AJP - Endo Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 281: E1286-E1299, 2001;
0193-1849/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernal-Mizrachi, E.
Right arrow Articles by Permutt, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernal-Mizrachi, E.
Right arrow Articles by Permutt, M. A.
Vol. 281, Issue 6, E1286-E1299, December 2001

Activation of Elk-1, an Ets transcription factor, by glucose and EGF treatment of insulinoma cells

Ernesto Bernal-Mizrachi1, Wu Wen1, Shanthi Srinivasan1, Alison Klenk1, David Cohen2, and M. Alan Permutt1

1 Division of Endocrinology, Diabetes, and Metabolism, Washington University School Of Medicine, St. Louis, Missouri 63110; and 2 Department of Cell and Developmental Biology, Oregon Health Services University, Portland, Oregon 97201


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Elk-1, a member of the ternary complex factor family of Ets domain proteins that bind serum response elements, is activated by phosphorylation in a cell-specific manner in response to growth factors and other agents. The purpose of the current study was to determine whether Elk-1 activation contributes to glucose-/depolarization-induced Ca2+-dependent induction of immediate early response genes in pancreatic islet beta -cells. The results of experiments in insulinoma (MIN6) cells demonstrated that Elk-1-binding sites (Ets elements) in the Egr-1 gene promoter contribute to transcriptional activation of the gene. Treatment with either epidermal growth factor (EGF), a known inducer of beta -cell hyperplasia, glucose, or KCl-induced depolarization resulted in Ser383 phosphorylation and transcriptional activation of Elk-1 (4 ± 0.3-, P = 0.003, 2.3 ± 0.19-, P = 0.002, and 2.2 ± 0.1- fold, P = 0.001 respectively). The depolarization response was inhibited by the Ca2+ channel blocker verapamil and by the MEK inhibitor PD98059 (53 ± 6 and 55 ± 0.5%, respectively). EGF-induced activation of Elk-1 was also inhibited by PD98059 (60 ± 5%). A dominant negative Ras produced partial inhibition (42%) of the depolarization-induced Elk-1 transcriptional activation. Transfection with a constitutively active Ca2+/calmodulin kinase IV plasmid also resulted in Elk-1 transcriptional activation. Experiments with p38, phosphatidylinositol 3-kinase, and protein kinase A inhibitors indicated that these pathways are not involved. We conclude that Elk-1 activation contributes to glucose-/depolarization-induced Ca2+-dependent induction of immediate early growth response genes in pancreatic islet beta -cells. Furthermore, the results demonstrated a convergence of nutrient- and growth factor-mediated signaling pathways on Elk-1 activation through induction of Ras/mitogen-activated protein kinase ERK-1 and -2. The role of these pathways in the glucose-induced proliferation of islet beta -cells can now be assessed.

depolarization; growth factors; Egr-1; epidermal growth factor


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

RECENT SUCCESS with human islet transplantation in diabetic patients underscores the need for adequate numbers of islet beta -cells for this therapy. A compensatory increase in pancreatic islet beta -cell mass occurs with insulin resistance states, yet the mechanisms involved in this response are little understood (14). Plasma glucose appears to be a major component in this response, as prolonged hyperglycemia in experimental animal models leads to increase in beta -cell mass (4). Glucose induces pleiotropic effects in islet beta -cells that are depolarization and Ca2+ dependent, and these effects are potentially mediated by activation of multiple intracellular signaling pathways. Depolarization-induced Ca2+ influx has been implicated in the activation of Ca2+/calmodulin (CaM) kinases II (CaMKII) and IV (CaMKIV), protein kinases A (PKA) and C (PKC), extracellular signal-regulated kinase (ERK)/mitogen-activated protein kinase (MAPK) (MEK) (16, 32), and phosphatidylinositol 3-kinase (PI 3-kinase) in islet beta -cells (16, 23, 27, 32). For glucose-induced depolarization and insulin-like growth factor (IGF) treatment of insulinoma cells, studies with pharmacological inhibitors have implicated the MAPK/ERK and PI 3-kinase pathways in proliferative responses (19). The relationships between these activated pathways, their downstream targets, and glucose-regulated growth responses have not been defined (35).

A prominent component of the cellular response to mitogenic stimuli is the rapid and transient transcriptional activation of a group of genes termed immediate early genes (IEGs) (38), most notably c-fos and Egr-1 (17). This rapid response of IEG transcription to mitogenic stimuli suggests that the products of these genes likely have a regulatory role in the cellular responses to growth factors (10). Like growth factors, glucose, peptide hormones (glucoincretins), and other nutrients have been shown to activate transcription of several IEGs including Egr-1 in insulinoma cell lines and pancreatic islets (22, 39). Egr-1 is a zinc-finger DNA-binding transcription factor that is expressed in multiple tissues and is induced by diverse stimuli, of which the best studied examples have been the treatment with peptide mitogens (7, 22, 25, 30). Recently, in an effort to define the signal transduction pathways involved in glucose regulation of Egr-1 transcription, we found that glucose-induced beta -cell depolarization triggers a cascade of events in which Ca2+ influx leads to the activation of PKA and CaM pathways (3). The initiation of these signaling pathways leads to activation of cAMP response element (CRE)-binding protein (CREB) and serum response factor (SRF), transcription factors involved in growth responses. The Egr-1 induction after depolarization was shown to result predominantly through serum response element (SRE)-dependent transcription. These studies defined a role of SRF activation as a mechanism for the glucose effect on pancreatic beta -cell gene expression.

SRF is a transcription factor early defined as being one of many that mediate mitogenic responses and regulate fibroblast proliferation in response to growth factors (42). Activated SRF by phosphorylation cascades induces transcription by binding to SREs and by recruiting ternary complex factors (TCFs). TCFs are members of the Ets family of transcription factors that are involved in the formation of the ternary complex with the SRF and SRE. Elk-1 is the most prominent member of the TCF family of transcription factors (33, 41). Whether Elk-1 activation contributes to SRE-dependent transcriptional responses appears to depend on the cell type and the stimulus (15).

In the present studies, we found that glucose-induced depolarization of pancreatic islet beta -cells triggers a cascade of events in which Ca2+ influx leads to Elk-1 activation through the Ras/MEK/ERK pathway. In addition, activation of the CaMKIV pathway also results in Elk-1-dependent transcription by an ERK-dependent mechanism. Epidermal growth factor (EGF) treatment, like depolarization, also results in Elk-1-dependent transcriptional activation by a similar pathway. These studies demonstrate convergence of depolarization- and growth factor-activated mitogenic responses on Elk-1 transcriptional activation in islet beta -cells.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Chemicals. Phorbol 12-myristate 13-acetate, KCl, verapamil, EGF, growth hormone, prolactin, and IGF-II were obtained from Sigma (St. Louis, MO). PD98059, H89, SB203580, and wortmannin were obtained from Biomol (Plymouth Meeting, PA).

Cell culture conditions. The MIN6 insulinoma cell line was obtained from Y. Oka (Yamaguchi University, Yamaguchi, Japan) (20) and was maintained in Dulbecco's modified Eagle's medium (DMEM) as previously described (3). All of the experiments were performed in cells between passages 20 and 30.

Plasmids. Plasmids containing the murine Egr-1 promoter linked to the luciferase vector pXP2 constructs have been described in detail previously (9). The cis-reporter plasmid 5XSRF+Ets-Luc contains the luciferase reporter gene driven by a basic promoter element (TATA box) joined to five tandem repeats of the c-fos SRE containing the SRF and Ets-binding elements (Stratagene). The cis-reporter plasmid 5XSRF-Luc contains the luciferase reporter gene driven by a basic promoter element (TATA box) joined to five tandem repeats of the c-fos SRF and lacking the Ets-binding elements (Stratagene). The Elk-GAL4 luciferase system includes a trans-activator plasmid that expresses a fusion protein containing the activator domain of Elk-1 fused to the DNA-binding domain of GAL4 (residues 1-147; Stratagene) and was cotransfected with a reporter gene containing a synthetic promoter with five tandem repeats of the yeast GAL4-binding sites that control expression of the luciferase gene pRC-Luc (Stratagene). The constitutively active forms of CaMKIV (CaMKIVCT) and CaMKII (CaMKIIgamma BC) and the dominant negative forms of CaMKIV (CaMKIVK75E) and CaMKII (CaMKIIgamma BI) were gifts from Dr. T. Chatila (Washington University, St. Louis, MO) and have been described previously (31). The plasmid containing the catalytic unit of PKA (pFC-PKA) was purchased from Stratagene. The plasmids pZIP-ras Ras wild-type (WT) and pZIP-ras 15A (Ras 15A) and the vector pZIP-NeoSV were provided by Dr. C. Der (University of North Carolina) (6, 11). The plasmids encoding the MAP kinase phosphatase 1 (MKP-1) and Elk-1 (CMV-Elk-1) were kindly provided by Dr. J. Pessin (University of Iowa) and Dr. J. Schwartz (University of Michigan) (26). The pRL-TK control vector contains the herpes simplex virus thymidine kinase promoter upstream of Renilla luciferase (Promega).

Transient transfections. MIN6 cells were transfected by lipofectamine and Plus Reagent (GIBCO-BRL) by using the suggested amounts of DNA according to the manufacturer's protocol. Briefly, 1 × 105 cells were plated in 12-well plates 3 days before transfection. Cells at ~60% confluence were transfected by mixing the indicated amount of DNA described in the figure legends and a lipid mixture containing a 1:2 ratio of lipofectamine and Plus Reagent in 1 ml of OPTI-MEM media (GIBCO-BRL). Afer 3 h of incubation, 0.5 ml of DMEM media containing 5 mM glucose and 2% serum was added to the cells. After 12 h, the medium-DNA complexes were replaced by preincubation media containing DMEM with 5 mM glucose and 2% FBS, and the cells were left for 24 h. At the end of the 24 h, the specific stimulating agent was added to the media, and the cells were harvested 6 h later. For the overexpression experiments with pFC-PKA, CaMKIVCT, CaMKIIgamma BC, MEK, and MEKK, MIN6 cells were transfected as described, followed by incubation in DMEM containing 5 mM glucose and 2% FBS for 30 h until harvesting. For the experiments that include the dominant negative forms of CaMKII and IV, and pZIP-ras (WT), pZIP-ras (15A), MIN6 cells were cultured as described, but the last 6 h of the experiment were in the presence of the stimulating agent. Total DNA was maintained constant in all of the transfection experiments by using the empty vector of the respective cDNA to be overexpressed. To correct for differences in transfection efficiencies, 2 ng of pRL-TK Renilla luciferase plasmid were simultaneously transfected. All results are normalized for transfection efficiency and expressed as the ratio of firefly to Renilla luciferase.

Electrophoretic mobility shift assay. The sense strand sequences of the oligonucleotides used were
<IT>c-fos</IT> SRE GGATGTCCATATTAGGACATCTGC

<IT>c−fos</IT> mutSRE ACAGGATGTCCATATTA<UNL><B>T</B></UNL>GACATCTGC

E74 GATCTCTAGCTGAATAACCGGAAGTAACTCATCCTTG
Nuclear extracts from MIN6 cells cultured under regular DMEM containing 25 mM glucose were prepared essentially as described previously (12), and protein content was determined using the Bio-Rad protein assay kit with bovine serum albumin as a standard. Lysates (5 µg of protein) were incubated in a final volume of 20 µl containing binding buffer (final concentrations: 4% glycerol, 1 mM MgCl2, 0.5 mM dithiothreitol, 50 mM NaCl, 10 mM Tris · HCl, pH7.5), 200 ng poly(dI-dC), and double-stranded gamma -32P-labeled oligonucleotide. Binding reactions proceeded at room temperature for 30 min and were analyzed by nondenaturing polyacrylamide electrophoresis followed by autoradiography. In assays where antibodies directed against SRF (1:10) (Santa Cruz Biotechnology, Santa Cruz, CA), phosphoElk-1 and Elk-1 (1:10) (New England Biolabs) were tested, these were preincubated with the nuclear extracts for 20 min at room temperature.

Luciferase assay. Cell lysis was performed using 200 µl of passive lysis buffer (Promega). Firefly and Renilla luciferase were measured by the Dual-Luciferase Reporter Assay System (Promega) with the use of 20 µl of cell lysate. Luciferase activity was measured in a Monolight 3010 luminometer.

Immunoblotting. MIN6 cells were plated in six-well plates and transfected by lipofectamine and Plus Reagent (GIBCO-BRL) with 1 µg of CMV-Elk-1 as described. Thirty-six hours later, cells were preincubated in Krebs-Ringer bicarbonate-HEPES buffer (KRBH) and 2% albumin for 1 h followed by stimulation with the indicated agents. Cells were lysed with buffer containing 1× PBS, 0.1% SDS, 0.01 M dithiothreitol, and one-half of a tablet of "Complete" protease inhibitor cocktail (Boehringer Mannheim). After boiling, proteins were separated by electrophoresis through 10% polyacrylamide, 0.1% SDS gels and transferred to polyvinylidene difluoride membranes. Membranes were incubated overnight at room temperature in blocking buffer containing 0.2% I-Block (Tropix) and 1:1,000 Tween 20. Subsequently, the membranes were hybridized at 4°C overnight in blocking buffer containing the Elk-1 and the phospho-Elk-1 antibody with the dilutions recommended by the manufacturer (New England Biolabs). After three washes at room temperature, the membranes were incubated in secondary horseradish peroxidase antibody for 1 h. After a 1-h washing, immunodetection was performed with an ECL Western blotting detection system (Amersham) following the manufacturer's protocol.

Kinase assay. MAPK assays were performed using the P44/42 MAP Kinase Assay Kit (Cell Signaling Technology) according to the manufacturer's protocol. MIN6 cells were precultured in KRBH-2% albumin and stimulated as indicated in the figure legends. Briefly, cell lysates were immunoprecipitated overnight at 4°C with an anti-phospho-p44/42 MAPK (Thr202 and Tyr204) antibody. The resulting immunoprecipitate was then incubated with an Elk-1 fusion protein in the presence of 200 µM ATP and kinase buffer for 30 min. Proteins were separated through 10% SDS-PAGE and transferred to nitrocellulose membranes. ERK activity was measured by phosphorylation of Elk-1 at Ser383 in Western blotting by use of a phospho-Elk-1 (Ser383) antibody. The total Elk-1 level was assessed by blotting the same membranes with Elk-1 antibody (Santa Cruz, CA).

Statistical analysis. Triplicate samples were analyzed for each experiment, and experiments were replicated to ensure consistency of the responses. Significant differences between control and the indicated treatments were determined using unpaired Student's t-test.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Ets elements are necessary for depolarization induction of SRE-dependent transcription in MIN6 insulinoma cell lines. Previous studies showed that the proximal 530 bp of the Egr-1 promoter, containing five SREs, are sufficient for depolarization activation of the promoter (3). The purpose of the present studies was to determine the role of Ets-dependent transcription in this process. SREs are comprised of SRF-binding sites and adjacent Ets motifs (GGA) that have been implicated in mediating a component of their enhancer activity in other cells (41). To define a minimal promoter suitable to investigate the contribution of the Ets elements in depolarization induction of Egr-1 in pancreatic beta -cells, several deleted constructs of the Egr-1 promoter were assessed. As shown in Fig. 1A, although the 1.2-kb promoter was induced ninefold (P < 0.003), deletion of the two activating protein 1 (AP-1) elements, the two proximal SRE/Ets elements, and the CRE (construct C) still retained sixfold induction (P = 0.03) by depolarization. This suggested that the distal cluster of SRE/Ets elements in construct C could be used to refine the contribution of these binding sites in the depolarization response. Parenthetically, basal activity for construct C was increased relative to the full promoter construct A, suggesting perhaps the presence of inhibitory elements in the proximal promoter.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.   Ets elements are important for depolarization induction of serum response element (SRE)-dependent transcription in MIN6 insulinoma cells. CRE, cAMP response element; AP-1, activating protein 1. A: depolarization effects on Egr-1 promoter activity. Egr-1 luciferase promoter 5'-deletion plasmids were transiently transfected as described in EXPERIMENTAL PROCEDURES with 0.2 µg of the indicated constructs. To control for transfection efficiency, 2 ng of the pRL-TK luciferase construct were used. After 24-h preincubation in regular media containing 5 mM glucose and 2% serum, cells were continued in preincubation media containing 5 mM glucose (control) or were stimulated with 45 mM KCl for 6 h. Values are expressed as the ratio of firefly to Renilla luciferase. Basal promoter activity for constructs A, B, C, and D was 1.45, 0.07, 11.7, and 0.28 arbitrary units, respectively. B: effects of KCl-induced depolarization on Egr-1 promoter deletion constructs containing sequences in the vicinity of SRE-3 and -4 as shown schematically in the inset. MIN6 cells were transfected with 0.2 µg of the indicated deletion mutants lacking one (B and C) or both (D) of the 5'- and 3'-cluster of Ets motifs (filled ovals); all were subcloned upstream of the minimal Egr-1 promoter (plasmid D in A). Cells were cultured as described in A and stimulated with 45 mM KCl. Basal activity for constructs A, B, C, and D were 11.3, 11.4, 7.2, and 2.7 arbitrary units, respectively. C: depolarization induction of c-fos SRE deletion constructs. As shown in the diagram the plasmid 5XSRF+Ets-Luc contains 5 tandem repeats of both the Ets- and the SRF-binding sites. The plasmid SRF-Luc is the same but lacks the Ets-binding sites. MIN6 cells were transiently transfected with the indicated constructs and preincubated as described in A and B followed by treatment with 45 mM KCl and 100 ng/ml epidermal growth factor (EGF). Results are shown as means ± SE of 3 independent experiments done in triplicate; *P < 0.04, **P < 0.01, ***P < 0.001.

Examination of the promoter sequence encompassing SREs 3-5 (construct C) revealed a cluster of three Ets motifs (GGA) within 30 bp upstream of SRE-4 and a cluster of two GGA motifs 40 bp downstream of SRE-3, schematically represented in Fig. 1B. To determine the contribution of these Ets elements in the depolarization response of Egr-1 in pancreatic beta -cells, multiple deletion constructs were tested (Fig. 1B). Depolarization induction of MIN6 cells transfected with a plasmid containing the SREs in conjunction with both clusters of Ets motifs (plasmid A) resulted in a fivefold activation (P = 0.0004). Deletion of the 3' Ets motif (plasmid B) resulted in a 3.3-fold induction (P = 0.0002), although this response was decreased (42%) relative to construct A (P = 0.003). The plasmids containing a deletion of the 5' Ets cluster (plasmid C) had a minimal response to depolarization (1.6-fold, P = 0.01), and this response was similar to that of the plasmid containing no Ets elements (plasmid D, 1.6-fold, P = 0.006). The results in Fig. 1, A and B, suggested that the SRE along with the Ets elements is sufficient to mediate depolarization induction of Egr-1 transcription and that the Ets elements are important components of this response.

To further determine the role of Ets elements in depolarization-induced, SRE-dependent transcription, MIN6 cells were transfected with a plasmid that contains five tandem SRE repeats (plasmid 5XSRF+Ets-Luc). Each repeat contains both the c-fos SRF and Ets-binding sites linked to a minimal promoter (Fig. 1C, inset). This plasmid was induced by depolarization (3.6-fold, P = 0.006) and by EGF (2-fold, P = 0.04), a growth factor known to activate SRE-dependent trascription and be involved in beta -cell hyperplasia (24, 29). Deletion of the Ets element (5XSRF-Luc) resulted in a lack of response to either stimulus. These results further highlight the importance of the Ets elements in transcriptional regulation by depolarization in pancreatic beta -cells.

Nuclear extracts from MIN6 cells exhibit Elk-1-binding to Ets motifs. The SRE is continuously occupied in vivo by SRF and Ets proteins of the ternary complex subfamily (15, 36, 40). In most cell types examined, formation of this complex is constitutive rather than inducible (15, 48). Previous studies have shown that the sequence encompassing SRE-3 to -5 in the Egr-1 promoter can interact with SRF and Elk-1 proteins at the SRF and Ets-binding domains, respectively (43, 44). Furthermore, Elk-1 in combination with SRF participates in the initiation of Egr-1 gene transcription under other experimental conditions (41). To determine whether Elk-1-binding activity in MIN6 cells is involved in SRE-dependent transcription by depolarization, nuclear extracts from MIN6 cells were incubated with a c-fos SRE. This SRE was chosen as consensus sequence on the basis of initial gelshift experiments with a probe containing the c-fos SRE and unlabeled Egr-1 SRE-1, -2, -3, -4, and -5. Binding of nuclear protein was competed for by each of the five Egr-1 SREs (data not shown). As observed in other systems, two DNA:protein complexes were observed (Fig. 2A). They included one slower migrating band (band A) and a diffuse faster migrating complex (band B) containing four bands (lane 1). Band A migrated similarly to bands identified by others as the ternary complex composed of the SRE, SRF, and Elk-1 or another TCF (18, 26, 37, 41). The identity of complex B is not known, and the intensity varies with cell type (26). To ensure that some of these complexes contained an Ets family member, competitions with an unlabeled oligonucleotide containing the Drosophila E74A-binding site was performed (34). This site has been shown to bind Elk-1 and compete for TCF binding, thereby inhibiting TCF at the c-fos SRE (21, 28). Bands A and B did not disappear when a nonspecific cold competitor in 5-, 25-, and 50-fold molar excess was used (lanes 2-4). In contrast, complexes A and B were progressively competed for by addition of unlabeled E74A oligonucleotide (lanes 5-7). These results suggested that band A is due to binding of SRF and an Ets family member. The disappearance of some of the components of band B suggested that some of these bands most likely contain homo- or heterodimers of Ets family members. Multiple DNA-protein complexes have also been observed when recombinant Elk-1 was incubated with E74 oligonucleotide (34). To recognize the identity of the proteins present in the SRE complex (bands A and B), nuclear extracts from MIN6 cells were preincubated with anti-SRF and anti-Elk-1 antibody (alpha SRF and alpha Elk-1, respectively). Addition of alpha SRF to nuclear extracts resulted in disappearance of band A and appearance of a more slowly migrating band C (Fig. 2B, lane 2). The presence of alpha Elk-1 reduced complex A by 80% as assessed by densitometric analysis (n = 3; Fig. 2B, lane 3), suggesting that Elk-1 is part of the SRE complex. Incubation of the nuclear extracts with a nonspecific antibody (anti-CREB) did not disrupt the protein complex (data not shown). Disruption by alpha Elk-1 of the protein complexes containing Elk-1 has been observed in other systems (1, 8). When nuclear extracts were incubated with an oligonucleotide containing the c-fos SRE with mutated SRF-binding site, no supershift was obtained with alpha SRF antibody, and a similar decrease in intensity of the bands was observed with the alpha Elk-1 antibody (data not shown). These findings suggest that Elk-1 and the SRF are part of the ternary complex in MIN6 cells.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2.   Elk-1 and serum response factor (SRF) bind the SREs. A: nuclear extracts from MIN6 cells cultured in 25 mM glucose were used in electrophoretic motility shift assays (EMSAs) with a probe containing the c-fos SRE sequence (lane 1). The individual bands representing SRE-binding complexes are labeled A and B. Unlabeled nonspecific competitor nucleotide was either not added (lane 1) or added at 5-, 25-, or 50-fold molar excess as indicated (lanes 2, 3, 4, respectively). Competition with an unlabeled oligonucleotide with sequences shown to compete for ternary complex factor (TCF) binding containing the Drosophila E74A-binding site (see EXPERIMENTAL PROCEDURES) (21) at 5-, 25-, or 50-fold molar excess is shown in lanes 5, 6, and 7. B: nuclear extracts from MIN6 cells cultured in 25 mM glucose were used in EMSAs with a probe containing the c-fos SRE sequence (lane 1). Preincubation of nuclear extracts from MIN6 cells with antibodies against SRF (lane 2) or Elk-1 (lane 3) were used.

Depolarization and growth factors induce phosphorylation of Elk-1 in pancreatic beta -cells. In other cells, it has been shown that EGF can regulate Elk-1 transcriptional activity by inducing phosphorylation of Ser383 (33). Having shown that depolarization activates Egr-1 transcription via SRE/Ets-dependent interaction and that Elk-1 and SRF are part of the ternary complex in MIN6 cells, we next sought to determine whether Elk-1 is phosphorylated on Ser383 in MIN6 cells after depolarization. Cells were transfected with a plasmid encoding Elk-1 and then subjected to Western blotting with the use of anti-phospho-Ser383 antibodies. Although the effects on phosphorylation of endogenous Elk-1 to depolarization and EGF could be observed, the signals with transfected Elk-1 were more readily evaluated. As shown in Fig. 3A, a rapid Ser383 phosphorylation of Elk-1 by glucose was observed as early as 5 min, which appeared to be diminishing by 30 min. The total amount of Elk-1 protein did not differ with either of the agents tested, as indicated by use of an antibody to nonphosphorylated Elk-1. KCl-induced depolarization resulted in a similar time course of Elk-1 phosphorylation (Fig. 3B).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3.   Glucose and KCl induce Elk-1 phosphorylation at Ser383. A: MIN6 cells were transfected with an expression plasmid encoding Elk-1 and 36 h later incubated in Krebs-Ringer bicarbonate-HEPES (KRBH)-2% albumin for 1 h followed by incubation with 25 mM glucose for the indicated time points. Protein was subjected to Western blot analysis using anti-phospho-Elk-1 (P-Elk) and anti-Elk-1 antibodies (Elk). B: MIN6 cells were transfected with an Elk-1 expression plasmid and precultured as described in A. Western blotting was performed at the indicated times after stimulation with 45 mM KCl. C: effects of mannitol, tolbutamide, and EGF treatment on Elk-1 phosphorylation. MIN6 cells were transfected with an expression plasmid encoding Elk-1 and 36 h later were incubated in KRBH-2% albumin for 1 h followed by incubation with 50 mM mannitol, 100 µM tolbutamide, or 100 ng/ml EGF for 15 min. Protein was subjected to Western blotting with a P-Elk-1 or Elk-1 antibody as described in EXPERIMENTAL PROCEDURES. Results are representative of 2 different experiments done in duplicate.

Activation of phosphorylation of Elk-1 by glucose and KCl at millimolar concentrations could result from osmotic changes. As shown in Fig. 3C, treatment with mannitol (50 mM) failed to result in Elk-1 phosphorylation, as did 3-O-methylglucose (25 mM), a nonmetabolizable glucose analog (data not shown). In contrast, mannose, a metabolizable glucose analog, did activate Elk-1 phosphorylation (data not shown), as did treatment with the depolarizing agent tolbutamide (100 µM). Diazoxide, an islet ATP-activated potassium (KATP) channel activator, blocked Elk-1 phosphorylation by 25 mM glucose (data not shown), further substantiating that glucose metabolism followed by inhibition of KATP channels and subsequent depolarization are required. Similarly, treatment with the growth factor EGF (100 ng/ml) also resulted in rapid (15 min) Elk-1 phosphorylation to the same extent as tolbutamide.

Depolarization induces Ca2+-dependent transcriptional activation of Elk-1. To determine whether depolarization-induced Ser383 phosphorylation of Elk-1 is associated with transcriptional activation, a transactivator plasmid Elk1-GAL4 encoding a fusion protein containing Elk-1 transactivation domain (amino acids 307-427) ligated downstream of the sequence encoding the GAL4 DNA-binding and dimerization domain was used. The Elk1-GAL4 plasmid was cotransfected with a reporter gene containing a synthetic promoter with five tandem repeats of the yeast GAL4-binding site upstream of the luciferase gene. As shown in Fig. 4A, KCl-induced depolarization activated Elk-1-dependent transcription in a dose-dependent manner. Addition of 25 mM glucose to cells preincubated with 2 mM glucose, a treatment previously shown to result in depolarization-dependent induction of Egr-1 transcription (17), also induced Elk-1-dependent transcriptional activation 2.3-fold (P = 0.002, Fig. 4B). Stimulation with EGF (100 ng/ml) resulted in similar transcriptional activation of Elk-1. The results of these experiments indicated that both a nutrient and a growth factor could lead to transcriptional activation of Elk-1.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Transcriptional activation of Elk-1 by depolarization and growth factors in beta -cells. A: dose-dependent activation by KCl of Elk-1-dependent transcription. Elk-1 transcriptional activation was assessed using the GAL4-Elk-1 luciferase expression system. MIN6 insulinoma cells were transfected with 0.1 ng of Elk-1-GAL4 and 0.25 µg of a reporter plasmid pFR-LUC, as described in EXPERIMENTAL PROCEDURES. After culturing in regular media containing 5 mM glucose and 2% FCS for 24 h, the cells were continued in the same media (control) or stimulated for 6 h with the indicated concentrations of KCl. B: glucose and growth factors induce Elk-1-dependent transcription. MIN6 cells were transfected with 0.1 ng of Elk-1-GAL4 and 0.25 µg of pFR-Luc and preincubated as described in A, followed by stimulation with 25 mM glucose or 100 ng/ml EGF. C: depolarization induction of Elk-1 is Ca2+ dependent. MIN6 cells were transfected with the same concentration of plasmids described in A and B and preincubated as described in EXPERIMENTAL PROCEDURES. Before stimulation with 45 mM KCl, MIN6 cells were exposed to the indicated concentrations of verapamil for 30 min where indicated. To control for transfection efficiency, 2 ng of pRL-TK luciferase construct were used. Data are expressed as means + SE of the fold induction over the luciferase activity at 5 mM glucose. Results are representative of 3 independent experiments done in triplicate; *P < 0.01, **P < 0.001.

To evaluate whether the effects of KCl were dependent on extracellular Ca2+ influx, the L-type calcium channel inhibitor verapamil was used. As shown in Fig. 4C, depolarization-induced Elk-1 transcriptional activation by KCl (4-fold, P = 0.01) was inhibited 88% (P < 0.001) by the addition of verapamil at 10 µM and by 100% at 40 µM. No Elk-1 transcriptional activation was observed when verapamil was used alone. These results suggest that depolarization activation of Elk-1 depends exclusively on Ca2+ influx from the extracellular compartment.

Elk-1 transcriptional activation is mediated by Ca2+-activated Ras/MAPK signaling. Calcium regulation of gene transcription in various cell types involves multiple signaling pathways (15). These include the Ser/Thr kinases PKA, MAPK, and CaMKs. As shown in Fig. 5A, the PKA inhibitor H89 (10 µM) did not inhibit KCl-induced Elk-1-mediated transcriptional activation. Consistent with this result, no response was observed when a plasmid encoding the catalytic unit of PKA was cotransfected. Evidence of the biological activity of this plasmid was previously demonstrated in a CREB-GAL4 transactivation assay (3).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Depolarization-induced Elk-1 mediated transcription is not PKA dependent and is mediated By Ca2+-activated Ras signaling. A: MIN6 insulinoma cells were transfected with 0.1 ng of Elk-1-GAL4 and 0.25 µg of a reporter plasmid pFR-Luc, as described in EXPERIMENTAL PROCEDURES. After culturing in regular media containing 5 mM glucose and 2% FBS for 24 h, the cells were continued in the same media or stimulated for 6 h with 45 mM KCl either alone or in the presence of H89. The protein kinase A (PKA) inhibitor H89 was added to the culture media to a final concentration of 15 µM 1 h before stimulation. Data are expressed as means + SE of the fold induction over the luciferase activity at 5 mM glucose. Constitutively active PKA (PKA; 50 ng) was cotransfected where indicated. Data are expressed as means + SE of the fold induction over the luciferase activity at 5 mM glucose. To control for transfection efficiency, 2 ng of pRL-TK luciferase construct were used in all experiments. B: effects of Ras in Elk-1-dependent transcription. MIN6 insulinoma cells were transfected as described in A. After culturing in regular media containing 5 mM glucose and 2% FBS for 24 h, the cells were continued in the same media or stimulated for 6 h with 45 mM KCl. Cells were cotransfected with wild-type Ras (Ras WT; 3 µg) or empty vector (vector) where indicated. To control for transfection efficiency, 2 ng of pRL-TK luciferase construct were used. Data are expressed as means + SE of the fold induction over the luciferase activity at 5 mM glucose. C: MIN6 cells were transfected with Elk-1 and pFR-Luc with the same concentrations described above. Cotransfection with dominant negative Ras (Ras 15A) (1 or 3 µg) and the corresponding amount of empty vector to maintain a constant DNA concentration was performed. Cells were precultured and induced with 45 mM KCl as described in A. Data are expressed as means + SE of the percent of KCl induction. Results are representative of 3 independent experiments done in triplicate; *P < 0.04, **P < 0.01, ***P < 0.001.

To determine whether MAP kinase activation through Ras signaling is a component of Elk-1 transcriptional activation, plasmids encoding either a wild-type (Ras WT) or a dominant negative form (Ras 15A) were tested. As shown in Fig. 5B, KCl-induced depolarization of MIN6 cells transfected with empty vector resulted in a 4.5-fold increase (P < 0.01). Transfection with Ras WT resulted in a 6-fold (P < 0.05) induction of Elk-1 transcriptional activation, and this response was augmented (14-fold, P = 0.01) by KCl-induced depolarization. To assess the role of endogenous Ras in the depolarization activation of Elk-1, cells were cotransfected with a dominant negative Ras (Ras 15A) under conditions similar to those that others have shown to be effective in inhibiting Ras signaling (6) (Fig. 5C). A partial dose-dependent inhibition was observed to 86 (P = 0.006) and 58% (P < 0.001) of control. Failure to observe complete inhibition in depolarization induction of Elk-1 transcriptional activation by inhibition of Ras signaling suggested that perhaps other Ca2+-activated pathways are involved (see below). This idea was also supported by the augmentation by KCl treatment of Elk-1 transcriptional activity in Ras WT-transfected cells (Fig. 5B).

Previous studies have shown that glucose and Ca2+ influx induces MAPK activation (16, 23, 32). To determine whether Elk-1 phosphorylation induced by glucose and KCl is mediated by ERK-1/2 activation, the specific MEK inhibitor PD98059 was used. Both glucose- and KCl-induced depolarization resulted in Elk-1 phosphorylation on Ser383 that was abolished by PD98059 (Fig. 6A), suggesting that this pathway is a major mediator in this response. Although PI 3-kinase activation has been implicated in beta -cell proliferation induced by IGF and glucose (19), the presence of the PI 3-kinase inhibitor wortmannin did not result in altered glucose activation of Elk-1 Ser383 phosphorylation (Fig. 6A). By use of the Elk-1 transactivation assays, both KCl and EGF activation were also shown to be blocked by treatment with the specific MEK inhibitor PD98059, as shown in Fig. 6B.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 6.   Depolarization and EGF signaling have common transduction pathways involving extracellular signal-regulated kinase (ERK) activation. A: Elk-1 phosphorylation is mediated by the ERK pathway. MIN6 cells were transfected with an expression plasmid encoding Elk-1 as described in EXPERIMENTAL PROCEDURES. Thirty-six hours later, cells were incubated in KRBH-2% albumin for 1 h followed by stimulation for 15 min with glucose (25 mM) and KCl (45 mM) in the presence or absence of the MEK (PD98059 50 µM) and phosphatidylinositol (PI) 3-kinase (wortmannin 100 µM) inhibitors as indicated in the figure. The MEK and PI 3-kinase inhibitors were added to the media 30 min before stimulation with glucose and KCl. Protein was subjected to Western blotting with a phospho-Elk-1 (P-Elk-1) and Elk-1 antibodies as described. Results are representative of 2 independent experiments done in duplicate. B: Elk-1 transcriptional activation by depolarization and EGF is inhibited by MEK inhibition. Elk-1 transcriptional activation was assessed using the GAL4-Elk-1 luciferase expression system. MIN6 insulinoma cells were transfected with 0.1 ng of Elk-1-GAL4 and 0.25 µg of a reporter plasmid pFR-Luc, as described in EXPERIMENTAL PROCEDURES. After culturing in regular media containing 5 mM glucose and 2% FBS for 24 h, the cells were continued in the same media or stimulated for 6 h with KCl (45 mM) and EGF (100 ng/ml) in the presence or absence of the MEK (PD98059, 50 µM) and p38 (SB203580, 5 µM) inhibitors. The MEK and p38 inhibitors were added to the media 1 h before stimulation with KCl or EGF. To control for transfection efficiency, 2 ng of pRL-TK luciferase construct were used. Data are expressed as means + SE of the fold induction over the luciferase activity at 5 mM glucose. Results are representative of 3 independent experiments done in triplicate; **P < 0.01, ***P < 0.001. C: measurement of Erk activity after glucose and KCl treatment. Cells were preincubated for 1 h in KRBH-2% albumin followed by stimulation with 25 mM glucose and 45 mM KCl for the indicated time points. Cell lysates were immunoprecipitated with anti-phospho-ERK-1 and -2 specific antibodies. ERK activity was measured by incubation of the immunoprecipitate with recombinant Elk-1, followed by immunoblotting using an anti Ser383 phospho-Elk-1 antibody as described in EXPERIMENTAL PROCEDURES. Results are representative of 2 independent experiments performed in duplicate.

Although ERK-1 and -2 appear to be the major Elk-1 kinases regulated by growth factors in noninsulinoma cells, c-Jun-NH2-terminal kinase (JNK) and p38 kinases are also capable of activating Elk-1 in response to cellular stresses and cytokines (5, 45-47). The related MAPK family members JNK/stress-activated protein kinases are insensitive to glucose and Ca2+ influx in insulinoma cells (23). In contrast, the p38 MAPK has been shown to be activated by glucose and to be involved in IUF1-dependent gene transcription in MIN6 insulinoma cells (23, 27). To determine the possible contribution of p38 kinase in depolarization activation of Elk-1-dependent transcription, MIN6 cells transfected with the Gal-Elk-1/Gal-luciferase expression-reporter system were evaluated in the presence of the specific p38 inhibitor SB203580. The p38 inhibitor failed to reduce depolarization-induced transcriptional activation of Elk-1 compared with cells treated with the inhibitor alone (Fig. 6B). To confirm that the findings obtained by Western and transcriptional activation assays correlated with activation of the MAPK, we measured ERK-1/2 enzymatic activity after treatment with either glucose or KCl. Both glucose and KCl treatment resulted in increased ERK activity as early as 5 min, whereas that induced by KCl appeared to be of greater magnitude, perhaps due to the more marked effect on Ca2+ influx (Fig. 6C).

CaMKIV activates Elk-1-dependent transcription. Previous evidence obtained with Ca2+/CaM inhibitors suggested that activation of Egr-1 transcription in insulinoma cells by depolarization involved this pathway (3). To determine whether activation of CaMKIV and CaMKII, in addition to the Ras/MAPK pathways, modulate Elk-1-dependent transcription, plasmids encoding constitutively active forms of these kinases were assessed in the GAL4-Elk-1 transcriptional activation assay. Transfection with CaMKIVCT or CaMKIIBC, respectively, activated Elk-1-dependent transcription 5- (P = 0.01) and 2.3-fold (P = 0.002), respectively (Fig. 7A). Neither dominant negative forms of CaMKIV (CaMKIVKT) nor CaMKII (CaMKIIBI) inhibited the depolarization induction of Elk-1-dependent transcription (data not shown). These results may be explained by the alternative activation through the Ras pathway. That both pathways do contribute to depolarization activation of Elk-1 was suggested by an additional 25% inhibition of Elk-1 activation with cotransfection of a dominant negative CaMKIV together with the dominant negative Ras (data not shown).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7.   Elk-1- transcription activation by CaMKIV is MAPK dependent. A: effects of activation of CaMKIV and -II pathways in Elk-1-dependent transcription. Elk-1 transcriptional activation was assessed using the GAL4-Elk-1 luciferase expression system. MIN6 insulinoma cells were transfected with 0.1 ng of Elk-1-GAL4 and 0.25 µg of a reporter plasmid pFR-Luc, as described in EXPERIMENTAL PROCEDURES. After culturing in regular media containing 5 mM glucose and 2% FBS for 24 h, the cells were continued in the same media (5 mM glucose) or stimulated for 6 h (45 mM KCl). Cells were cotransfected with wild-type 1 µg of constitutively active Ca+/calmodulin kinase (CaMK)IV (CaMKIVCT) or 1 µg of consitutively active CaMKII (CaMKIIBC) as indicated. A corresponding amount of empty vector was used to maintain a constant DNA concentration. To control for transfection efficiency, 2 ng of pRL-TK luciferase construct were used. Data are expressed as means + SE of the fold induction over the luciferase activity at 5 mM glucose. B: CaMKIV induction of Elk-1-dependent transcription is MAPK dependent. MIN6 insulinoma cells were transfected with the GAL4-Elk-1 activation system as described in A and B. Cotransfection with 1 µg of CaMKIV or 50 ng of MEKK (inset) alone or with 50 ng of a plasmid encoding for the MAP kinase phosphatase 1 (MKP1). DNA concentration was maintained constant by using the corresponding empty plasmids. To control for transfection efficiency, 2 ng of pRL-TK luciferase construct were used in all experiments. Data are expressed as means + SE of the fold induction over the luciferase activity at 5 mM glucose. Values are representative of 3 independent experiments done in triplicate; *P < 0.01.

In neuronal cells (NG108), Ca2+ influx activates Elk-1 via two pathways that converge on Ras/Raf/MEK. One involves Ca2+ activation of a soluble tyrosine kinase receptor, the other Ca2+ activation of CaMKIV (13). To determine whether the ERK pathway is involved in the activation of Elk-1 by CaMKIV, cotransfection with a plasmid encoding a specific inhibitor of the ERK pathway, MKP-1, was performed. In Fig. 7B is shown the complete inhibition of CaMKIV induction of ELK-1 transcriptional activation by MKP-1. The effectiveness of the MKP was demonstrated by >95% inhibition of Elk-1 transcription when cotransfection of MKP-1 and a plasmid encoding MEKK was performed (see Fig. 7B, inset). The results of the experiments described above suggest that CaMKIV, as well as Ras, also activates Elk-1-dependent transcription by activation of the MAPK pathway.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A common cellular response to a variety of growth stimuli is the activation of various kinase-dependent signaling pathways. Several of these kinase-mediated pathways have been shown to be triggered by glucose treatment of pancreatic beta -cells. Although it is recognized that hyperglycemia serves as a growth factor for these cells, the proximal mechanisms whereby glucose-induced depolarization and Ca2+ influx alter gene expression are still undetermined. To appreciate the mechanisms concerned in Ca2+ regulation of islet beta -cell transcription, we have focused on the identification of signal transduction pathways by which Ca2+ leads to the phosphorylation and activation of transcription factors regulating the Egr-1 promoter. In the current studies, we demonstrated 1) that the Ets elements are important components in depolarization-activated SRE-dependent Egr-1 transcription, 2) that Elk-1 is one of the TCFs that bind the SRE in pancreatic beta -cells, 3) that Elk-1 is phosphorylated and transcriptionally activated by glucose and other depolarizing agents, as well as by growth factors, and 4) that the MEK/ERK pathway is involved in Elk-1-dependent transcription activated by both glucose and growth factors. These studies also confirm the tissue specificity of Ca2+-dependent TCF-mediated transcription, since similar findings were described in cortical neurons and the pituitary cell line AtT20, but not in hippocampal neurons or PC12 cells (2). Most important, the results of these studies are the first to show the convergence of glucose-induced depolarization and growth factor treatment on activation of a transcription factor in insulinoma cells.

It was noted that KCl-induced depolarization increased both phosphorylation and transactivation of Elk-1 to a greater extent than glucose treatment. The differences in the responses between glucose and depolarization can be explained by differences in the magnitude of the stimulus, which we have previously shown is extracellular Ca2+. This conclusion is based on the observation that inhibition of both glucose and KCl induction of Egr-1 transcription was blocked by the hyperpolarizing agent diazoxide and by Ca2+ channel blockers (3). Because it was previously shown that KCl-induced depolarization elicited a higher magnitude of Ca2+ influx, we decided to use this stimulus to study the signaling pathways induced by depolarization.

Efforts to define the proximal pathways whereby Ca2+ influx triggers the MEK/ERK pathway involved transfections with Ras and CaMK plasmids. Although expression of wild-type Ras resulted in robust Elk-1 transcriptional activation, expression of a dominant negative form of Ras, under conditions where others have observed marked inhibition (6), resulted in only partial inhibition. These results suggested that other pathways besides Ca2+ activation of Ras could be involved. In the present study, we demonstrated that activation of the CaMKIV pathway resulted in Elk-1-dependent transcriptional activation. This activation was ERK dependent as suggested by the complete inhibition of CaMKIV transactivation of Elk-1 by the ERK-1-specific MAP kinase phosphatase (Fig. 7B). Similar activation of the ERK pathway by CaMKIV has been shown in NG108 neuronal cells (13). Although the present study showed that activation of the CaMKIV pathway resulted in Elk-1-dependent transcriptional activation, the lack of inhibition by a dominant negative form of CaMKIV raised the concern about the role of endogenous CaMKIV. An additional inhibition was observed when a combination of dominant negative forms of Ras and CaMKIV was used, however (data not shown). The results of these experiments suggested that the CaMKIV pathway contributes to, but is not essential for, depolarization induction of Elk-1 in insulinoma cells.

EGF has been shown to modulate islet growth in animal models, and overexpression of EGF in beta -cells in transgenic mice results in pancreatic beta -cell hyperplasia (24). Recently, EGF receptor-deficient mice were shown to have generalized defects in islet beta -cell proliferation (29). EGF activation of Elk-1 transcription has been demonstrated in several cell types. In the present studies, we showed that EGF treatment of MIN6 insulinoma cells results in Elk-1 activation. As demonstrated in other systems, this activation occurs via a Ras/MAPK pathway, as this effect was inhibited by PD98059. The results of the present studies also indicated a convergence of glucose/depolarization/Ca2+ activation and EGF-mediated signaling pathways through activation of Ras/MAPK/ERK-1/2. Thus both mitogenic stimuli result in transcriptional activation of Elk-1 via similar mechanisms. In this regard, in preliminary experiments we have demonstrated that, in insulinoma cells, inhibition of the MEK MAPK pathway by PD98059 decreases thymidine incorporation induced by both EGF and glucose (data not shown). The present studies thus provide an in vitro experimental model to begin to assess the molecular mechanisms involved in EGF responses in transgenic animals.

On the basis of the results of previous (3) and the present studies, a schematic respresentation of the signal transduction pathways involved in depolarization/Ca2+ regulation of SRE-dependent transcription in pancreatic beta -cells is suggested in Fig. 8. Using the Egr-1 gene as a model, we have shown that the Egr-1 promoter contains five SREs and that the transcriptional response to depolarization is SRE dependent. In response to increased glucose metabolism, depolarization and Ca2+ influx result in CaMKIV activation of SRF (3). The present studies now demonstrate Ca2+/CaM/CaMK activation of another transcription factor, Elk-1, involved in SRE-mediated transcription. In contrast to the activation of SRF by CaMKIV, Elk-1-dependent transcription requires activation of the Ras/MEK pathway. EGF activation of Elk-1-dependent transcription also requires the Ras/MEK pathway. Thus the results of the present experiments show that both glucose/depolarization and EGF treatment converge on a common pathway leading to Elk-1 activation. How this pathway contributes to the proliferation of beta -cells to prolonged hyperglycemia and insulin resistance can now be tested in different experimental models.


View larger version (116K):
[in this window]
[in a new window]
 
Fig. 8.   Schematic diagram of the essential components of glucose-induced depolarization and EGF-stimulated Elk-1 and SRF transcriptional activation by phosphorylation in insulinoma cells. SUR, sulfonyl urea receptor.


    ACKNOWLEDGEMENTS

We gratefully acknowledge Michael D. Shornick, Cris M. Welling, and Jon Wasson for technical assistance, and Burton Wice for careful comments and suggestions. We also thank Gary Skolnick for preparation of the manuscript.


    FOOTNOTES

This work was supported in part by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-16746 (M. A. Permutt) and the Diabetes Research and Training Center for technical support.

Address for reprint requests and other correspondence: E. Bernal-Mizrachi, Division of Endocrinology, Diabetes and Metabolism, Washington Univ. School Of Medicine, Campus Box 8127, 660 S. Euclid Ave., St. Louis, MO 63110 (E-mail: ebernal{at}im.wustl.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 13 June 2001; accepted in final form 26 July 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Babu, G, Lalli JM J, Sussman MA, Sadoshima J, and Periasamy M. Phosphorylation of elk-1 by MEK/ERK pathway is necessary for c-fos gene activation during cardiac myocyte hypertrophy. J Mol Cell Cardiol 32: 1447-1457, 2000[Web of Science][Medline].

2.   Bading, H, Hardingham GE, Johnson CM, and Chawla S. Gene regulation by nuclear and cytoplasmic calcium signals. Biochem Biophys Res Commun 236: 541-543, 1997[Web of Science][Medline].

3.   Bernal-Mizrachi, E, Wice B, Inoue H, and Permutt MA. Activation of serum response factor in the depolarization induction of Egr-1 transcription in pancreatic islet beta-cells. J Biol Chem 275: 25681-25689, 2000[Abstract/Free Full Text].

4.   Bonner-Weir, S, Deery D, Leahy JL, and Weir GC. Compensatory growth of pancreatic beta-cells in adult rats after short-term glucose infusion. Diabetes 38: 49-53, 1989[Abstract].

5.   Cavigelli, M, Dolfi F, Claret FX, and Karin M. Induction of c-fos expression through JNK-mediated TCF/Elk-1 phosphorylation. EMBO J 14: 5957-5964, 1995[Web of Science][Medline].

6.   Chen, SY, Huff SY, Lai CC, Der CJ, and Powers S. Ras-15A protein shares highly similar dominant-negative biological properties with Ras-17N and forms a stable, guanine-nucleotide resistant complex with CDC25 exchange factor. Oncogene 9: 2691-2698, 1994[Web of Science][Medline].

7.   Christy, BA, Lau LF, and Nathans D. A gene activated in mouse 3T3 cells by serum growth factors encodes a protein with "zinc finger" sequences. Proc Natl Acad Sci USA 85: 7857-7861, 1988[Abstract/Free Full Text].

8.   Clarkson, RW, Shang CA, Levitt LK, Howard T, and Waters MJ. Ternary complex factors Elk-1 and Sap-1a mediate growth hormone-induced transcription of egr-1 (early growth response factor-1) in 3T3-F442A preadipocytes. Mol Endocrinol 13: 619-631, 1999[Abstract/Free Full Text].

9.   Cohen, DM, Gullans SR, and Chin WW. Urea inducibility of egr-1 in murine inner medullary collecting duct cells is mediated by the serum response element and adjacent Ets motifs. J Biol Chem 271: 12903-12908, 1996[Abstract/Free Full Text].

10.   Curran, T, and Franza BRJ Fos and Jun: the AP-1 connection. Cell 55: 395-397, 1988[Web of Science][Medline].

11.   Der, CJ, Pan BT, and Cooper GM. rasH mutants deficient in GTP binding. Mol Cell Biol 6: 3291-3294, 1986[Abstract/Free Full Text].

12.   Dignam, JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475-1489, 1983[Abstract/Free Full Text].

13.   Enslen, H, Tokumitsu H, Stork PJ, Davis RJ, and Soderling TR. Regulation of mitogen-activated protein kinases by a calcium/calmodulin-dependent protein kinase cascade. Proc Natl Acad Sci USA 93: 10803-10808, 1996[Abstract/Free Full Text].

14.   Finegood, DT, Scaglia L, and Bonner-Weir S. Dynamics of beta-cell mass in the growing rat pancreas. Estimation with a simple mathematical model. Diabetes 44: 249-256, 1995[Abstract].

15.   Finkbeiner, S, and Greenberg ME. Ca2+ channel-regulated neuronal gene expression. J Neurobiol 37: 171-189, 1998[Web of Science][Medline].

16.   Frodin, M, Sekine N, Roche E, Filloux C, and Pretki M. Glucose, other secretagogues, and nerve growth factor stimulate mitogen-activated protein kinase in the insulin-secreting beta -cell line, INS-1. J Biol Chem 270: 7882-7889, 1995[Abstract/Free Full Text].

17.   Ghosh, A, and Greenberg ME. Calcium signaling in neurons: molecular mechanisms and cellular consequences. Science 268: 239-247, 1995[Abstract/Free Full Text].

18.   Hipskind, RA, Rao VN, Mueller CG, Reddy ES, and Nordheim A. Ets-related protein Elk-1 is homologous to the c-fos regulatory factor p62TCF. Nature 354: 531-534, 1991[Medline].

19.   Hugl, SR, White MF, and Rhodes CJ. Insulin-like growth factor I (IGF-I)-stimulated pancreatic beta-cell growth is glucose-dependent---synergistic activation of insulin receptor substrate-mediated signal transduction pathways by glucose and IGF-I in ins-1 cells. J Biol Chem 273: 17771-17779, 1998[Abstract/Free Full Text].

20.   Ishihara, H, Asano T, Tsukuda K, Katagiri H, Inukai K, Anai M, Kikuchi M, Yazaki Y, Miyazaki JI, and Oka Y. Pancreatic beta cell line MIN6 exhibits characteristics of glucose metabolism and glucose-stimulated insulin secretion similar to those of normal islets. Diabetologia 36: 1139-1145, 1993[Web of Science][Medline].

21.   Janknecht, R, and Nordheim A. Elk-1 protein domains required for direct and SRF-assisted DNA-binding. Nucleic Acids Res 20: 3317-3324, 1992[Abstract/Free Full Text].

22.   Josefsen, K, Sorensen LR, Buschard K, and Birkenbach M. Glucose induces early growth response gene (Egr-1) expression in pancreatic beta cells. Diabetologia 42: 195-203, 1999[Web of Science][Medline].

23.   Khoo, S, and Cobb MH. Activation of mitogen-activating protein kinase by glucose is not required for insulin secretion. Proc Natl Acad Sci USA 94: 5599-5604, 1997[Abstract/Free Full Text].

24.   Krakowski, ML, Kritzik MR, Jones EM, Krahl T, Lee J, Arnush M, Gu D, Mroczkowski B, and Sarvetnick N. Transgenic expression of epidermal growth factor and keratinocyte growth factor in beta-cells results in substantial morphological changes. J Endocrinol 162: 167-175, 1999[Abstract].

25.   Lemaire, P, Revelant O, Bravo R, and Charnay P. Two mouse genes encoding potential transcription factors with identical DNA-binding domains are activated by growth factors in cultured cells. Proc Natl Acad Sci USA 85: 4691-4695, 1988[Abstract/Free Full Text].

26.   Liao, J, Hodge C, Meyer D, Ho PS, Rosenspire K, and Schwartz J. Growth hormone regulates ternary complex factors and serum response factor associated with the c-fos serum response element. J Biol Chem 272: 25951-25958, 1997[Abstract/Free Full Text].

27.   MacFarlane, WM, Smith SB, James RFL, Clifton AD, Doza YN, Cohen P, and Docherty K. The p38/reactivating kinase mitogen-activated protein kinase cascade mediates the activation of the transcription factor insulin upstream factor 1 and insulin gene transcription by high glucose in pancreatic beta-cells. J Biol Chem 272: 20936-20944, 1997[Abstract/Free Full Text].

28.   McMahon, SB, and Monroe JG. A ternary complex factor-dependent mechanism mediates induction of egr-1 through selective serum response elements following antigen receptor cross-linking in B lymphocytes. Mol Cell Biol 15: 1086-1093, 1995[Abstract].

29.   Miettinen, PJ, Huotari MA, Koivisto T, Ustinov J, Palgi J, Rasilainen S, Lehtonen E, Keski-Oja J, and Otonkoski T. Impaired migration and delayed differentiation of pancreatic islet cells in mice lacking EGF-receptors. Development 127: 2617-2627, 2000[Abstract].

30.   Milbrandt, J. A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science 238: 797-799, 1987[Abstract/Free Full Text].

31.   Miranti, CK, Ginty DD, Huang G, Chatila T, and Greenberg ME. Calcium activates serum response factor-dependent transcription by a Ras- and Elk-1-independent mechanism that involves a Ca2+/calmodulin-dependent kinase. Mol Cell Biol 15: 3672-3684, 1995[Abstract].

32.   Persaud, SJ, Wheller-Jones CPD, and Jones PM. The mitogen-activated protein kinase pathway in rat islets of Langerhans: studies on the regulation of insulin secretion. Biochem J 313: 119-124, 1996.

33.   Price, MA, Rogers AE, and Treisman R. Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET). EMBO J 14: 2589-2601, 1995[Web of Science][Medline].

34.   Rao, VN, and Reddy ES. A divergent ets-related protein, elk-1, recognizes similar c-ets-1 proto-oncogene target sequences and acts as a transcriptional activator. Oncogene 7: 65-70, 1992[Web of Science][Medline].

35.   Rhodes, CJ. IGF-I and GH post-receptor signaling mechanisms for pancreatic beta-cell replication. J Mol Endocrinol 24: 303-311, 2000[Abstract].

36.   Roose, J, and Clevers H. TCF transcription factors: molecular switches in carcinogenesis. Biochim Biophys Acta 1424: M23-M37, 1999[Medline].

37.   Shaw, PE, Schroter H, and Nordheim A. The ability of a ternary complex to form over the serum response element correlates with serum inducibility of the human c-fos promoter. Cell 56: 563-572, 1989[Web of Science][Medline].

38.   Sheng, M, and Greenberg ME. The regulation and function of c-fos and other immediate early genes in the nervous system. Neuron 4: 477-485, 1990[Web of Science][Medline].

39.   Susini, S, Roche E, Prentki M, and Schlegel W. Glucose and glucoincretin peptides synergize to induce c-fos, c-jun, junb, zif-268, and nur-77 gene expression in pancreatic beta(ins-1) cells. FASEB J 12: 1173-1182, 1998[Abstract/Free Full Text].

40.   Treisman, R. The serum response element. Trends Biochem Sci 17: 423-426, 1992[Web of Science][Medline].

41.   Treisman, R. Ternary complex factors: growth factor regulated transcriptional activators. Curr Opin Genet Dev 4: 96-101, 1994[Medline].

42.   Vandromme, M, Gauthier-Rouviere C, Carnac G, Lamb N, and Fernandez A. Serum response factor p67SRF is expressed and required during myogenic differentiation of both mouse C2 and rat L6 muscle cell lines. J Cell Biol 118: 1489-1500, 1992[Abstract/Free Full Text].

43.   Watson, DK, McWilliams MJ, Lapis P, Lautenberger JA, Schweinfest CW, and Papas TS. Mammalian ets-1 and ets-2 genes encode highly conserved proteins. Proc Natl Acad Sci USA 85: 7862-7866, 1988[Abstract/Free Full Text].

44.   Watson, DK, Robinson L, Hodge DR, Kola I, Papas TS, and Seth A. FLI1 and EWS-FLI1 function as ternary complex factors and ELK1 and SAP1a function as ternary and quaternary complex factors on the Egr1 promoter serum response elements. Oncogene 14: 213-221, 1997[Web of Science][Medline].

45.   Whitmarsh, AJ, and Davis RJ. Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways. J Mol Med 74: 589-607, 1996[Web of Science][Medline].

46.   Whitmarsh, AJ, Shore P, Sharrocks AD, and Davis RJ. Integration of MAP kinase signal transduction pathways at the serum response element. Science 269: 403-407, 1995[Abstract/Free Full Text].

47.   Whitmarsh, AJ, Yang SH, Su MS, Sharrocks AD, and Davis RJ. Role of p38 and JNK mitogen-activated protein kinases in the activation of ternary complex factors. Mol Cell Biol 17: 2360-2371, 1997[Abstract].

48.   Zinck, R, Hipskind RA, Pingoud V, and Nordheim A. c-fos transcriptional activation and repression correlate temporally with the phosphorylation status of TCF. EMBO J 12: 2377-2387, 1993[Web of Science][Medline].


Am J Physiol Endocrinol Metab 281(6):E1286-E1299
0193-1849/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
FASEB J.Home page
D. A. Glauser and W. Schlegel
Sequential actions of ERK1/2 on the AP-1 transcription factor allow temporal integration of metabolic signals in pancreatic {beta} cells
FASEB J, October 1, 2007; 21(12): 3240 - 3249.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Nilsson, K. Dahlman-Wright, C. Karelmo, J.-A. Gustafsson, and K. R. Steffensen
Elk1 and SRF transcription factors convey basal transcription and mediate glucose response via their binding sites in the human LXRB gene promoter
Nucleic Acids Res., July 10, 2007; (2007) gkm492v1.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Wang, D. T. Hendricks, F. Wamunyokoli, and M. I. Parker
A Growth-Related Oncogene/CXC Chemokine Receptor 2 Autocrine Loop Contributes to Cellular Proliferation in Esophageal Cancer.
Cancer Res., March 15, 2006; 66(6): 3071 - 3077.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
K. E Garnett, P. Chapman, J. A Chambers, I. D Waddell, and D. S W Boam
Differential gene expression between Zucker Fatty rats and Zucker Diabetic Fatty rats: a potential role for the immediate-early gene Egr-1 in regulation of beta cell proliferation
J. Mol. Endocrinol., August 1, 2005; 35(1): 13 - 25.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Ohsugi, C. Cras-Meneur, Y. Zhou, W. Warren, E. Bernal-Mizrachi, and M. A. Permutt
Glucose and Insulin Treatment of Insulinoma Cells Results in Transcriptional Regulation of a Common Set of Genes
Diabetes, June 1, 2004; 53(6): 1496 - 1508.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. Bernal-Mizrachi, W. Wen, M. Shornick, and M. A. Permutt
Activation of Nuclear Factor-{kappa}B by Depolarization and Ca2+ Influx in MIN6 Insulinoma Cells
Diabetes, December 1, 2002; 51(90003): S484 - 488.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernal-Mizrachi, E.
Right arrow Articles by Permutt, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernal-Mizrachi, E.
Right arrow Articles by Permutt, M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online