victoria Parade, Fitzroy, Victoria 3065, Australia (E-mail: s.rogers{at}medicine.unimelb.edu.au).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 21 August 2001; accepted in final form 29 October 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Arbuckle, MI, Kane S, Porter LM, Seatter MJ, and Gould GW. Structure-function analysis of liver-type (GLUT2) and brain-type (GLUT3) glucose transporters: expression of chimeric transporters in Xenopus oocytes suggests an important role for putative transmembrane helix 7 in determining substrate selectivity. Biochemistry 35: 16519-16527, 1996[Medline].

2.   Asano, T, Katagiri H, Takata K, Lin JL, Ishihara H, Inukai K, Tsukuda K, Kikuchi M, Hirano H, Yazaki Y, and Oka Y. The role of N-glycosylation of GLUT1 for glucose transport activity. J Biol Chem 266: 24632-24636, 1991[Abstract/Free Full Text].

3.   Baldwin, SA, and Henderson PJF Homologies between sugar transporters from eukaryotes and prokaryotes. Annu Rev Physiol 51: 459-471, 1989[Web of Science][Medline].

4.   Bell, GI, Burant CF, Takeda J, and Gould GW. Structure and function of mammalian facilitative sugar transporters. J Biol Chem 268: 19161-19164, 1993[Free Full Text].

5.   Bell, GI, Kayano T, Buse JB, Burant CF, Takeda J, Lin D, Fukumoto H, and Seino S. Molecular biology of mammalian glucose transporters. Diabetes Care 13: 198-208, 1990[Abstract].

6.   Binder, C, Binder L, Marx D, Schauer A, and Hiddemann W. Deregulated simultaneous expression of multiple glucose transporter isoforms in malignant cells and tissues. Anticancer Res 17: 4299-4304, 1997[Web of Science][Medline].

7.   Burant, CF, Sivitz WI, Fukumoto TK, Nagamatsu SS, Pessin JE, and Bell GI. Mammalian glucose transporters: structure and molecular regulation. Recent Prog Horm Res 47: 349-387, 1991.

8.   Burchell, A. A re-evaluation of GLUT7. Biochem J 331: 973, 1998.

9.   Carayannopoulos, MO, Chi MMY, Cui Y, Pingsterhaus JM, McKnight RA, Mueckler M, Devaskar SU, and Moley KH. GLUT8 is a glucose transporter responsible for insulin-stimulated glucose uptake in the blastocyst. Proc Natl Acad Sci USA 97: 7313-7318, 2000[Abstract/Free Full Text].

10.   Doege, H, Bocianski A, Joost HG, and Schürmann A. Activity and genomic organization of human glucose transporter 9 (GLUT9), a novel member of the family of sugar-transport facilitators predominantly expressed in brain and leucocytes. Biochem J 350: 771-776, 2000.

11.   Doege, H, Schürmann A, Bahrenberg G, Brauers A, and Joost HG. GLUT8, a novel member of the sugar transport facilitator family with glucose transport activity. J Biol Chem 275: 16275-16280, 2000[Abstract/Free Full Text].

12.   Garcia, JC, Strube M, Leingang K, Keller K, and Mueckler MM. Amino acid substitutions at tryptophan 412 of the HepG2 (Glut1) glucose transporter inhibit transport activity and targeting to the plasma membrane in Xenopus oocytes. J Biol Chem 267: 7770-7776, 1992[Abstract/Free Full Text].

13.   Ibberson, M, Uldry M, and Thorens B. GLUTX1, a novel mammalian glucose transporter expressed in the central nervous system and insulin-sensitive tissues. J Biol Chem 275: 4607-4612, 2000[Abstract/Free Full Text].

14.   James, DE, and Piper RC. Insulin resistance, diabetes and the insulin-regulated trafficking of GLUT-4. J Cell Biol 126: 1123-1126, 1994[Free Full Text].

15.   Katz, EB, Stenbit AE, Hatton K, DePinho R, and Charron MJ. Cardiac and adipose tissue abnormalities but not diabetes in mice deficient in GLUT4. Nature 377: 151-155, 1995[Medline].

16.   Lawrence, JC, Jr, Hiken JF, and James DE. Phosphorylation of the glucose transporter in rat adipocytes: identification of the intracellular domain at the carboxyl terminus as a target for phosphorylation in intact cells and in vitro. J Biol Chem 265: 2324-2332, 1990[Abstract/Free Full Text].

17.   Lennon, GG, Auffray C, Polymeropoulos M, and Soares MB. The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression. Genomics 33: 151-152, 1996[Web of Science][Medline].

18.   McVie-Wylie, AJ, Lamson DR, and Chen YT. Molecular cloning of a novel member of the GLUT family of transporters, SLC2A10 (GLUT10), localized on chromosome 20q13.1: a candidate gene for NIDDM susceptibility. Genomics 72: 113-117, 2001[Web of Science][Medline].

19.   Mueckler, M. The molecular biology of glucose transport: relevance to insulin resistance and non-insulin-dependent diabetes mellitus. J Diabetic Complications 7: 130-141, 1993.

20.   Phay, JE, Hussain HB, and Moley JF. Cloning and expression analysis of a novel member of the facilitative glucose transporter family, SLC2A9 (GLUT9). Genomics 66: 217-220, 2000[Web of Science][Medline].

21.   Phay, JE, Hussain HB, and Moley JF. Strategy for identification of novel glucose transporter family members by using Internet-based genomic databases. Surgery 128: 946-951, 2000[Web of Science][Medline].

22.   Piper, RC, Tai C, Kulesza P, Pang S, Warnock D, Baenziger J, Slot JW, Geuze HJ, Puri C, and James DE. GLUT-4 NH2 terminus contains a phenylalanine-based targeting motif that regulates intracellular sequestration. J Cell Biol 121: 1221-1232, 1993[Abstract/Free Full Text].

23.   Rogers, S, James DE, and Best JD. Identification of a novel facilitative glucose transporter like protein---GLUT8 (Abstract). Diabetes 47, Suppl1: 45A, 1998.

24.   Sato, M, and Mueckler M. A conserved amino acid motif (R-X-G-R-R) in the Glut1 glucose transporter is an important determinant of membrane topology. J Biol Chem 274: 24721-24725, 1999[Abstract/Free Full Text].

25.   Schürmann, A, Doege H, Scheepers A, Bocianski A, Eckel J, and Joost HG. Characterization of glucose transporter 10 (GLUT10), a novel heart and muscle specific sugar transport facilitator (Abstract). Diabetes 50, Suppl2: 277A-278A, 2001.

26.   Verhey, KJ, and Birnbaum MJ. A leu-leu sequence is essential for COOH-terminal targeting signal of GLUT4 glucose transporter in fibroblasts. J Biol Chem 269: 2353-2356, 1994[Abstract/Free Full Text].

27.   Younes, M, Brown RW, Mody DR, Fernandez L, and Laucirica R. GLUT1 expression in human breast carcinoma: correlation with known prognostic markers. Anticancer Res 15: 2895-2898, 1995[Web of Science][Medline].


Am J Physiol Endocrinol Metab 282(3):E733-E738
0193-1849/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
JNMHome page
H. Jadvar, A. Alavi, and S. S. Gambhir
18F-FDG Uptake in Lung, Breast, and Colon Cancers: Molecular Biology Correlates and Disease Characterization
J. Nucl. Med., November 1, 2009; 50(11): 1820 - 1827.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
V. Douard and R. P. Ferraris
Regulation of the fructose transporter GLUT5 in health and disease
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E227 - E237.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
A. R. Manolescu, K. Witkowska, A. Kinnaird, T. Cessford, and C. Cheeseman
Facilitated Hexose Transporters: New Perspectives on Form and Function
Physiology, August 1, 2007; 22(4): 234 - 240.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. J. Miller, J. Li, K. M. Sinusas, G. D. Holman, and L. H. Young
Infusion of a biotinylated bis-glucose photolabel: a new method to quantify cell surface GLUT4 in the intact mouse heart
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1922 - E1928.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
F.-Q. Zhao and A. F. Keating
Expression and Regulation of Glucose Transporters in the Bovine Mammary Gland
J Dairy Sci, June 1, 2007; 90(13_suppl): E76 - E86.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. A. Stuart, D. Yin, M. E. A. Howell, R. J. Dykes, J. J. Laffan, and A. A. Ferrando
Hexose transporter mRNAs for GLUT4, GLUT5, and GLUT12 predominate in human muscle
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E1067 - E1073.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
J. K Riley and K. H Moley
Glucose utilization and the PI3-K pathway: mechanisms for cell survival in preimplantation embryos.
Reproduction, May 1, 2006; 131(5): 823 - 835.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. C. Linden, C. L. DeHaan, Y. Zhang, S. Glowacka, A. J. Cox, D. J. Kelly, and S. Rogers
Renal expression and localization of the facilitative glucose transporters GLUT1 and GLUT12 in animal models of hypertension and diabetic nephropathy
Am J Physiol Renal Physiol, January 1, 2006; 290(1): F205 - F213.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. Ericsson, B. Hamark, T.L. Powell, and T. Jansson
Glucose transporter isoform 4 is expressed in the syncytiotrophoblast of first trimester human placenta
Hum. Reprod., February 1, 2005; 20(2): 521 - 530.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. He, M. Thamotharan, and S. U. Devaskar
Insulin-induced translocation of facilitative glucose transporters in fetal/neonatal rat skeletal muscle
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2003; 284(4): R1138 - R1146.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (48)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rogers, S.
Right arrow Articles by Best, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rogers, S.
Right arrow Articles by Best, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online