|
|
||||||||
1 Molecular Medicine Centre, Western General Hospital, Edinburgh, EH4 2XU Scotland, UK; 2 PRASSIS-SigmaTau Research Institute, 3-20019 Settimo Milanese, Milano; 5 University Vita Salute, San Raffaele Hospital, 20132 Milano, Italy; 3 Department of Biochemistry, Saarland University, 66041 Saarbruecken, Germany; and 4 University of Mississippi Medical Center and G. V. Montgomery Medical Center, Jackson, Mississippi 39216-4505
| |
ABSTRACT |
|---|
|
|
|---|
Using in vitro and in vivo methods,
we have demonstrated increased sensitivity of adrenocortical
steroidogenesis to ACTH in Milan hypertensive (MHS) compared with
normotensive (MNS) rats and have investigated whether this is caused by
mutations of steroidogenic enzymes. Genes encoding aldosterone synthase
(CYP11B2) and 11
-hydroxylase (CYP11B1) in MHS
and MNS have been cloned and sequenced. Nucleotide 752 (G) in exon 4 of
MHS CYP11B2 differs from that of MNS (A); CYP11B1
sequences were identical. The nucleotide 752 mutation caused a
Q251R substitution in the amino acid sequence of MHS CYP11B2.. The phenotype of MHS CYP11B2
alleles, when expressed in COS-1 cells, differed from that of MNS
alleles. The relative activities of the three reactions catalyzed by
CYP11B2 (11
-hydroxylation of deoxycorticosterone,
18-hydroxylation of corticosterone, and dehydrogenation of
18-hydroxycorticosterone) were estimated after incubation of
transfected cells with [14C]deoxycorticosterone and
analysis of radioactivity associated with deoxycorticosterone,
corticosterone, 18 hydroxycorticosterone, and aldosterone. Both 11- and
18-hydroxylase activities were lower (19 and 12%, respectively;
P < 0.01 and P < 0.05) in cells
transfected with MHS compared with MNS alleles, whereas 18-oxidase
activity was 42% higher (P < 0.01). To assess the
significance of the CYP11B2 mutation in vivo, DNA from F2
hybrid MHS × MNS rats was genotyped. MHS alleles were associated
with lower urine volumes in both sexes, lower ventricle weights in male
rats, but no difference in systolic or diastolic blood pressures
between the sexes. We conclude that a mutation in CYP11B2
may affect aldosterone secretion in MHS; however, under normal
environmental circumstances, we were unable to demonstrate any
influence of this mutation on blood pressure.
CYP11B genes; adrenocorticotropic hormone; corticosterone
| |
INTRODUCTION |
|---|
|
|
|---|
THE MILAN HYPERTENSIVE STRAIN of rat
(MHS) is widely used as a genetic model of essential hypertension
(1, 7). Recently, mutations in genes encoding adducin, a
cytoskeleton protein, have been identified in MHS that are responsible
for renal cation transport abnormalities accounting for some, but not
all, the blood pressure difference when compared with MNS, the
normotensive control strain (2). MHS are also
characterized by increased adrenocortical activity, which might
contribute to blood pressure control (2, 9, 29, 36).
Because adducin is expressed ubiquitously and is implicated in signal
transduction processes (37), it is possible that increased
steroidogenesis in MHS is an intermediate phenotype caused by greater
adrenal responsiveness to stimulation with one or more of the major
adrenocorticotropic factors (e.g., ACTH, angiotensin II, or
K+). However, we have previously shown that patterns of
steroids released into the adrenal vein of MHS and MNS are different
(11), observations that are akin to, but not identical
with, the steroid hormone profiles of salt-sensitive and salt-resistant
Dahl rats (34) and those of Lyon hypertensive and
normotensive rats (39). In the case of Dahl rats,
differences in steroidogenesis have been attributed to mutations in
genes encoding enzymes that catalyze the final steps in the
biosynthesis of corticosterone and aldosterone (5, 6, 30).
The two genes involved, CYP11B1 (encoding 11
-hydroxylase)
and CYP11B2 (encoding aldosterone synthase), are highly
homologous and lie in tandem on chromosome 7 (15). CYP11B1 and CYP11B2 are similarly juxtaposed in
humans and also appear to be important in the genetic determination of
blood pressure and cardiovascular function. Notably, crossover
mutations between CYP11B1 and CYP11B2 have been
identified as the cause of a rare hypertensive disorder,
glucocorticoid-suppressible hyperaldosteronism (27).
In view of previous studies showing associations between blood pressure and the CYP11B1/B2 locus, we investigated whether MHS and MNS differ genetically at this locus too, whether there is an association between CYP11B1/B2 genotype and steroidogenic properties, and whether there are any physiological consequences regarding blood pressure control. Accordingly, we have 1) confirmed phenotypic differences in aldosterone and corticosterone synthesis between MHS and MNS; 2) cloned and sequenced both CYP11B1 and CYP11B2 from MHS and MNS; 3) expressed MHS and MNS genes in COS-1 cells to monitor steroidogenic activity, and 4) evaluated the cosegregation of CYP11B1/B2 alleles with blood pressure and associated phenotypes in an F2 population of MHS × MNS crosses.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animals. Tissues for gene sequencing studies and isolated adrenocortical cell studies were obtained from rats held at the Field Laboratories, University of Sheffield, UK. Male rats were maintained in a light- and temperature-controlled environment with free access to food and water. Genetic studies and a further in vivo study of adrenocortical function were carried out with animals from colonies of MHS and MNS rats bred and maintained in Milan. For the genetic study, a large F2 population of 121 males and 130 females was used, as described in previous work (2). Blood pressure, left ventricular weights, and urine volume were analyzed. Urine volume was measured over a 24-h period after rats had been acclimatized to individual metabolic cages with free access to a standard diet (including 0.25% NaCl) and distilled water. Blood pressure was measured as previously described (2). Rats of the F2 population and age-matched rats of parental strains were killed by decapitation after ether anesthesia. Hearts were removed, blotted free of blood on filter paper, and weighed. The left ventricles were dissected and weighed.
Adrenocortical function in Milan strains.
On separate occasions, pairs of age-matched male MHS and MNS
(12-16 wk old) were killed by decapitation between 9 and 10 AM (1-2 h after lights on). Trunk blood for plasma hormone
measurements was collected within 1 min of first handling. Various
tissues, including adrenal glands, were removed and weighed, and the
results are expressed in proportion to body weights that did not vary between strains. Zona glomerulosa (ZG) and zona fasciculata/reticularis (ZF) cells were disaggregated from adrenal capsules and decapsulated adrenal glands, respectively, by collagenase digestion, as previously described (16). Aliquots of suspensions of ZG or ZF cells
containing 5 × 105 cells/ml were incubated for 1 h at 37°C in Ham's F-12 medium (Life Technologies, Paisley, UK) in
duplicate with 10
12, 10
11,
10
10, and 10
9 M ACTH
[ACTH-(1-24), Synacthen, Ciba, Horsham, UK]. After
centrifugation at 1,000 g for 10 min at 4°C, the
supernatant was removed and stored at
20°C for radioimmunoassay of
aldosterone and corticosterone, as previously described
(18). Adrenals from further groups of age-matched male MHS
and MNS were taken for Western blotting and RT-PCR.
Amplification and sequencing of CYP11B1 and CYP11B2.
RNA was extracted from MHS and MNS adrenal glands using the RNeasy Mini
Kit (Qiagen, Crawley, Sussex, UK). Reverse transcription of total RNA
and subsequent PCR amplification of 11
-hydroxylase and aldosterone
synthase open reading frames (ORFs) were carried out using the GeneAmp
RNA PCR kit (Perkin-Elmer, Warrington, Cheshire, UK) according to the
manufacturer's instructions. Primers were purchased from Oswell DNA
Service (Southampton, UK). Primer pairs for CYP11B1
amplification were TCAGCGATTYATRTCYTCAAGACAA (forward) and
GGACAGARGTAGGCYGGTGGACT (reverse); primer pairs for CYP11B2 amplification were GATTAGCTGAACAGTACAGTACTTAG (forward) and
GGACAGARGTAGGCYGGTGGACT (reverse). Total RNA (1 µg) was reverse
transcribed using oligo d(T)s primers. Transcription reactions were
carried out as follows: 1× PCR buffer [50 mM KCl, 10 mM
Tris · HCl (pH 8.3)], 5 mM MgCl2, 1 mM dNTPs, 2.5 µM oligo d(T) primers, 1 U RNase inhibitor, and 2.5 U MuLV reverse
transcriptase. Reactions were incubated at room temperature for 10 min,
at 42°C for 15 min, at 99° for 5 min, and at 4° for 5 min.
Amplification reactions were carried out in a Perkin-Elmer Applied
Biosystems thermal cycler in 1× PCR buffer [10 mM Tris · HCl
(pH 8.3) and 50 mM KCl], with 2 mM MgCl2, 0.2 mM dNTPs, 40 pmol of both the forward and reverse primers, and 3 U of Ultma DNA
polymerase (Perkin-Elmer) in a total volume of 100 µl. Amplification
cycles were as follows: initial denaturation at 94°C for 120 s,
then 30 cycles at 94° for 45 s, at 63° for 45 s, at 72°
for 120 s, and finally at 72° for 10 min. Amplified products
were purified using Microcon YM-100 columns (Millipore, Watford, Herts,
UK) and cloned into pPCR-Script SK(+) using the PCR-Script Amp Cloning
Kit (Stratagene, Amsterdam, The Netherlands). Plasmid DNA was purified
using Wizard Plus Miniprep DNA Purification System (Promega,
Southampton, UK), and the DNA was further purified for automated
sequencing by ethanol precipitation. Plasmid template was sequenced
using ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit
(Perkin-Elmer) with primers that were complementary to both
CYP11B1 and CYP11B2. Sequence data were assembled
using ABI Prism software Autoassembler 3.1.2. Comparisons of the
sequence data CYP11B1 and CYP11B2 from MNS and
MHS were made using GCG software (The Wisconsin Package, version 10) at
the UK Human Genome Mapping Project Resource Centre (Cambridge, UK).
Plasmid construction of CYP11B2 ORFs for transient cell
expression studies.
The CYP11B2 ORF from the MNS pPCR-Script SK(+) plasmid was
subcloned into the pSVL SV40 late promoter expression vector (Amersham Pharmacia Biotech, Little Chalfont, Bucks, UK) by use of
NotI and SalI restriction enzymes, blunt ended
with the Klenow fragment (Amersham Pharmacia Biotech), and ligated into
the SmaI site of pSVL to yield plasmid pMNS-AS. An A
G
nucleotide substitution, position 752 of the CYP11B2 ORF,
was introduced into pMNS-AS using the QuikChange Site-Directed
Mutagenesis Kit (Stratagene). The nucleotide change was introduced
using primers (Operon Technologies, Vh Bio, Newcastle upon Tyne,
UK) GACTCGCTGGACAAGCACCCGGGTGTGGAAAGAACATTTTG (forward) and
CAAAATGTTCTTTCCACACCCGGGTGCTTGTCCAGCGAGTC (reverse) to yield plasmid pMHS-AS. The presence of the mutation in pMHS-AS and
the integrity of the CYP11B2 ORFs from both pMHS-AS and
pMNS-AS clones were verified by automated sequencing, as we have described.
Transfection studies. COS-1 cells were cultured in DMEM (without sodium pyruvate, with 2.5 mM glucose and with pyridoxine HCl; Life Technologies), supplemented with 10% FCS, 2 mM L-glutamate, 1 mM sodium pyruvate, 100 U/ml penicillin, and 0.1 mg/ml streptomycin (DMEM + FCS). Cells were incubated at 37°C with 5% CO2. Transfections were carried out by the DEAE-dextran method (Amersham Pharmacia Biotech) as described by Zuber et al. (42), with some slight modifications. Plates (6 cm) were seeded with 6.5 × 105 cells and grown overnight. The DMEM + FCS medium was aspirated, and the cells were incubated with 2 ml DMEM supplemented with 1 mM HEPES, 2 mM L-glutamate, 100 mM sodium pyruvate, 100 U/ml penicillin, and 0.1 mg/ml streptomycin (DMEM + HEPES) for 2 h. DEAE-dextran medium (5 µl of 50 mg/ml) was added to 800 µl DMEM + HEPES. DNA for transfection was added to 200 µl DMEM + HEPES. Cells were cotransfected with 3 µg of bovine adrenodoxin (ADX) and 6 µg of either pMNS-AS, pMHS-AS, or pSVL. The DMEM + HEPES was aspirated, cells were incubated with the DEAE-dextran and DNA containing DMEM + HEPES for 1 h, and then 2 ml of DMEM + FCS containing 360 µg chloroquine (Sigma, Poole, Dorset, UK) were added, and the incubation was continued for a further 2.5 h. The medium was aspirated, and cells were subjected to DMSO shock treatment by incubation for 2 min with Hanks' balanced salt solution (HBSS) containing NaHCO3 (Life Technologies) and 10% DMSO (Sigma). After removal of the DMSO solution and two washes with HBSS, cells were incubated overnight with 3 ml of DMEM + FCS. Experiments were repeated three times, with duplicate or triplicate transfections within each experiment.
Aldosterone synthase activity. Transfected cells were incubated with 2 ml of DMEM containing 30 µM 11 deoxycorticosterone (DOC; Sigma) and 6 nCi [14C]DOC (NEN Life Science Products, Hounslow, UK) for 24 h. Steroid metabolites were extracted and separated with chloroform-methanol-water (300:20:1, vol/vol) by high-performance thin-layer chromatography, as described previously (3). Ultraviolet absorption of unlabeled steroid standards was performed to identify the reaction products. Radioactivity was reported as arbitrary units of intensity after phosphorimager analysis of TLC plates (Bio-Imager; FLA-200, Fuji).
Western blotting of CYP11B1 and CYP11B2.
Proteins were extracted from adrenal tissue by a method modified from
that of LeHoux et al. (24). Whole adrenals were
homogenized in extraction buffer containing 50 mM Tris · HCl
(pH 7.4), 0.25 M sucrose, 5 mM EDTA, 2 µg/ml leupeptin, aprotinin,
trypsin inhibitor, antipain, and 1 mM phenylmethylsulfonyl fluoride
(PMSF; Sigma). The homogenate was centrifuged at 1,500 g for
10 min to remove cellular debris and then at 11,500 g for 15 min. The mitochondrial pellet was resuspended in a small volume of
extraction buffer. Protein concentration was assayed with a kit
(Bio-Rad Laboratories, Hemel Hempstead, Herts, UK). Mitochondrial
protein (20 µg) was separated by PAGE (22) and blotted
onto an enhanced chemiluminescence (ECL) membrane (Amersham Phamacia
Biotech). Western blotting techniques were carried out according to
standard protocols by use of monoclonal antibodies raised to specific
synthetic peptides of aldosterone synthase and 11
-hydroxylase.
Antibodies were generated in CD-1 mice immunized by repeated injections
with the synthetic multiple antigenic peptide KVRQNARSLTMDVQQSLMAP for
aldosterone synthase and with the synthetic peptide KNVYRELAEGRQQSC for
11
-hydroxylase conjugated to chicken serum albumin. Spleens from
high titer mice were fused to HL-L Friendly myelome, and monoclonal
antibodies were prepared by a standard technique. Clones were screened
by ELISA with inner mitochondrial membranes prepared from adrenals of
sodium-depleted rats immobilized on 96-well plates. Antibodies produced
by incubation of hybridomas in roller bottles were concentrated by
ultrafiltration. Immunodetection of the antibody reaction in Milan
tissues was determined using the ECL detection system. Quantitative analyses were performed using a phosphorimager (Bio-Imager, FLA-200; Fuji).
Competitive RT-PCR. Primers for the amplification of distinctive fragments of CYP11B1 and CYP11B2 genes were those designed by Oaks and Raff (33). A 297-bp fragment of CYP11B2 (position 657-954) was amplified using primers ACCATGGATGTCAGCAA (forward) and GAGAGCTGCCGAGTCTGA (reverse). Primers GAGAGCTGCCGAGTCTGA (forward) and GCTGGAGAATGTTCATGG (reverse) amplified a 312-bp fragment from CYP11B1 (position 528-840).
A nonhomologous competitor was constructed from a fragment of the onion allinase gene (a gift of Dr. S. Edwards) with the method of Förster (10). Hybrid primers were designed to amplify a 198-bp fragment from a 1.2-kbp fragment of the allinase gene with appropriate CYP11B1 and primers (see above) tagged on. Hybrid primers for the amplification of the CYP11B2 competitor were ACCATGGATGTCCAGCAAGTTGCTCATGCCC (forward) and GAGAGCTGCCGAGTCTGACGTAATCCGCTGCA (reverse), and those for CYP11B1 were GCTGGAGAATGTTCATGGTTGCTCATGCCCC (forward) and CTCTGCCAGTTCGCGATACGTAATCCGCTGCA (reverse). The hybrid primers were annealed to the onion fragment template, and the nonhomologous competitor was amplified by PCR. Amplification reactions were carried out in 1× PCR buffer [10 mM Tris · HCl (pH 8.3), 10 mM KCl, 0.002% Tween 20 (vol/vol)], with 1.5 mM MgCl2, 200 µM dNTPs, 40 pmol of both the hybrid forward and reverse primers, and 3 U of Ultma DNA polymerase (Perkin-Elmer) in a total volume of 50 µl. Amplification cycles were as follows: initial denaturation at 95°C for 60 s and then 5 cycles at 95° for 30 s, at 35° for 30 s, and at 72° for 30 s; these were followed by 25 more cycles at 95° for 30 s, at 55° for 30 s, at 72° for 30 s, and finally at 72° for 2 min. Amplified products were purified using Microcon YM-100 columns and cloned into pPCR-Script SK(+) with the PCR-Script Amp Cloning. Plasmid DNA was purified and sequenced with T7 and T3 primers by automated methods, as described above, to verify the sequence of the competitors. Plasmid template was linearized with HindIII (Promega), and in vitro transcriptions were carried out using standard protocols with T3 polymerase (Promega). RT-PCR reactions were carried out using the Gene Amp Gold RNA PCR Reagent Kit according to the manufacturer's instructions. Either 10 ng or 300 ng of total RNA, for the RT-PCR of CYP11B1 and CYP11B2 mRNA, respectively, were reverse transcribed with 1 µl of an appropriate concentration of competitor, diluted in 0.05 mg/ml tRNA (Life Technologies, Paisley, UK). Transcription reactions were carried out in 1× RT-PCR buffer (30 mM Tris · HCl and 20 mM KCl, pH 8.3), 2.5 mM MgCl2, 250 µM dNTPs, 10 mM dithiothreitol, 1.25 µM random hexamer, 10 U of RNase inhibitor, and 15 U of Multiscribe reverse transcriptase in a total volume of 20 µl. Reactions were incubated at 25°C for 10 min and at 42°C for 12 min in an Eppendorf Mastercycler gradient thermal cycler. The RT reactions were subjected to PCR amplification as follows: 1× RT-PCR buffer (30 mM Tris · HCl and 20 mM KCl, pH 8.3), 2 mM MgCl2, 200 µM dNTPs, 20 pmol primers, and 2.6 U AmpliTaq Gold DNA polymerase. Amplification reactions were as follows: initial incubation at 95°C for 10 min, and then 28 cycles at 48° for 45 s, 72° for 45 s, and finally 72° for 5 min. Amplified products were separated on 2% agarose gels. Quantitative analyses were performed using a phosphorimager.Genotype determination for CYP11B2 and other polymorphic markers. DNA for genotyping F2 rat populations was extracted from tails. PCR and gel electrophoresis for markers on chromosome 7 (D7Rat32, D7Rat44, D7Rat 66, D7Wox3, D7Wox6, D7Mit4, D7Mit5, D7Mit14, D7Mgh1, Cyp11B1) were carried out as previously described (41). CYP11B2 genotyping was based on a single base A-to-G transition in codon 251, which gives rise to a restriction fragment length polymorphism (RFLP) with the restriction enzyme SmaI (restriction site absent in MNS and present in MHS). PCR amplification was carried out with primers (forward: 5'-CAGCCAGCAACTTTGCACTT-3' and reverse: 5'-GACATCCCAGGCATCAAAAT-3') based on the exon 4 genomic sequence (GenBank accession no. D14093). The reaction was performed in 20-µl reaction volume under the following conditions: 250 ng genomic DNA, 0.4 µM each primer, 200 µM dNTPs, NH4 buffer, 1.5 mM MgCl2, and 2 U Taq polymerase (Bioline, London, UK). PCR was carried out for 32 cycles with an annealing temperature of 55°C. The genotypes in the F2 (MHS × MNS) intercross cohort were then analyzed by 4% agarose gel electrophoresis after digestion of the PCR amplification products with the restriction enzyme SmaI, which results in 159- and 35-bp fragments in the case of the MHS allele; the PCR product from MNS DNA remains uncleaved (194 bp).
Linkage and statistical analysis. Linkage map and quantitative trait loci (QTL) localizations were done with MAPMAKER/EXP and MAPMAKER/QTL 1.1 programs as previously described (41). According to Lander and Kruglyak (23), threshold logarithm of odds (LOD) score values of 1.9 and 3.3 may be considered as suggestive and significant evidence of linkage in a codominant genetic model. One-way ANOVA was used to compare tissue weights of MHS and MNS and steroid output in transfected cells. Plasma concentrations of aldosterone, corticosterone, ACTH, and plasma renin activity in cannulated rats and dose-response curves to ACTH in MHS and MNS ZG and ZF cells were compared by MANOVA. Data from cosegregation studies were analyzed by one-way ANOVA with the Newman-Keuls correction test for multiple comparisons. P values of <0.05 were considered significant. Statistical packages used were Minitab and SPSS.
| |
RESULTS |
|---|
|
|
|---|
Tissue weights and adrenocortical function in Milan strain.
In rats used for the preparation of adrenocortical cells, MHS had
heavier adrenal glands, higher plasma aldosterone concentrations, smaller thymuses, and smaller kidneys compared with MNS (Table 1). Responses of ZG and ZF cells from MHS
and MNS to ACTH are shown in Fig. 1.
Overall aldosterone responses, when account was taken of fixed and
random variables, were greater in MHS compared with MNS ZG cells
(P = 0.002), but differences at each concentration of
ACTH were not statistically significant. Corticosterone responses of
MHS ZF cells were approximately twofold greater than those of MNS cells
(P < 0.001). Despite increased aldosterone production by stimulated ZG cells, Western blotting (Fig.
2) indicated that aldosterone synthase
tended to be lower in MHS compared with MNS adrenals. Although this
difference was not statistically significant (P < 0.1), it nevertheless contrasts with the ability of MHS adrenal glands
to secrete greater amounts of aldosterone. 11
-Hydroxylase expression
was higher (P < 0.05) in MHS, which is consistent with data from several sources showing increased corticosterone synthesis compared with MNS (2, 9, 29, 36).
|
|
|
|
|
Sequencing.
MHS and MNS nucleotide and amino acid sequences for aldosterone
synthase and 11
-hydroxylase were aligned and compared with those
published for Sprague-Dawley rats (30, 32). MNS sequences were identical with those of Sprague-Dawley rats, as was MHS
CYP11B1. Three nucleotide substitutions were observed in
CYP11B2 of MHS. Two of the substitutions in the MHS gene
were silent (exon 1, nucleotide 60 G
A; exon 6, nucleotide 1084 C
T). The third substitution (exon 4, nucleotide 752 A
G) caused an
amino acid change at position 251 from glutamine
arginine. This gave
a restriction site for SmaI in MHS that was used to
distinguish MHS and MNS CYP11B2 alleles when F2 rats were genotyped
(see Cosegregation studies).
Expression studies in transfected cells.
When transfected into COS 1 cells, CYP11B2 alleles of MHS
and MNS genotype converted DOC to corticosterone, 18OH corticosterone, and aldosterone. Radioactivity was quantified by phosphorimage analysis
and reported as arbitrary units of intensity. Conversions to
corticosterone (MNS: 597.5 ± 63.9; MHS: 583.8 ± 61.5) and
aldosterone (MNS: 459.1 ± 90.6; MHS: 439.6 ± 60.6) were
similar for MNS and MHS alleles, but 18OH corticosterone release (MNS:
423.1 ± 42.2; MHS: 294.8 ± 14.4) appeared less for MHS
alleles (P < 0.02). Bearing in mind that aldosterone
synthase catalyzes three sequential reactions (hydroxylations at the 11 and 18 positions and then dehydrogenation of 18OH corticosterone), we
assessed individual reactions as ratios of products to substrate.
Figure 5 shows that cells transfected with MHS, compared with MNS alleles, had less 11
-hydroxylase activity (P < 0.01; aldosterone + 18OH
corticosterone + corticosterone to DOC) and 18-hydroxylase
activity (P < 0.05; aldosterone + 18OH corticosterone
to corticosterone) and greater 18-dehydrogenase activity
(P < 0.01; aldosterone to 18OH corticosterone).
|
Cosegregation studies.
DNA from F2 rats was genotyped according to the SmaI
restriction site in MHS CYP11B2 alleles. No significant
influence of MHS genotype on systolic or diastolic blood pressures was
seen, but rats homozygous for the MHS genotype had lower left ventricle weights and urine volumes than MNS homozygotes (Fig.
6). These differences contrast with
values in age-matched parental strains, where daily urine volume
appeared higher for male MHS than MNS (4.04 ± 0.38 vs. 2.56 ± 0.18 ml/kg body wt; P < 0.05), as did left
ventricular weights (0.195 ± 0.002 vs. 0.176 ± 0.003 g/kg body wt; P < 0.05), particularly in male rats.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
We have investigated the basis for increased steroidogenic activity in MHS. At the outset, the phenotype of heavier adrenal glands and higher plasma concentrations of aldosterone and corticosterone, which others have described, was confirmed. A number of possible explanations are suggested: 1) that feedback control of the hypothalamo-pituitary-adrenal axis is impaired; 2) that adrenocortical cells are intrinsically more sensitive to stimulation; 3) that steroidogenic enzymes are more active. The first suggestion is supported by our previous study of glucocorticoid receptor-binding properties, which demonstrated that hepatic GR in MHS exhibit reduced affinity for corticosterone compared with MNS GR (19). If this property were common to all tissues, then diminished negative feedback of ACTH secretion would lead to adrenal cell hypertrophy and hyperplasia, particularly of ZF cells (the predominant adrenal cell type). However, despite impaired GR binding, we have unpublished evidence that hepatic phosphoenolpyruvate carboxykinase, a glucocorticoid-regulated enzyme, is more, not less, active in MHS. It is also significant that thymus weight is less in MHS, another feature of excess glucocorticoid activity.
We have assessed responsiveness of isolated ZG and ZF cells. Both cell types from MHS were significantly more sensitive to ACTH than those of MNS. Similarly, in vivo, plasma aldosterone and corticosterone concentrations were higher in MHS than in MNS over a range of concentrations of plasma ACTH. It is generally acknowledged that acute increases in steroidogenesis are mediated by the supply of substrate, cholesterol, to the mitochondrial, cholesterol side-chain cleavage enzyme. It is relevant, therefore, that more cholesterol is stored in MHS than in MNS adrenal cells (29). However, whether this is a cause or a consequence of raised steroid hormone concentrations is unclear.
Another factor to consider is that hypertension in MHS is primarily due to mutations of adducin, which alter renal cation transport. The mechanism of ACTH action also involves changes in cation transport. Therefore, if we assume that adducin is ubiquitously expressed, it is easy to see that adducin mutations might interfere with signal transduction processes.
CYP11B1 and CYP11B2 are key enzymes regulating
corticosterone and aldosterone synthesis, respectively. Western
blotting and competitive RT-PCR techniques were developed to compare
expression in MHS and MNS adrenal glands. Differences in
CYP11B1 and CYP11B2 mRNA expression between MHS
and MNS did not achieve statistical significance, but protein levels
were differentially affected. Expression of 11
-hydroxylase was
higher in MHS than in MNS, which could account for the greater output
of corticosterone from ZF cells stimulated with ACTH. In contrast,
aldosterone synthase levels appeared lower, although the difference was
not statistically significant. The discrepancy between mRNA and protein
expression is difficult to explain, but not without precedent. Rats
treated chronically with ACTH show reduced adrenal expression of mRNA of several steroidogenic enzymes without corresponding changes in
protein levels (25). It is interesting to note that
Hornsby and Crivello (13, 14) suggest that adrenal
CYP450 enzymes are susceptible to oxidative damage and that
aldosterone synthase, because of blood supply to the ZG, is
particularly exposed. A difference in adrenal blood supply could
account for an apparently shorter half-life of aldosterone synthase in
MHS adrenals, but not also an increase in 11
-hydroxylase stability,
particularly as 11
-hydroxylase in the ZF is relatively protected
from peroxidation.
Our previous work with adrenal vein samples found differences in steroid hormone profiles between MHS and MNS that were indicative of altered CYP11B1/B2 properties. However, measurements of plasma ratios cannot distinguish the zonal origin of adrenocortical steroids, or whether CYP11B1 and/or CYP11B2 properties are affected. We chose to compare the coding sequences of each enzyme for MHS and MNS, because this approach had successfully identified several mutations in both genes in the Dahl rat. It seemed less likely that promoter sequences would be affected, given that mRNA expression levels in Milan rats were similar for both genes. The only meaningful difference found was a G-to-A substitution at nucleotide 752 in exon 4 of CYP11B2, which caused a glutamine-to-arginine change at amino acid 251. Interestingly, this same mutation was one of two found in Dahl salt-resistant rats (6). In vitro expression studies showed that the MHS gene had little effect on net aldosterone production in COS-1 cells but did appear to reduce 18OH corticosterone output. We acknowledge that this experiment may be flawed because only one relatively high concentration of DOC was tested and because aldosterone production may have been limited by the availability of cofactors in COS-1 cells compared with steroidogenic cell lines. However, our interpretation of these data is that there are reciprocal changes in the properties of aldosterone synthase such that 11/18-hydroxylase activities are decreased, whereas 18-oxidase activities are increased. In contrast, the combined effect of the two Dahl salt-resistant mutations caused a thousandfold increase in aldosterone production by transfected steroidogenic MA-10 cells. Whether this reflects the added influence of the second mutation or differences in protocol for testing enzyme activity is unclear. In vivo, the difference in aldosterone production between resistant and sensitive strains is much more modest.
An attempt has been made to analyze the separate effects of the Dahl resistant type of mutations at corresponding sites in human CYP11B2 (8). As in our experiments, the production of corticosterone, 18OH corticosterone, and aldosterone from radioactive DOC was analyzed by TLC. Both Dahl-type mutations increased aldosterone synthesis, but again residue 251 appeared to critically affect relative 18-hydroxylase and 18-oxidase activities. Changing lysine (corresponding to glutamine in rat) to arginine at position 251 increased 18OH corticosterone output 4- to 5-fold but increased aldosterone synthesis only 1.5-fold. In vivo, these reciprocal changes would become important only if CYP11B1 and CYP11B2 were coexpressed when 11 hydroxylated products from CYP11B1 could be utilized by aldosterone synthase.
The physiological consequences of the MHS CYP11B2 mutation were tested with DNA archived from an F2 population of an MHS × MNS cross. Unfortunately, it was not possible to match phenotypic information about steroid hormone levels or adrenocortical activity with CYP11B2 genotype. However, bearing in mind that MHS exhibit characteristics of mineralocorticoid excess (11), our expectation was that the CYP11B2 mutation might influence blood pressure, possibly with consequential increases in heart mass. Indeed, given recent findings that aldosterone regulates cardiac function in rats (35) and that a polymorphism in the promoter region of CYP11B2 is associated with ventricular hypertrophy in humans (21), we considered the possibility that CYP11B2 might affect heart weight independent of blood pressure in MHS. In fact, blood pressures of F2 rats were similar for all genotypes, and left ventricle weight tended to be lower, not higher, in rats with MHS CYP11B2 alleles. Given that mineralocorticoid-induced hypertension in rodents requires dietary sodium loading and a reduction in renal mass (20), the lack of influence of CYP11B2 on blood pressure might be explained, but the reason for reduced heart weight with MHS alleles is less clear. In some respects, this inconsistency is similar to that of Dahl salt-sensitive and salt-resistant rats. MHS have one of the two mutations in CYP11B2 found in Dahl resistant rats. Paradoxically, the combined CYP11B2 mutations of Dahl-resistant rats cause increased aldosterone synthase activity in vitro, yet they are associated with lower blood pressures and left ventricular weights in vivo. It has been argued, however, that mutations of CYP11B1 rather than CYP11B2 genes contribute to hypertension and left ventricular hypertrophy of Dahl-sensitive compared with resistant rats (4). This cannot account for differences between MHS and MNS, since the sequences of CYP11B1 are identical, although it is possible that other genes in close linkage dysequilibrium may be involved. In two separate studies, QTL for left ventricular mass have been identified on chromosome 7 in the vicinity of the CYP11B1/B2 locus (12, 38).
The association of MHS genotype with reduced urine volume was found in males and females. This observation is consistent with known effects of aldosterone (20). Interval mapping on chromosome 7 established a QTL for urine volume near the CYP11B1/B2 locus in male but not in female rats. The LOD scores for CYP11B2 did not meet strict statistical tests of significance but were at least as good as those suggesting linkage of CYP11B1 with blood pressure in Dahl rats and left ventricular mass (4, 5). The possibility that another gene in close linkage disequilibrium is involved cannot be excluded. However, as yet there is no information about alternative candidate genes that could account for LOD scores >3.5 in the vicinity of D7Mit4.
In summary, we have provided evidence of increased adrenocortical
sensitivity to ACTH in MHS compared with MNS rats. A difference in the
sequence of CYP11B2 was identified in MHS that altered the
relative 18-hydroxylase and 18-oxidase properties of aldosterone synthase and an increase in the expression of 11
-hydroxlase has been
found. These differences could account for previously observed steroid
profiles in adrenal vein samples of MHS and MNS. The CYP11B2 mutation might influence plasma aldosterone concentration and hence
determine heart weight and urine volume. Potentially, elevated plasma
aldosterone could influence blood pressure via a
mineralocorticoid-dependent mechanism, but the present linkage studies
have not identified the MHS CYP11B2 mutation as a
determinant of blood pressure. It should be noted, however, that
mineralocorticoid-induced hypertension in rats is very much affected by
two variables, salt sensitivity and renal mass (16),
phenotypes that differ markedly between MHS and MNS. Therefore, a more
complete test of the MHS CYP11B2 mutation would require rats
to be fed a high-salt diet and should also take account of genetically
determined variations in renal mass.
No difference in the sequence of CYP11B1 was identified to
account for increased corticosterone synthesis in MHS, but higher levels of hormone and 11
-hydroxylase protein were consistent with
greater sensitivity to ACTH. However, in vivo and in vitro studies
indicated that acutely both aldosterone and corticosterone responses to
ACTH were greater in MHS adrenocortical tissue. This could reflect an
enhancement of signal transduction processes, which in turn might
contribute to the higher blood pressure of MHS. The work of Whitworth
et al. (40) has investigated in some detail the pressor
effects of ACTH among five different strains of rat. Blood pressure
increases were similar, but responses relating to fluid and electrolyte
balance were different (40). Interestingly, although
ACTH-induced hypertension is associated with corticosterone synthesis
(28), it is not clear that pressor responses are mediated by either mineralocorticoid or glucocorticoid receptors
(26).
We conclude that increased adrenocortical activity in MHS is associated with greater sensitivity to ACTH and a mutation in the coding region of CYP11B2. Further tests, which take account of known genetic and phenotypic differences between MNS and MHS, are required to define any cardiovascular consequences of abnormally high steroid hormone concentrations.
| |
ACKNOWLEDGEMENTS |
|---|
The expert statistical advice provided by Dr. Niall Anderson (Department of Statistics, University of Glasgow, UK) is very much appreciated. Minotti Elena gave excellent technical assistance. We are particularly grateful to Professor Giuseppe Bianchi for constructive suggestions and for generously providing animals and laboratory facilities.
| |
FOOTNOTES |
|---|
This work was supported in the UK by the Medical Research Council (C. J. Kenyon and S. A. Lloyd-MacGilp) and in Germany (S. Bechtel and R. Bernhardt) by Deutsche Forschungsgemeinschaft Grant Be 1343/2-5 and Fonds der Chemischen Industrie.
Address for reprint requests and other correspondence: C. J. Kenyon, Molecular Medicine Centre, Western General Hospital, Edinburgh, EH4 2XU Scotland, UK (E-mail: cjk{at}srv0.med.ed.ac.uk).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpendo.00043.2001
Received 5 February 2001; accepted in final form 31 October 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bianchi, G,
Ferrari P,
and
Barber BR.
The Milan hypertensive strain.
In: Handbook of Hypertension, , edited by de Jong W. Amsterdam: Elsevier, 1984, p. 328-349.
2.
Bianchi, G,
Tripodi G,
Casari G,
Salardi S,
Barber BR,
Garcia R,
Leoni P,
Torielli L,
Cusi D,
Ferrandi M,
Pinna LA,
Baralle FE,
and
Ferrari P.
Two point mutations within the adducin genes are involved in blood pressure.
Proc Nat Acad Sci USA
91:
3999-4003,
1994.
3.
Bülow, HE,
Mobius K,
Bahr V,
and
Bernhardt R.
Molecular cloning and functional expression of the cytochrome P450 11B-hydroxylase of the guinea pig.
Biochem Biophys Res Commun
221:
304-312,
1996.
4.
Cicila, GT,
Dukhanina OI,
Kurtz TW,
Walder R,
Garrett MR,
Dene H,
and
Rapp JP.
Blood pressure and survival of a chromosome 7 congenic strain bred from Dahl rats.
Mamm Genome
8:
896-902,
1997.
5.
Cicila, GT,
Rapp JP,
Wang JM,
St Lezin E,
Ng SC,
and
Kurtz TW.
Linkage of 11
-hydroxylase mutations with altered steroid biosynthesis and blood pressure in the Dahl rat.
Nature Genet
3:
346-353,
1993.
6.
Cover, CM,
Wang JM,
St Lezin E,
Kurtz TW,
and
Mellon SH.
Molecular variants in the P450c11AS gene as determinants of aldosterone synthase activity in the Dahl rat model of hypertension.
J Biol Chem
270:
16555-16560,
1995.
7.
Cusi, D,
Alberghini E,
Pati P,
Tripodi G,
Barlassini C,
Colombo R,
Cova T,
Niutta E,
Vezzoli G,
and
Binchi G.
Pathogenic mechanisms in essential hypertension. Analogies between a rat model and the human disease.
Int J Cardiol
25, Suppl1:
S29-S36,
1989.
8.
Fardella, CE,
Rodriguez H,
Hum DW,
Mellon SH,
and
Miller WL.
Artificial mutations in P450c11AS (aldosterone synthase) can increase enzymatic activity: a model for low-renin hypertension?
J Clin Endocrinol Metab
80:
1040-1043,
1995.
9.
Ferrari, P,
Mantero F,
and
Bianchi G.
Role of adrenal steroids in the rat genetic models of hypertension.
In: The Adrenal Gland and Hypertension, , edited by Mantero F,
Biglieri EG,
Funder JW,
and Scoggins BA.. New York: Raven, 1985, vol. 27, p. 149-158. (Serono Symp Publ)
10.
Forster, E.
An improved general method to generate internal standards for competitive PCR.
Biotechniques
16:
18-20,
1994.
11.
Fraser, R,
Ancil AK,
Brown WB,
Ingram MC,
Holloway CD,
Henderson IW,
and
Kenyon CJ.
Evidence of abnormalities in corticosteroid secretion leading to volume-dependent hypertension in Milan rats.
Hypertension
24:
512-515,
1994.
12.
Garrett, MR,
Dene H,
Walder R,
Zhang QY,
Cicila GT,
Assadnia S,
Deng AY,
and
Rapp JP.
Genome scan and congenic strains for blood pressure QTL using Dahl salt-sensitive rats.
Genome Res
8:
711-723,
1998.
13.
Hornsby, PJ,
and
Crivello JF.
The role of lipid peroxidation and biological antioxidants in the function of the adrenal cortex. Part 1: A background review.
Mol Cell Endocrinol
30:
1-20,
1983.
14.
Hornsby, PJ,
and
Crivello JF.
The role of lipid peroxidation and biological antioxidants in the function of the adrenal cortex. Part 2.
Mol Cell Endocrinol
30:
123-147,
1983.
15.
Inglis, GC,
Kenyon CJ,
Szpirer C,
Klinga-Levan K,
Sutcliffe RG,
and
Connell JMC
Microsatellite polymorphism analysis allows the individual assignment of the rat 11
-hydroxylase gene (Cyp11b1) and the rat aldosterone synthase gene (Cyp11b2) to rat chromosome 7 using rat-mouse somatic cell hybrids and identifies differences between and within various rat strains.
J Mol Endocrinol
14:
303-311,
1995.
16.
Kenyon, CJ,
and
Morton JJ.
Experimental steroid-induced hypertension.
In: Textbook of Hypertension, edited by Swales JD. Oxford: Blackwell Scientific, 1994, p. 493-500.
17.
Kenyon, CJ,
Mosley W,
Hargreaves G,
Balment RJ,
and
Henderson IW.
The effects of dietary sodium restriction and potassium supplementation and hypophysectomy on adrenocortical function in the rat.
J Steroid Biochem
9:
337-344,
1978.
18.
Kenyon, CJ,
Panarelli M,
Holloway CD,
Dunlop D,
Morton JJ,
Connell JM,
and
Fraser R.
The role of glucocorticoid activity in the inheritance of hypertension: studies in the rat.
J Steroid Biochem Mol Biol
45:
7-11,
1993.
19.
Kenyon, CJ,
Panarelli M,
Zagato L,
Torielli L,
Heeley RP,
Holloway CD,
Fraser R,
Casari G,
Sutcliffe RG,
and
Bianchi G.
Glucocorticoid receptor polymorphism in genetic hypertension.
J Mol Endocrinol
21:
41-50,
1998.
20.
Kenyon, CJ,
Saccoccio NA,
and
Morris DJ.
Aldosterone effects on water and electrolyte metabolism.
J Endocrinol
100:
93-100,
1984.
21.
Kupari, M,
Hautanen A,
Lankinen L,
Koskinen P,
Virolainen J,
Nikkila H,
and
White PC.
Associations between human aldosterone synthase (CYP11B2) gene polymorphisms and left ventricular size, mass, and function.
Circulation
97:
569-575,
1998.
22.
Laemmli, UK.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:
680-685,
1970.
23.
Lander, E,
and
Kruglyak L.
Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results.
Nat Genet
11:
241-247,
1995.
24.
LeHoux, JG,
Lefebvre A,
Ducharme L,
Lehoux J,
Martel D,
and
Briere N.
Some effects of a low sodium intake on the expression of P450 aldosterone synthase in the hamster adrenal cortex: immunoblotting, immunofluorescent and immuno-gold electron microscopic studies.
J Endocrinol
149:
341-349,
1996.
25.
LeHoux, JG,
Fleury A,
and
Ducharme L.
The acute and chronic effects of adrenocorticotropin on the levels of messenger ribonucleic acid and protein of steroidogenic enzymes in rat adrenal in vivo.
Endocrinology
139:
3913-3922,
1998.
26.
Li, M,
Wen C,
Fraser T,
and
Whitworth JA.
Adrenocorticotrophin-induced hypertension: effects of mineralocorticoid and glucocorticoid receptor antagonism.
J Hypertens
17:
419-426,
1999.
27.
Lifton, RP,
Dluhy RG,
Powers M,
Rich GM,
Cook S,
Ulick S,
and
Lalouel JM.
A chimaeric 11 beta-hydroxylase/aldosterone synthase gene causes glucocorticoid-remediable aldosteronism and human hypertension.
Nature
355:
262-265,
1992.
28.
Mangos, GJ,
Turner SW,
Fraser TB,
and
Whitworth JA.
The role of corticosterone in corticotrophin (ACTH)-induced hypertension in the rat.
J Hypertens
18:
1849-1855,
2000.
29.
Mantero, F,
Nussdorfer GG,
Robba C,
Opocher G,
Ferrari P,
and
Bianchi G.
Evidence for mineralocorticoid hyperactivity in the Milan hypertensive strain of rat.
J Hypertens
1, Suppl.2:
150-152,
1983.
30.
Matsukawa, N,
Nonaka Y,
Higaki J,
Nagano M,
Mikami H,
Ogihari T,
and
Okamoto M.
Dahl's salt resistant normotensive rat has mutations in cytochrome P450 (11beta) but the salt-sensitive rat does not.
J Biol Chem
268:
9117-9121,
1993.
31.
Millar, JA,
Leckie BJ,
Morton JJ,
Jordan J,
and
Tree M.
A microassay for active and total renin concentration in human plasma based on antibody trapping.
Clin Chim Acta
101:
5-15,
1980.
32.
Mukai, K,
Imai M,
Shimada H,
and
Ishimura Y.
Isolation and characterization of rat CYP11B genes involved in late steps of mineralo- and glucocorticod syntheses.
J Biol Chem
268:
9130-9137,
1993.
33.
Oaks, MK,
and
Raff H.
Differentiation of the expression of aldosterone synthase and 11 beta-hydroxylase mRNA in the rat adrenal cortex by reverse transcriptase-polymerase chain reaction.
J Steroid Biochem Mol Biol
54:
193-199,
1995.
34.
Rapp, JP,
and
Dahl LK.
Mutant forms of cytochrome P-450 controlling both 18- and 11beta-steroid hydroxylation in the rat.
Biochemistry
15:
1235-1242,
1976.
35.
Robert, V,
Silvestre JS,
Charlemagne D,
Sabri A,
Trouve P,
Wassef M,
Swynghedauw B,
and
Delcayre C.
Biological determinants of aldosterone-induced cardiac fibrosis in rats.
Hypertension
26:
971-978,
1995.
36.
Stewart, PM,
Whorwood CB,
Valentino R,
Burt D,
Sheppard MC,
and
Edwards CR.
11
-Hydroxysteroid dehydrogenase activity and gene expression in the hypertensive Bianchi-Milan rat.
J Hypertens
11:
349-354,
1993.
37.
Tripodi, G,
Valtorta F,
Torielli L,
Chieregatti E,
Salardi S,
Trusolino L,
Menegon A,
Ferrari P,
Menegon A,
Ferrari P,
Marchisio PC,
and
Bianchi G.
Hypertension associated point mutations in the adducin
and
-subunits affect actin cytoskeleton and ion transport.
J Clin Invest
97:
2815-2822,
1996.
38.
Tsujita, Y,
Iwai N,
Tamaki S,
Nakamura Y,
Nishimura M,
and
Kinoshita M.
Genetic mapping of quantitative trait loci influencing left ventricular mass in rats.
Am J Physiol Heart Circ Physiol
279:
H2062-H2067,
2000.
39.
Vincent, M,
Gomez-Sanchez CE,
Bataillard A,
and
Sassard J.
Steroids during development of genetic hypertension in rats of Lyon strain.
Am J Physiol Heart Circ Physiol
257:
H506-H510,
1989.
40.
Whitworth, JA,
Hewitson TD,
and
Cornwallis C.
Corticotropin effects on blood pressure and fluid and electrolyte homeostasis in five strains of rats.
Am J Hypertens
5:
302-313,
1992.
41.
Zagato, L,
Modica R,
Florio M,
Torielli L,
Bihoreau MT,
Bianchi G,
and
Tripodi G.
Genetic mapping of blood pressure quantitative trait loci in Milan hypertensive rats.
Hypertension
36:
734-739,
2000.
42.
Zuber, MX,
Mason JI,
Simpson ER,
and
Waterman MR.
Simultaneous transfection of COS-1 cells with mitochondrial and microsomal steroid hydroxylases: incorporation of a steroidogenic pathway into nonsteroidogenic cells.
Proc Natl Acad Sci USA
85:
699-703,
1988.
This article has been cited by other articles:
![]() |
E. P. Gomez-Sanchez, C. M. Gomez-Sanchez, M. Plonczynski, and C. E. Gomez-Sanchez Aldosterone synthesis in the brain contributes to Dahl salt-sensitive rat hypertension Exp Physiol, January 1, 2010; 95(1): 120 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. van der Hoek, M. Waaijers, P. M. van Koetsveld, D. Sprij-Mooij, R. A. Feelders, H. A. Schmid, P. Schoeffter, D. Hoyer, D. Cervia, J. E. Taylor, et al. Distinct functional properties of native somatostatin receptor subtype 5 compared with subtype 2 in the regulation of ACTH release by corticotroph tumor cells Am J Physiol Endocrinol Metab, August 1, 2005; 289(2): E278 - E287. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Forte, S. Esposito, M. De Feo, U. Galderisi, C. Quarto, F. Esposito, A. Renzulli, L. Berrino, M. Cipollaro, L. Agozzino, et al. Stenosis progression after surgical injury in Milan hypertensive rat carotid arteries Cardiovasc Res, December 1, 2003; 60(3): 654 - 663. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |