|
|
||||||||
1 Department of Internal Medicine, Institute of Clinical Medicine, and 2 Department of Immunology, Institute of Basic Medicine, University of Tsukuba, Tsukuba 305-8575; and 3 Department of Metabolic Disease, School of Medicine, University of Tokyo, Tokyo 113-8655, Japan
| |
ABSTRACT |
|---|
|
|
|---|
DNA microarray analysis on upregulated genes in the livers from transgenic mice overexpressing nuclear sterol regulatory element-binding protein (SREBP)-1a, identified an espressed sequence tag (EST) encoding a part of murine cytosolic acetyl-coenzyme A synthetase (ACAS). Northern blot analysis of the livers from transgenic mice demonstrated that this gene was highly induced by SREBP-1a, SREBP-1c, and SREBP-2. DNA sequencing of the 5' flanking region of the murine ACAS gene identified a sterol regulatory element with an adjacent Sp1 site. This region was shown to be responsible for SREBP binding and activation of the ACAS gene by gel shift and luciferase reporter gene assays. Hepatic and adipose tissue ACAS mRNA levels in normal mice were suppressed at fasting and markedly induced by refeeding, and this dietary regulation was nearly abolished in SREBP-1 knockout mice, suggesting that the nutritional regulation of the ACAS gene is controlled by SREBP-1. The ACAS gene was downregulated in streptozotocin-induced diabetic mice and was restored after insulin replacement, suggesting that diabetic status and insulin also regulate this gene. When acetate was administered, hepatic ACAS mRNA was negatively regulated. These data on dietary regulation and SREBP-1 control of ACAS gene expression demonstrate that ACAS is a novel hepatic lipogenic enzyme, providing further evidence that SREBP-1 and insulin control the supply of acetyl-CoA directly from cellular acetate for lipogenesis. However, its high conservation among different species and the wide range of its tissue distribution suggest that this enzyme might also play an important role in basic cellular energy metabolism.
lipogenic enzyme; acetate; diabetes; insulin; transcription
| |
INTRODUCTION |
|---|
|
|
|---|
INTRACELLULAR CHOLESTEROL and fatty acid synthesis are regulated at the transcriptional level, mainly by sterol regulatory element-binding proteins (SREBPs), transcription factors belonging to the basic-helix-loop-helix leucin zipper family (2-4, 28). SREBPs are synthesized in a membrane-bound form. Upon sterol deprivation, nuclear SREBPs are cleaved to enter the nucleus and activate the transcription of genes involved in cholesterol and fatty acid synthesis by binding to sterol regulatory elements (SREs) or to palindromic sequences called E boxes within their promoter regions (3, 5, 26, 28). SREBPs consist of three isoforms (SREBP-1a, SREBP-1c, and SREBP-2), where SREBP-1a and -1c are generated from a single gene through alternative splicing (14, 31).
Cumulative lines of evidence, including normal, transgenic, and knockout mice on diet studies, established that SREBP-1 plays a role in regulating the transcription of genes involved in fatty acid synthesis, whereas SREBP-2 is actively involved in the transcription of cholesterogenic enzymes (13, 24). SREBP-1a is a stronger activator than SREBP-1c because of a longer transactivation domain, and it has a wider range of target genes involved in both cholesterol and fatty acid synthesis (22, 23). Transgenic mice overexpressing nuclear SREBP-1a in the liver demonstrated a marked induction of cholesterogenesis and lipogenesis resulting in engorged fatty livers (22).
Lipogenic enzymes, which are involved in energy storage through synthesis of fatty acids and triglycerides, are coordinately regulated at the transcriptional level during different metabolic states (9, 11). Recent in vivo studies demonstrated that SREBP-1c plays a crucial role in the dietary regulation of most hepatic lipogenic genes. These include studies of the effects of the absence or overexpression of SREBP-1 on hepatic lipogenic gene expression (22-24), as well as physiological changes of SREBP-1c protein in normal mice after dietary manipulations, such as placement on high carbohydrate diets, polyunsaturated fatty acid-enriched diets, and fasting-refeeding regimens (12, 15, 25, 29, 30). Recent studies suggest that insulin or insulin-facilitated glucose uptake mediates lipogenesis through SREBP-1c induction (7, 10, 18).
Acetyl-CoA synthetase (ACAS) is an intracellular enzyme that catalyzes the formation of acetyl-coenzyme A (acetyl-CoA) from coenzyme A and acetate (17). ACAS is known to be involved in ethanol and acetate metabolism of bacteria, and its molecular characterization has been well described from a microbiological point of view (8, 27). ACAS activity has also been well known among researchers in ruminology to play a crucial role in energy production of ruminants, because volatile fatty acids (also known as short-chain fatty acids), produced through fermentation of cellulose and other fibers in rumen, are their main source of energy. Even in other mammals, including rodents and humans, acetate, a major component of volatile fatty acids, can contribute considerably as an energy source as a result of fermentation of dietary fibers (20).
Beyond this limited information, the molecular characterization of ACAS in mammals has not been well understood. Because ACAS produces acetyl-CoA, which is a key branching molecule for different metabolic pathways, it could play an important role in energy metabolism in mammals. In a search for new targets of SREBP-1, we cloned the murine ACAS cDNA and analyzed its gene promoter. Investigation of the tissue-specific expression profile and nutritional regulation demonstrated a new aspect of this gene as a lipogenic enzyme.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
Mice (C57BL/6NCrj) were obtained from Charles River Japan
(Yokohama, Japan). All animal experiments had been approved by a review
of the institutional board of animal welfare. Streptozotocin was
purchased from Sigma (St. Louis, MO). TRIzol reagent (GIBCO-BRL, Rockville, MD) was used to isolate total RNA.
[
-32P]dCTP and Hybond-N+ membrane were purchased from
Amersham Pharmacia Biotech (Uppsala, Sweden). The BcaBEST
Labeling Kit (TaKaRa Biomedicals, Kyoto, Japan) was used to label
radioactive probes. The BAS 2000 system (Fuji Photo Film, Tokyo, Japan)
was used to detect the signals of Northern and dot blot analysis. NIH
Image version 1.62 (free software distributed by the National
Institutes of Health, Bethesda, MD) was used to quantify intensity of
the detected bands.
cDNA cloning of the murine ACAS gene and its promoter region. Poly(A)+ RNA samples were isolated from livers of male SREBP-1a transgenic and male normal control mice (C57BL/6NCrj) of 8 wk of age and applied to Gene Expression Microarray serviced by Incyte Genomics (St. Louis, MO). A 514-bp expressed sequence tag (EST) (AA537637), which encoded a part of the murine ACAS cDNA, was located, and homologs and other searches were performed in the National Center for Biotechnology Information (NCBI) database to collect the related ESTs. 5'-Rapid amplification of cDNA ends (RACE) was performed by using the 5' RACE system version 2.0 (GIBCO-BRL) to extend a known sequence to get further upstream probes for more efficient screening of libraries. A probe was obtained by PCR with a forward primer, S39, GGACAAGGTGTTCGGAACTTG, and a reverse primer, AS209, ACAGAACGCCGGTGCAGCTC.
A liver cDNA library of SREBP-1a transgenic mice was prepared in the pCMV7 vector. The library was screened for full-length cDNA of ACAS using the probe just described. Obtained clones were sequenced three times by dye-terminator cycle sequencing using the Dye Primer Cycle Sequencing Kit (Perkin-Elmer, Wellesley, MA) and chemiluminescence sequencers (model 377, ABI 100, Perkin-Elmer) and were analyzed by ABI Prism software version 3.0 (Perkin-Elmer).Luciferase promoter assay of ACAS gene.
We obtained a clone containing the 5' flanking region of the ACAS gene
by screening the BAC library of mouse genomic DNA (Incyte Genomics). An
EcoRI fragment (a 7.8-kb fragment) containing the promoter
and 5'UTR of ACAS was subcloned into the pGEM3Zf vector (Promega,
Madison, WI), was designated as pGEM3/ACAS/BAC/EcoRI 5'
flanking region of the ACAS gene, and was sequenced. Three DNA
fragments (sizes from 676, 463, and 331 bp 5' upstream of the ACAS
coding region) of the ACAS gene promoter were obtained by PCR with
forward primers pS676, ACTAGCTAGC GGAAGGTTCA TATTGGGGAT CTGTGC; pS436,
ACTAGCTAGC GTAACCCAAC CCTTGTCACT CCAAG; and pS331, ACTAGCTAGC
GCCTCCTCGC CTGTCACCTC TG, and a 3' primer, pAS1, TCCGCTCGAG CGCATCAAGT
TCCGAACACC TTGTC. They were ligated into
XhoI-NheI sites of the pGL3-Basic vector
(Promega) and designated as pGL3-ACAS676, ACAS463, and ACAS331,
respectively. Transfection and luciferase assays were performed as
previously described (1) except that pRL-SV40 (Tokyo Ink,
Tokyo, Japan) was used as a reference plasmid instead of pSV
gal.
Either an expression plasmid of SREBP-1a, -1c, or -2, under the
regulation of the CMV early promoter (pCMV-SREBP-1a, -1c, -2) (0.2 µg) or an empty vehicle vector (pCMV7) (0.2 µg) as a control, was
cotransfected with the indicated luciferase construct and pRL-SV40 (0.2 µg) into HepG2 cells by using SuperFect reagent (Qiagen, Hilden,
Germany). The cells were incubated in DMEM with 10% FCS and
cholesterol (10 µg/ml) and 25-hydroxycholesterol (1 µg/ml) to
suppress endogenous SREBP activity. The Dual Luciferase System
(Picagene Dual Seapansy, Toyo Ink, Tokyo, Japan) was used to measure
firefly and seapansy luciferase activities with a luminometer, Lumat
LB9507 (Berthod, Berlin, Germany), according to the manufacturer's instruction.
Gel shift assay.
The DNA probe was prepared by annealing both strands of the SRE (see
Fig. 3) containing sequence of the mouse ACAS gene promoter, GGGCTACACCCCATCACTCCACGGGCC, and was labeled with
[
-32P]dCTP by the Klenow enzyme, followed by
purification on G50 Sephadex columns. The labeled DNA was incubated
with a recombinant SREBP-1 protein (100 ng) in a mixture containing 10 mM Tris · HCl, pH 7.6, 50 mM KCl, 0.05 mM EDTA, 2.5 mM
MgCl2, 8.5% glycerol, 1 mM dithiothreitol, 0.5 µg/ml
poly(dI-dC), 0.1% Triton X-100, and 1 mg/ml nonfat milk for 30 min on
ice. The DNA-protein complexes were resolved on a 4.6% polyacrylamide gel.
ACAS gene expression profile in various tissues. Tissue survey of murine and human ACAS mRNA levels was performed using Poly(A)+ RNA dot blots that were normalized by eight different housekeeping genes (RNA Master Blots and Human Multiple Tissue Expression Array; Clontech, Palo Alto, CA) according to the manufacturer's instructions. Probes used for murine and human blots were produced by PCR with a forward primer S39 and a reverse primer AS209 (for murine blots) and a forward primer, h3S, GACACTCTCGTGTGGGACAC, and a reverse primer, h2AS, CCTTGTTGTCTGTCCTGTGAGC (for human blots), respectively, which were set on the basis of reported ESTs (AW007194 and AW242634).
Animals and dietary manipulation.
Mice were housed in colony cages with a 12:12-h light-dark cycle and
were fed a regular chow diet until the dietary manipulations. C57BL/6
mice 8 wk of age were used for dietary and streptozotocin (STZ)
studies. Mice homozygous for the disrupted SREBP-1 gene allele B
(SREBP-1
/
) were handled as previously described
(24). Transgenic mice overexpressing human nuclear
SREBP-1a, -1c, and -2 in the liver have been previously described
(22). The fasting (24 h) and refeeding (12 h) protocol was
as previously described (24). To prepare diabetic mice,
STZ (100 mg/kg) or saline was administered by peritoneal injection of
8-wk-old C57BL/6 mice. Some of the diabetic mice received subcutaneous
insulin administration (100-400 U · kg
1 · day
1,
Novolet N, Novo Nordisk, Bagsvaerd, Denmark) for 7 days to
correct their blood glucose levels. The effect of acetate on the
hepatic ACAS gene was estimated by giving water containing
indicated concentrations of acetic acid for 24 h.
| |
RESULTS |
|---|
|
|
|---|
Cloning of mouse ACAS gene.
Results of the microarray analysis identified an EST clone, expression
of which was highly (10-fold) increased in the livers of transgenic
mice overexpressing nuclear SREBP-1a (22) compared with
that of wild-type mice. This clone (AA537637) had a high similarity to
bacterial ACAS. The increase of this gene transcript by SREBP-1a was
confirmed by Northern blot analysis of total RNA from livers of
SREBP-1a transgenic mice (Fig. 1). The
hepatic mRNA level of this gene was also elevated by SREBP-1c and
SREBP-2, demonstrating that any member of the SREBP family can induce
this gene. On the basis of the high similarity to bacterial homologs and the data we will present later, we assumed that this clone was a part of the murine ACAS gene. We cloned a whole ACAS cDNA by screening a mouse liver cDNA library using the 5' RACE method. The
murine cDNA sequence of ACAS open reading frame consisted of 2103 bp coding for 701 amino acids (Fig. 2).
The sequence is highly preserved among many species; i.e., 92%
homologous with human, 74% with Drosophila, 63% with
Caenorhabditis elegans, 58% with Saccharomyces
cerevisiae (yeast), and 64% with Escherichia coli at
the amino acid level. This cDNA was essentially identical to a clone
that was registered by P. S. Haghighi and co-workers in the
NCBI GenBank as a murine ACAS cDNA (AF216873). Very recently,
Luong et al. (19) reported the amino acid sequences of
human and murine ACAS and their regulation by SREBP and, furthermore, demonstrated that they have an ACAS activity when overexpressed in the
cultured cells.
|
|
Promoter analysis of the ACAS gene.
We obtained a clone containing the mouse ACAS gene from a mouse genomic
DNA BAC library. DNA sequencing of the 5' flanking region of the mouse
ACAS gene is shown in Fig. 3. We
identified a sequence (ATCACTCCAC at
350 bp) that is highly similar
to a classic SRE (ATCACCCCAC). The only mismatched base (6th T instead of C) was at the position of a residue that separates two direct repeats of PyCAC in the consensus and is not conserved among SREs in
different SREBP target genes. Downstream of this SRE, a binding site of
Sp1 (CCCCGCCCC), an essential cofactor required for activation by
SREBPs, was also found in an inverted orientation, which made this
region a highly probable binding site for SREBPs. Upstream of the SRE,
the computer-assisted search found two Nkx6.1 sites and two C/EBP
sites, suggesting that this gene could be expressed and participate in
energy metabolism in pancreatic
-cells.
|
|
|
|
ACAS gene expression profile in various tissues.
The tissue survey of human and mouse ACAS gene expression is shown in
Fig. 7, A and B,
respectively. In both species, ACAS was ubiquitously expressed in
almost every tissue tested. Particularly in mice, it was highly
expressed in kidney, liver, submaxillary gland, epididymus, and testis.
|
Effects of fasting and refeeding on ACAS expression in mice.
Recently, SREBP-1 has been reported to play a crucial role in hepatic
expression of lipogenic enzyme genes, especially in nutritional
regulation, as was observed in fasted and refed mice (24).
As shown by Northern blot analysis in Fig.
8, ACAS expression was significantly
downregulated in a fasted state and markedly upregulated by refeeding
in both liver and adipose tissue. This nutritional change is similar to
changes of other lipogenic enzymes that are controlled by SREBP-1
(24). This refeeding induction of the ACAS gene was nearly
abolished in the livers and adipose tissue of SREBP-1 knockout (KO)
mice (Fig. 8), indicating that lipogenic induction of the ACAS gene by
refeeding is controlled mainly by SREBP-1. At the same time, a slight
but significant increase in ACAS RNA was seen in the SREBP-1 KO mice as
well as wild-type mice, suggesting that other factors contribute to
expression to a lesser degree.
|
Effect of insulin-depleted diabetes on ACAS expression.
Because insulin has also been known to be important for lipogenic
enzyme expression, we estimated the effects of insulin depletion and
its supplementation on the hepatic mRNA level of ACAS. As shown in Fig.
9, STZ-induced diabetic mice showed
markedly decreased ACAS expression in the livers compared with normal
control mice, expression that was totally restored by insulin
administration.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
ACAS is a new member of the family of lipogenic enzymes. The current study clearly demonstrates that expression of the mouse acetyl-CoA synthetase gene is nutritionally regulated in the same fashion as all other known lipogenic enzymes. Hepatic/adipose ACAS expression was suppressed by fasting and highly induced by refeeding, which is a typical feeding response of lipogenic genes. It was also suppressed in a state of insulin depletion by administration with STZ and was restored by insulin supplement, also a well known response of lipogenic enzymes in a diabetic state. Therefore, nutritional regulation of ACAS followed a lipogenic pattern. This is not surprising, as ACAS is one of the enzymes responsible for the production of acetyl-CoA, an initial substrate for lipogenesis. In a nutritional state favorable for lipogenesis, acetyl-CoA is produced from glycolysis and transported from mitochondria to the cytosol through a sequence of steps. However, lipogenic induction of cytosolic ACAS suggests that direct production of acetyl-CoA from free acetate in the cytosol might play a role in lipogenesis. The relative contribution of this pathway to lipogenesis remains unknown, and it awaits gene KO mice of this gene to estimate this. This enzyme could be more important in ruminants in which glycolytic activity is low and acetate is a main source of energy.
The ACAS gene is a target of SREBPs. The expression of the EST clone from the ACAS gene was upregulated by SREBP-1a, which led us to clone this gene. Recently, we reported that SREBP-1c is a dominant factor for the expression of most lipogenic genes in the liver (24). Absence of hepatic/adipocytic induction of the ACAS gene in refed SREBP-1 KO mice in the current study supports the notion that ACAS is another target of SREBP-1 as a lipogenic enzyme. Upregulation of the ACAS gene by SREBPs has already been shown in the first report of this gene (19). The SRE sequence was found in the promoter region of the ACAS gene and was confirmed to be responsible for SREBP activation by promoter analysis. Luciferase assays showed that the ACAS promoter was activated by SREBP-1a, -1c, or -2, consistent with the observation that the ACAS mRNA was increased in livers from transgenic mice overexpressing any of the SREBPs. The relative activity of each SREBP isoform for the ACAS SRE as estimated by Northern blot analysis of transgenic livers (Fig. 1) was similar to that of classic SRE: SREBP-1a > SREBP-2 > SREBP-1c (21). This is presumably due to a high similarity between the SRE in the ACAS promoter and the classic SRE originally found in the low-density lipoprotein receptor promoter.
The current studies with STZ-induced diabetic mice demonstrated that insulin regulates ACAS gene expression. This is consistent with the previous report on changes in hepatic ACAS enzyme activity in STZ-induced rats (21). Because insulin is important for SREBP-1c expression, insulin-dependent ACAS expression can be explained at least partially by its activation of SREBP-1c.Physiological roles of ACAS gene in mammals. The decreased ACAS expression in the mouse liver by oral administration of acetate is implicative. The suppression of the enzyme expression by excess substrate is a good contrast to the regular mechanism of lipogenic enzyme regulation, in which conversion of excess energy to lipids is free from a negative feedback control. There may be a regulatory system for cytosolic production of acetyl-CoA by excess exogenous acetate. In addition, this gene is highly expressed in many other tissues, as well as in lipogenic organs. We also observed a considerable expression of this gene in cultured cells such as 293 cells (data not shown). The ACAS gene expression in the cultured cells is reported to be partially under sterol regulation, as predicted from the control by SREBPs (19). These observations suggest that ACAS might have some physiological roles other than in lipogenesis. From this standpoint, it is important to identify and clone a mitochondrial ACAS. This enzyme produces acetyl-CoA in mitochondria and would be involved in ketogenesis or ATP production in the tricarboxylic acid cycle and should be regulated in a different way from the cytosolic enzyme.
Crabtree et al. (6) have proposed futile cycling of acetate between free acetate and acetyl-CoA though cytoplasmic and mitochondrial pathways. One hypothesis of why such a pathway exists is to provide a means by which free acetate levels can be controlled (i.e., buffered). This hypothesis is attractive when one considers that ACAS is expressed in all tissues studied. There could be other functions for ACAS as well. Further studies are needed to clarify the physiological roles and regulation of both enzymes in cellular energy metabolism. In the current studies, we cloned and identified the murine ACAS gene as a target of SREBPs and a new member of the lipogenic enzyme family. Acetyl-CoA plays a pivotal role in cellular fuel metabolism. Further studies on ACAS might open up a new aspect of glucose and fatty acid metabolism and have therapeutic implications, because acetate is known to be a better fuel source than glucose, especially for individuals with impaired glucose tolerance and diabetes.| |
ACKNOWLEDGEMENTS |
|---|
We thank Hiroshi Kajikawa, PhD, Chief Researcher, Digestive Microbiology Laboratory of National Institute of Animal Industry (Tsukuba, Japan); Kenji Tayama, Ph.D., Manager, Central Research Institute, Mitsukan Group (Handa, Japan); and Hiromitsu Nakauchi, MD, PhD, Professor of Immunology, Institute of Basic Medicine, University of Tsukuba (Tsukuba, Japan) for fruitful discussion. We are also grateful to Alyssa H Hasty, Ph.D., Vanderbilt University Medical Center (Nashville, TN), for careful reading of the manuscript.
| |
FOOTNOTES |
|---|
This work is supported by the Promotion of Fundamental Studies in Health Science of the Organization for Pharmaceutical Safety and Research (OPSR), Health Sciences Research Grants (Research on Human Genome and Gene Therapy) from Ministry of Health and Welfare, and a research project grant of the University of Tsukuba. H. Sone is the recipient of a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (no. 12770632).
Address for reprint requests and other correspondence: H. Shimano, Dept. of Internal Medicine, Institute of Clinical Medicine, Univ. of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575, Japan (E-mail: hshimano{at}md.tsukuba.ac.jp).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 2 May 2001; accepted in final form 11 September 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Amemiya-Kudo, M,
Shimano H,
Yoshikawa T,
Yahagi N,
Hasty AH,
Okazaki H,
Tamura Y,
Shionoiri F,
Iizuka Y,
Ohashi K,
Osuga Ji Harada K,
Gotoda T,
Sato R,
Kimura S,
Ishibashi S,
and
Yamada N.
Promoter analysis of the mouse sterol regulatory element-binding protein (SREBP)-1c gene.
J Biol Chem
275:
31078-31085,
2000
2.
Briggs, MR,
Yokoyama C,
Wang X,
Brown MS,
and
Goldstein JL.
Nuclear protein that binds sterol regulatory element of low density lipoprotein receptor promoter. I. Identification of the protein and delineation of its target nucleotide sequence.
J Biol Chem
268:
14490-14496,
1993
3.
Brown, MS,
and
Goldstein JL.
The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor.
Cell
89:
331-340,
1997[Web of Science][Medline].
4.
Brown, MS,
and
Goldstein JL.
A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood.
Proc Natl Acad Sci USA
96:
11041-11048,
1999
5.
Brown, MS,
Ye J,
Rawson RB,
and
Goldstein JL.
Regulated intramembrane proteolysis: a control mechanism conserved from bacteria to humans.
Cell
100:
391-398,
2000[Web of Science][Medline].
6.
Crabtree, B,
Gordon MJ,
and
Christie SL.
Measurement of the rates of acetyl-CoA hydrolysis and synthesis from acetate in rat hepatocytes and the role of these fluxes in substrate cycling.
Biochem J
270:
219-225,
1990[Web of Science][Medline].
7.
Foretz, M,
Pacot C,
Dugail I,
Lemarchand P,
Guichard C,
Le Liepvre X,
Berthelier Lubrano C,
Spiegelman B,
Kim JB,
Ferre P,
and
Foufelle F.
ADD1/SREBP-1c is required in the activation of hepatic lipogenic gene expression by glucose.
Mol Cell Biol
19:
3760-3768,
1999
8.
Garre, V,
Murillo FJ,
and
Torres-Martinez S.
Isolation of the facA (acetyl-CoA synthetase) gene of Phycomyces blakesleeanus.
Mol Gen Genet
244:
278-286,
1994[Web of Science][Medline].
9.
Goodridge, AG.
Dietary regulation of gene expression: enzymes involved in carbohydrate and lipid metabolism.
Annu Rev Nutr
7:
157-185,
1987[Web of Science][Medline].
10.
Hasty, AH,
Shimano H,
Yahagi N,
Amemiya-Kudo M,
Perrey S,
Yoshikawa T,
Osuga Ji Okazaki H,
Tamura Y,
Iizuka Y,
Shionoiri F,
Ohashi K,
Harada K,
Gotoda T,
Nagai R,
Ishibashi S,
and
Yamada N.
Sterol regulatory element-binding-1 protein is regulated by glucose at the transcriptional level.
J Biol Chem
276:
37402-37408,
2000
11.
Hillgartner, FB,
Salati LM,
and
Goodridge AG.
Physiological and molecular mechanisms involved in nutritional regulation of fatty acid synthesis.
Physiol Rev
75:
47-76,
1995
12.
Horton, JD,
Bashmakov Y,
Shimomura I,
and
Shimano H.
Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice.
Proc Natl Acad Sci USA
95:
5987-5992,
1998
13.
Horton, JD,
Shimomura I,
Brown MS,
Hammer RE,
Goldstein JL,
and
Shimano H.
Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2.
J Clin Invest
101:
2331-2339,
1998[Web of Science][Medline].
14.
Hua, X,
Yokoyama C,
Wu J,
Briggs MR,
Brown MS,
Goldstein JL,
and
Wang X.
SREBP-2, a second basic-helix-loop-helix-leucine zipper protein that stimulates transcription by binding to a sterol regulatory element.
Proc Natl Acad Sci USA
90:
11603-11607,
1993
15.
Kim, HJ,
Takahashi M,
and
Ezaki O.
Fish oil feeding decreases mature sterol regulatory element-binding protein 1 (SREBP-1) by down-regulation of SREBP-1c mRNA in mouse liver. A possible mechanism for down-regulation of lipogenic enzyme mRNAs.
J Biol Chem
274:
25892-25898,
1999
16.
Kim, JB,
Spotts GD,
Halvorsen YD,
Shih HM,
Ellenberger T,
Towle HC,
and
Spiegelman BM.
Dual DNA binding specificity of ADD1/SREBP1 controlled by a single amino acid in the basic helix-loop-helix domain.
Mol Cell Biol
15:
2582-2588,
1995[Abstract].
17.
Knowles, SE,
Jarrett IG,
Filsell OH,
and
Ballard FJ.
Production and utilization of acetate in mammals.
Biochem J
142:
401-411,
1974[Web of Science][Medline].
18.
Koo, SH,
and
Towle HC.
Glucose regulation of mouse S14 gene expression in hepatocytes. Involvement of a novel transcription factor complex.
J Biol Chem
275:
5200-5207,
2000
19.
Luong, A,
Hannah V,
Brown M,
and
Goldstein J.
Molecular characterization of human acetyl-CoA synthetase, an enzyme regulated by sterol regulatory element-binding proteins.
J Biol Chem
275:
458-466,
2000.
20.
McNeil, NI.
The contribution of the large intestine to energy supplies in man.
Am J Clin Nutr
39:
338-342,
1984
21.
Murthy, VK,
and
Steiner G.
Hepatic acetate levels in relation to altered lipid metabolism.
Metabolism
22:
81-84,
1973[Web of Science][Medline].
22.
Shimano, H,
Horton JD,
Hammer RE,
Shimomura I,
Brown MS,
and
Goldstein JL.
Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a.
J Clin Invest
98:
1575-1584,
1996[Web of Science][Medline].
23.
Shimano, H,
Horton JD,
Shimomura I,
Hammer RE,
Brown MS,
and
Goldstein JL.
Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells.
J Clin Invest
99:
846-854,
1997[Web of Science][Medline].
24.
Shimano, H,
Yahagi N,
Amemiya Kudo M,
Hasty AH,
Osuga J,
Tamura Y,
Shionoiri F,
Iizuka Y,
Ohashi K,
Harada K,
Gotoda T,
Ishibashi S,
and
Yamada N.
Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes.
J Biol Chem
274:
35832-35839,
1999
25.
Thewke, DP,
Panini SR,
and
Sinensky M.
Oleate potentiates oxysterol inhibition of transcription from sterol regulatory element-1-regulated promoters and maturation of sterol regulatory element-binding proteins.
J Biol Chem
273:
21402-21407,
1998
26.
Tontonoz, P,
Kim JB,
Graves RA,
and
Spiegelman BM.
ADD1: a novel helix-loop-helix transcription factor associated with adipocyte determination and differentiation.
Mol Cell Biol
13:
4753-4759,
1993
27.
Van den Berg, MA,
de Jong Gubbels P,
Kortland CJ,
van Dijken JP,
Pronk JT,
and
Steensma HY.
The two acetyl-coenzyme A synthetases of Saccharomyces cerevisiae differ with respect to kinetic properties and transcriptional regulation.
J Biol Chem
271:
28953-28959,
1996
28.
Wang, X,
Briggs MR,
Hua X,
Yokoyama C,
Goldstein JL,
and
Brown MS.
Nuclear protein that binds sterol regulatory element of low density lipoprotein receptor promoter. II. Purification and characterization.
J Biol Chem
268:
14497-14504,
1993
29.
Worgall, TS,
Sturley SL,
Seo T,
Osborne TF,
and
Deckelbaum RJ.
Polyunsaturated fatty acids decrease expression of promoters with sterol regulatory elements by decreasing levels of mature sterol regulatory element-binding protein.
J Biol Chem
273:
25537-25540,
1998
30.
Yahagi, N,
Shimano H,
Hasty A,
Amemiya-Kudo M,
Okazaki H,
Tamura Y,
Iizuka Y,
Shionoiri F,
Ohashi K,
Osuga J,
Harada K,
Gotoda T,
Nagai R,
Ishibashi S,
and
Yamada N.
A crucial role of sterol regulatory element-binding protein-1 in the regulation of lipogenic gene expression by polyunsaturated fatty acids.
J Biol Chem
274:
35840-35844,
1999
31.
Yokoyama, C,
Wang X,
Briggs MR,
Admon A,
Wu J,
Hua X,
Goldstein JL,
and
Brown MS.
SREBP-1, a basic-helix-loop-helix-leucine zipper protein that controls transcription of the low density lipoprotein receptor gene.
Cell
75:
187-197,
1993[Web of Science][Medline].
This article has been cited by other articles:
![]() |
W. C. Hallows, S. Lee, and J. M. Denu Sirtuins deacetylate and activate mammalian acetyl-CoA synthetases PNAS, July 5, 2006; 103(27): 10230 - 10235. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Christian, E. Kiskinis, D. Debevec, G. Leonardsson, R. White, and M. G. Parker RIP140-Targeted Repression of Gene Expression in Adipocytes Mol. Cell. Biol., November 1, 2005; 25(21): 9383 - 9391. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gosmain, N. Dif, V. Berbe, E. Loizon, J. Rieusset, H. Vidal, and E. Lefai Regulation of SREBP-1 expression and transcriptional action on HKII and FAS genes during fasting and refeeding in rat tissues J. Lipid Res., April 1, 2005; 46(4): 697 - 705. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Wolfe The Acetate Switch Microbiol. Mol. Biol. Rev., March 1, 2005; 69(1): 12 - 50. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Lavrentyev, D. He, and G. A. Cook Expression of genes participating in regulation of fatty acid and glucose utilization and energy metabolism in developing rat hearts Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2035 - H2042. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Commerford, L. Peng, J. J. Dube, and R. M. O'Doherty In vivo regulation of SREBP-1c in skeletal muscle: effects of nutritional status, glucose, insulin, and leptin Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2004; 287(1): R218 - R227. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsuzaka, H. Shimano, N. Yahagi, M. Amemiya-Kudo, H. Okazaki, Y. Tamura, Y. Iizuka, K. Ohashi, S. Tomita, M. Sekiya, et al. Insulin-Independent Induction of Sterol Regulatory Element-Binding Protein-1c Expression in the Livers of Streptozotocin-Treated Mice Diabetes, March 1, 2004; 53(3): 560 - 569. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Piloquet, V. Ferchaud-Roucher, F. Duengler, Y. Zair, P. Maugere, and M. Krempf Insulin effects on acetate metabolism Am J Physiol Endocrinol Metab, September 1, 2003; 285(3): E561 - E565. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Vecchini, V. Ceccarelli, P. Orvietani, P. Caligiana, F. Susta, L. Binaglia, G. Nocentini, C. Riccardi, and P. Di Nardo Enhanced expression of hepatic lipogenic enzymes in an animal model of sedentariness J. Lipid Res., April 1, 2003; 44(4): 696 - 704. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |