|
|
||||||||
Division of Endocrinology, Metabolism, and Molecular Medicine, Charles R. Drew University of Medicine and Science, Los Angeles, California 90509
| |
ABSTRACT |
|---|
|
|
|---|
We cloned and
characterized a 3.3-kb fragment containing the 5'-regulatory region of
the human myostatin gene. The promoter sequence contains putative
muscle growth response elements for glucocorticoid, androgen, thyroid
hormone, myogenic differentiation factor 1, myocyte enhancer factor 2, peroxisome proliferator-activated receptor, and nuclear
factor-
B. To identify sites important for myostatin's gene
transcription and regulation, eight deletion constructs were placed in
C2C12 and L6 skeletal muscle cells. Transcriptional activity of the constructs was found to be
significantly higher in myotubes compared with that of myoblasts. To
investigate whether glucocorticoids regulate myostatin gene expression,
we incubated both cell lines with dexamethasone. On both occasions, dexamethasone dose dependently increased both the promoter's
transcriptional activity and the endogenous myostatin expression. The
effects of dexamethasone were blocked when the cells were coincubated with the glucocorticoid receptor antagonist RU-486. These findings suggest that glucocorticoids upregulate myostatin expression by inducing gene transcription, possibly through a glucocorticoid receptor-mediated pathway. We speculate that glucocorticoid-associated muscle atrophy might be due in part to the upregulation of myostatin expression.
glucocorticoid; RU-486; skeletal muscle; C2C12 cells
| |
INTRODUCTION |
|---|
|
|
|---|
MYOSTATIN, previously known as growth differentiation factor-8 and a suggested member of the transforming growth factor superfamily, is predominantly expressed in skeletal muscle throughout life, from the early stages of embryogenesis to late adulthood (30). It was first identified by McPherron and Lee (30), who observed that gene targeting that disrupted myostatin expression resulted in a dramatic increase in the skeletal muscle mass of null mice. Subsequently, naturally occurring mutations that inactivate myostatin were identified in Belgian Blue and Piedmontese cattle (20), two breeds that are conspicuous because of their hypermuscularity (30). Conversely, increased myostatin expression was found to be associated with certain physiological conditions that result in a loss of muscle mass, such as acquired immune deficiency syndrome wasting syndrome (16), exposure to microgravity during space flight (22, 45), and hindlimb suspension (8, 46). Collectively, these data suggest that myostatin may act as an inhibitor of skeletal muscle growth.
The maintenance of muscle mass is determined by a fine balance between protein synthesis and breakdown, a dynamic homeostatic state modulated by numerous anabolic and catabolic factors. The muscle atrophy resulting from catabolic factors, such as glucocorticoids, starvation, and illness, could be the result of inhibition of protein synthesis or stimulation of protein breakdown in skeletal muscle (17, 18). Conversely, anabolic factors, such as androgens, recombinant human growth hormone, and resistance exercise, increase protein synthesis and thus promote muscle hypertrophy (2, 11). The precise processes by which these factors affect skeletal muscle growth or influence myostatin gene expression remain unclear.
As a first step toward elucidating the mechanisms that regulate myostatin gene expression, we cloned the 5'-upstream regulatory region of the human myostatin gene and characterized the regulatory elements present. Deletion analysis of the promoter was then used to further identify which of these elements was necessary for basal transcriptional activity of myostatin in vitro.
Furthermore, because the myostatin promoter region was found to contain many putative glucocorticoid response elements, we considered the possibility that glucocorticoids may regulate myostatin gene expression. Therefore, we first investigated the effects of dexamethasone (a glucocorticoid agonist) on myostatin transcriptional activity by using myostatin promoter luciferase reporter gene constructs. Subsequently, we examined the effects of graded doses of dexamethasone on endogenous myostatin mRNA and protein expression in both the absence and presence of a glucocorticoid receptor antagonist (RU-486). These studies demonstrated that dexamethasone increases both myostatin mRNA and protein expression in skeletal muscle cells in vitro by upregulating myostatin gene transcription.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of the human myostatin promoter.
A human genomic P1-derived artificial chromosome library in
pAd10SacBII (DMPC-HFF#1; Genomic System) was screened using a human myostatin random-primed [32P]cDNA probe.
Membranes were prehybridized with human Cot1 DNA (GIBCO-BRL)
and a hybridization mixture (high phosphate buffer: 0.25 M NaCl, 50 nM
Na2HPO4, and 2.5% SDS) for 2 h before the
probe was added. The filters were incubated at 65°C overnight, washed at a high stringency (0.1% saline-sodium citrate, 1% SDS, 65°C), and autoradiographed. Selected P1 clones, 2m21 and 170f7, were mapped
by restriction endonuclease digestions (BamHI,
HindIII, SalI, EcoRI, KpnI,
EagI, NotI, XbaI, and
PstI). The digested DNA was electrophoresed in 0.8% agarose
gel, transferred to Hybond N+ membranes using the standard
Southern blot techniques (40), and hybridized using an
-32P-labeled human myostatin cDNA probe. A 5-kb
EcoRI DNA fragment containing the 5'-end of the myostatin
gene was subcloned into pGEM7zf+ plasmid vector (Promega)
and sequenced. The DNA sequence of the promoter was analyzed with the
GCG program for restriction enzyme sites and with the TESS program
(Baylor College of Medicine Human Genome Sequencing Center) for
transcription response elements. Eight myostatin promoter constructs of
various lengths were generated by selected restriction enzyme
digestions and subsequently subcloned into a pGL-3 basic vector
possessing a luciferase reporter gene (Promega).
Cell culture. C2C12 (mouse) and L6 (rat) skeletal muscle cell lines were obtained from the American Type Culture Collection (nos. CRL-1772 and CRL-1458, respectively). Each cell line was cultured in DMEM (GIBCO-BRL) supplemented with 10% (vol/vol) FCS (GIBCO-BRL), 100 U/ml penicillin, and 100 g/ml streptomycin (GIBCO-BRL) as recommended by the supplier. Once cells became confluent, myoblasts (MB) could be harvested. Alternatively, after the first passage, cells were cultured in DMEM containing 3% horse serum (GIBCO-BRL) for 4 days, and the resulting myotubes (MT) were harvested.
Cell culture transfection.
Plasmid DNA containing one of the myostatin promoter constructs and a
PRL-TK Renilla/luciferase plasmid were cotransfected in MBs
and cultured in 24-well plates. To study promoter activity, transfected
MBs were cultured to 70% confluence, whereas MTs were cultured to 90%
confluence. To achieve parity of the molar concentration of each
promoter construct used for transfection, the amount of plasmid DNA of
each construct was adjusted, on the basis of its length, by the
following formula
|
|
Isolation of nuclear protein extracts.
Nuclear proteins were extracted from C2C12 MBs
and MTs using the procedure described by Thai et al. (43).
Briefly, cells were harvested by scraping, washed at 0°C in HBS (10 mM HEPES, 150 mM NaCl, and 1 mM EDTA), collected by centrifugation, and then resuspended in 5 vol of homogenization buffer [10 mM HEPES (pH
7.9), 1.5 mM MgCl2, 10 mM KCl, and 0.5 mM dithiothreitol
(DTT) with 6 protease inhibitors at 1 µg/ml]. The samples were
homogenized with 10 strokes of a Dounce pestle B to >60% lysis by
microscopic examination. The resulting cell lysate was layered over 1 vol of 0.5 M sucrose in homogenization buffer and then centrifuged at
4°C for 15 min at 5,000 g. The nuclear pellet was
resuspended in 1 vol of extraction buffer (homogenization buffer plus
0.4 M KCl, 0.2 mM EDTA, and 25% glycerol), placed on ice for 30 min, and centrifuged for 15 min at 4°C. The supernatant containing nuclear
proteins was added to a dialysis buffer (15 mM HEPES, 40 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, and 20%
glycerol) and was dialyzed in a microdialysis chamber (Pierce). The
protein concentration was determined by the bicinchoninic acid assay
(Pierce), and aliquots were frozen at
70°C until needed.
Myocyte enhancer factor 2 DNA probe synthesis.
Four specific oligonucleotides were synthesized with the following
sequences: myocyte enhancer factor 2 (MEF2)-2T:
5'-GGCACTAAAAATAATTTAATAC; MEF2-2B: 5'-GTTGTATTAAATTATTTTTAGTG;
MEF2-1T: 5'-GTGACTTTAAAAATAAATATTTGATATGAG; and
MEF2-1B: 5'-GGCTCATAT CAAATATTTATTTTTAAAG. Double-stranded DNA
for the MEF2-1A and -2A elements was synthesized by mixing equimolar
amounts of the corresponding oligonuceotide pairs (for MEF2-1A: MEF2-1T
and -1B and for MEF2-2A: MEF2-2T and -2B) and incubating at 60°C to
allow for annealing and finally cooling to 25°C. The resulting
double-stranded oligonucleotides had 5'-overhanging ends on both sides,
facilitating radiolabeling by a fill-in reaction using the Klenow
fragment of DNA polymerase and [
-32P]dCTP. After
labeling, the DNA was purified using Sephadex G-25 spin columns (Clontech).
Gel electrophoretic mobility shift assay. Protein-DNA binding reactions were performed for 30 min at room temperature by combining 2-8 µg nuclear protein extract with 40,000 counts/min (~1 ng) of DNA probe plus 2 µg poly(dI-dC) (Sigma) in 16 µl of electrophoretic mobility shift assay (EMSA) buffer (15 mM HEPES, pH 7.9, 5 mM MgCl2, 40 mM KCl, 0.5 mM EDTA, 0.5 mM DTT, and 5% glycerol). For competitive binding experiments, 10- or 50-fold molar excess of two nonlabeled DNA elements were included in the above solution, specifically, F15/R13 (GGATGGAAAACCCAAATGTT), a double-stranded, annealed oligomer containing no sequence homology with MEF2, and F10/R21 (GCTACAGTATGTAAACTAAAAGG), an oligonucleotide containing 7/9 bp homology with the known core MEF2 element (CTAAAATAA). For supershift experiments, 1-2 µl of an antibody specific to the MEF2D transcription factor (Transduction Laboratories) was added to the completed binding reaction, and the mixture was incubated for an additional 10 min at 4°C. Finally, 4 µl of EMSA buffer with 20% glycerol and 0.005% bromphenol blue were added to the reaction mix. A 5% polyacrylamide gel (30:1 bis) containing 5% glycerol in 0.5× TBE [Tris-base (90 mM), boric acid (90 mM), EDTA (2 mM)] was prepared, set, and prerun (200 volts at 4°C) for 1 h before the were samples loaded. After 3-4 h of separation at 250 volts, the gel was removed, dried, and exposed to X-ray film for autoradiography.
Analysis of endogenous myostatin mRNA by RT-PCR. Total RNA was extracted from the cultured muscle cells using the TRIzol reagent following the manufacturer's suggested procedure (GIBCO-BRL). Each sample was DNase treated, and cDNA was synthesized by reverse transcription of 2 µg of total RNA employing an oligo(dT) primer (GIBCO-BRL). Multiplex PCR amplification was carried out on a 2-µl aliquot of the resultant cDNA using the following two primer pairs: rat myostatin (RMst forward: ATG AGG ACA GTG AGA GAG AGG; reverse: GCA CAA GAT GAG TAT GCG G) and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (RGap forward: ATC AGT GCC ACC CAG AAG ACT; reverse: CAT GCC AGT GAG CTT CCC GTT; see Ref. 15). Thermocycling conditions were denaturation at 94°C for 2 min, amplification (94°C/30 s, 58°C/30 s, 72°C/50 s) for 35 cycles, and a final elongation at 72°C for 10 min. Amplification products were separated by electrophoresis on 2% agarose gels, stained with ethidium bromide, photographed, scanned, and analyzed using the densitometric software package QuantiScan version 1.5.
Western blot analysis.
Protein was extracted from both MB and MT using a denaturing reducing
lysis buffer containing 1% SDS, Tris · HCl, and a 1:20 dilution of
-mercaptoethanol. Samples were heat denatured (95°C for 5 min) and electrophoretically separated using 12% Tris-glycine polyacrylamide gels (ReadyGel; Bio-Rad, Hercules, CA), and the proteins were visualized using Coomassie brilliant blue staining. The electrophoretically separated samples were then transferred to a
nitrocellulose membrane (Hyperbond-ECL; Amersham) and immunodetected using the previously described procedure (16). The
antibody employed was the previously described myostatin polyclonal
antibody B (16). An anti-rabbit-IgG secondary antibody
linked to horseradish peroxidase (HRP) was used. Blots were developed
with an enhanced chemiluminescent substrate for HRP and exposed to film
(ECL Hyperfilm; Amersham).
Statistical analysis. At least three repetitions of each experiment were performed. In each experiment, every treatment was performed in quadruplicate. Values are means ± SE. The statistical significance was determined by one-way ANOVA. All pairwise multiple comparison procedures (Fisher's least significant difference method) in experiments are shown in Figs. 2 and 5. The statistical significance was determined by one-way ANOVA. All pairwise multiple comparison procedures (Dunnett's method) in experiments are shown in Fig. 4. All statistical tests were performed using the Jandel SigmaStat statistical software package. P < 0.05 was taken as the level of statistical significance.
| |
RESULTS |
|---|
|
|
|---|
Cloning and characterization of the human myostatin promoter.
We screened a human genomic P1-derived artificial chromosome library
with a full-length myostatin cDNA probe and identified two clones (2m21
and 170f7, ~25 and 40 kb in size, respectively) that contained the
myostatin promoter. Restriction digestion and Southern blot analysis of
the clones identified two fragments of ~5 and 9 kb in size. The 9-kb
fragment only hybridized with a probe consisting of the 3'-end of
myostatin cDNA. Conversely, the 5-kb fragment only hybridized with a
probe comprising the 5'-end of myostatin cDNA, suggesting that it
contained the myostatin promoter. Consequently, the 5-kb fragment was
subcloned and sequenced. Sequence analysis revealed that this fragment
contained not only the 5'-end of myostatin cDNA but also a 3.3-kb
5'-upstream region of the human myostatin gene. Further sequence
analysis identified three TATA boxes, a partial CCAAT box, and five
octameric sequences homologous to the consensus binding sites of POU
homeodomain proteins (Table 1 and Fig.
1). Twelve E boxes
corresponding to myogenic differentiation factor 1 (MyoD) binding
sites, two regions homologous to MEF2 binding sites, a putative
peroxisome proliferator-activated receptor-
(PPAR
) binding site,
and a region homologous to the consensus sequence of the nuclear factor
(NF)-
B binding site were also found (Table 1 and Fig. 1).
|
|
Mapping myostatin promoter transcriptional activity.
The eight myostatin promoter deletion constructs that we tested
displayed differing levels of transcriptional activity in transfected
C2C12 (Fig. 2)
and L6 cells (data not shown), both at the MB and MT stages.
Interestingly, the transcriptional activities of all the constructs,
except for pMK6, were approximately twofold higher in MT than in MB
(Fig. 2).
|
3322 to
1187 resulted in a marked increase of transcriptional activity. Of
the eight constructs, pMK8 (1187 bp), had the highest transcriptional
activity, more than three times that of the longest construct pMK1
(3322 bp). These findings suggest the presence of possible
transcriptional inhibitory elements between
3322 and
2062 and
1447 and
1187. Deletions of sequences proximal to
1187 caused
loss of transcriptional activity, suggesting the presence of
transcriptional enhancers, especially between
1187 and
529.
Similarly, as the promoter was deleted even further, to a length of 327 bp (pMK6), there was a decrease of approximately threefold in
transcriptional activity, suggesting that the region between
327 and
529 contains a transcriptional enhancer (Fig. 2).
Characterization of MEF2 sites.
To test whether the two MEF2 elements identified on the myostatin
promoter sequence could bind MEF2 nuclear proteins, we performed gel
shift experiments using synthetic DNA probes for MEF20-1A and -2A and
nuclear extracts from C2C12 MB and MT.
High-molecular-weight protein-DNA complexes were formed with both MEF2
DNA sequences, but MEF2-2A bound much more strongly than MEF2-1A to
proteins in both MB and MT. We observed approximately sevenfold more
prominent protein-DNA complexes being formed with MEF2-2A in MT than in MB extracts (Fig. 3A). The
specificity of protein-DNA binding was demonstrated by complete
competition of complex formation by a 50-fold excess of the MEF2-2A
sequence and partial competition by MEF2-1A (Fig. 3B).
Partial competition was also observed with the F10/R21 oligonucleotide
pair, which fortuitously has a small MEF2-like DNA sequence. No
competition was observed with F15/R13 DNA. Furthermore, the antibody
specific for MEF2D was able to supershift up to 50% of the protein-DNA
complexes (Fig. 3B), indicating that these complexes contain
the MEF2D transcription factor. The nonshifted complexes may contain
other MEF2 factors (e.g., MEF2B). The binding of MT MEF2 transcription
factors specifically with the MEF2-2A element in the myostatin promoter
is consistent with its postulated function in activation of this
muscle-specific enhancer, since deletion of this promoter region causes
a significant loss of the promoter activity.
|
Glucocorticoid agonist dexamethasone increases transcriptional
activity of myostatin promoter in vitro.
The presence of sequences homologous to the consensus sequence of the
GRE suggested that glucocorticoids might regulate myostatin transcription. To test this hypothesis, we transfected the myostatin promoter construct pMK1 into both C2C12 and L6
cells and measured the changes of its transcriptional activity after
96 h. Dexamethasone dose dependently increased the luciferase
reporter activity in C2C12 and L6 muscle cell
lines (Fig. 4). A concentration of 1 nM
dexamethasone had minimal effect on transcriptional activity, whereas
maximal induction was observed at 100 nM dexamethasone (Fig. 4,
A and B). Increasing dexamethasone concentration,
>100 nM, did not further increase myostatin transcriptional activity (data not shown).
|
|
Dexamethasone increases endogenous myostatin mRNA
and protein expression.
To determine whether dexamethasone affects the expression of endogenous
myostatin mRNA and protein, we incubated C2C12
cells with dexamethasone (100 nM), dexamethasone (100 nM)-RU-486 (1,000 nM), and RU-486 (1,000 nM) alone for 4 days. Northern blot did not
detect the presence of myostatin RNA in any of the cell cultures (data
not shown). However, RT-PCR analysis indicated that incubation with
dexamethasone increased myostatin mRNA expression approximately two- to
threefold over the basal level (Fig. 6).
This effect was nullified in cells that were incubated with
dexamethasone and RU-486 (Fig. 6). Addition of dexamethasone also
resulted in a significant increase in the 30-kDa myostatin
immunoreactive protein, as determined by Western blot analysis (Fig.
6). As with mRNA, the effect of dexamethasone on myostatin
immunoreactive protein was antagonized by concurrent incubation with
RU-486. Incubation with RU-486 alone had no significant effect on
myostatin mRNA or protein expression.
|
| |
DISCUSSION |
|---|
|
|
|---|
We characterized the 3.3-kb 5'-flanking regulatory region of the
human myostatin gene and found it to contain the consensus DNA
sequences of a number of transcription factor response elements. Among
those identified were GRE, ARE, MEF2, PPAR
, and NF-
B, suggesting
that the corresponding proteins may influence the expression of
myostatin during the regulation of muscle growth.
Of particular interest was the identification of multiple E boxes. These elements, which are present in the control regions of many skeletal muscle structural genes (4, 9, 27, 47), have been shown to be activated by certain myogenic factors, especially MyoD (6, 24). MyoD, a member of the basic helix-loop-helix (bHLH) superfamily of proteins (33, 34), is required to generate the MB population and thus is instrumental in specifying the skeletal muscle lineage (37). The presence of E boxes in the upstream region of our promoter suggests that myostatin expression may result as a response to MyoD expression.
Our studies showed that the elements necessary for both the basal
transcription of myostatin, and its response to glucocorticoids, are
present within the proximal 327 bp of the promoter region. Further
information on the roles of the different regions of the promoter was
provided by the deletion construct experiments that indicated that the
promoter contained two regions that were capable of inhibiting
transcription (between
3322 and
2062, and
1447 and
1187) and an
area with probable transcriptional enhancers (between
1187 and
529). The removal of an MEF2 site (between
529 and
327 bp) caused
a threefold decrease in transcriptional activity, suggesting that the
region acts as a strong transcriptional enhancer.
MEF2 is a four-member gene family, MEF2A through MEF2D (25), that encodes nuclear proteins belonging to the MADS (MCM1, agamous, deficiens, serum) superfamily of DNA-binding proteins (48). In the adult mouse, MEF2C transcripts are restricted to skeletal muscle, brain, and spleen (28, 29), whereas MEF2A, MEF2B, and MEF2D are expressed ubiquitously (48). The MEF2 enhancer has been found in the regulatory regions of many muscle structure genes (26, 35). Because the MEF2 proteins are involved in complex heterotypic protein-protein interactions with members of the myogenic bHLH family (32), it has been suggested that they might play a role in stabilizing myogenin expression during mammalian myogenesis (13). Recently, it was found that MEF2 and the myogenic bHLH proteins act within a regulatory network that establishes the differentiated phenotype of skeletal muscle (14, 23, 34). Indeed, expression of MEF2 genes marks the development of early myogenic lineages during embyogenesis (10, 14), whereas the trans-activation function of the MEF2 proteins is required for muscle-specific gene expression and differentiation during mammalian myogenesis (1). The presence of MEF2 binding sites on the myostatin promoter and its strong enhancing effect shown on the transcriptional activity suggest that MEF2 is influential in myostatin expression during various stages of skeletal muscle growth.
We demonstrated that myostatin expression could be regulated in two in vitro skeletal muscle models and that the transcriptional activity of the promoter was lower in MB cells than in MT. Furthermore, endogenous myostatin mRNA could only be detected in MT, suggesting that myostatin expression in cultured MB is very low. A possible explanation for this observation may be found in the results of the gel shift assay, which showed that a much higher density band of protein-DNA complexes was generated with MT nuclear extract than in MB. This suggests that there is a higher concentration of MEF2 or related proteins in MT, which in turn may lead to a greater enhancement of the myostatin promoter activity and consequently a higher expression of myostatin.
Glucocorticoids, widely used for the treatment of a number of inflammatory disorders, are well known to induce muscle atrophy in humans and experimental animals. Previous in vitro and in vivo studies have suggested that the effects of glucocorticoids on muscle may be mediated through the inhibition of protein synthesis and an increase in protein degradation. However, the precise molecular mechanisms by which glucocorticoids induce the catabolic effects on muscle remain unknown.
Our data constitute the first demonstration that a glucocorticoid, dexamethasone, can upregulate both myostatin mRNA and protein concentrations in skeletal muscle cells in vitro. The results suggest that the dexamethasone-induced increase in myostatin mRNA expression may be due, at least in part, to the induction of myostatin gene transcription. Furthermore, the effect of dexamethasone was antagonized by the glucocortioid receptor antagonist RU-486, and the addition of the mineralocorticoid agonist fludrocortisone failed to influence myostatin transcription or mRNA and protein expression. It can therefore be surmised that dexamethasone acts upon myostatin via an as yet unspecified glucocorticoid receptor-mediated mechanism. Also, we do not know whether dexamethasone has additional posttranscriptional or posttranslational effects on myostatin.
The shortest of our deletion constructs, containing only 327 bp of the
proximal region, was found to be sufficient for mediating the myostatin
transcriptional response to dexamethasone. It is possible that two
GREs, tatGRE at
221 and a partial GRE at
287, might mediate these
responses to dexamethasone. However, the magnitude of the
transcriptional response to glucocorticoid administration was
significantly greater in promoter constructs containing the region
between
2062 and
1187. This region contains numerous GREs. Taken
together, these data suggest that the coordinated action of multiple
GREs might be needed for the optimal response to dexamethasone to be attained.
Our studies demonstrate that glucocorticoids may induce muscle atrophy through the upregulation of myostatin gene expression. We have previously reported that recombinant myostatin inhibits muscle cell replication and protein synthesis in vitro. Therefore, it is possible that an increase in myostatin expression resulting from glucocorticoid administration may cause a decrease in protein synthesis that in turn might lead to a loss of muscle mass. This hypothesis needs to be tested in vivo.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Jose A. Arias, Marintan Pandjaitan, and Khalil A Sheikh for technical assistance.
| |
FOOTNOTES |
|---|
This work was supported by National Institutes of Health Grants 1RO1 DK-49296, and 1RO1 AG-14369; Research Center of Minority Institution Grants P20 RR-11145-01 and G12 RR-03026; Food and Drug Administration-Orphan Drug Program Grant 1397; and Minority Biomedical Research Support Grant W950306.
Address for reprint requests and other correspondence: K. Ma, Div. of Endocrinology, Metabolism, and Molecular Medicine, Charles R. Drew Univ. of Medicine and Science, Los Angeles, CA 90509 (E-mail: kuma{at}cdrewu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 4 April 2001; accepted in final form 22 July 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Akkila, WM,
Chambers RL,
Ornatsky OI,
and
McDermott JC.
Molecular cloning of up-regulated cytoskeletal genes from regenerating skeletal muscle: potential role of myocyte enhancer factor 2 proteins in the activation of muscle-regeneration-associated genes.
Biochem J
325:
40-93,
1997.
2.
Ameredes, BT,
Watchko JF,
Daood MJ,
Rosas JF,
Donahoe MP,
and
Rogers RM.
Growth hormone improves body mass recovery with refeeding after chronic undernutrition-induced muscle atrophy in aging male rats.
J Nutr
129:
2264-2270,
1999
3.
Andres, V,
Cervera M,
and
Mahdavi V.
Determination of the consensus binding site for MEF2 expressed in muscle and brain reveals tissue-specific sequence constraints.
J Biol Chem
270:
23246-23249,
1995
4.
Armour, C,
Garson K,
and
McBurney MW.
Cell-cell interaction modulates myoD-induced skeletal myogenesis of pluripotent P19 cells in vitro.
Exp Cell Res
251:
79-91,
1999[Web of Science][Medline].
5.
Baulieu, EE.
Contragestion and other clinical applications of RU 486, an antiprogesterone at the receptor.
Science
245:
1351-1357,
1989
6.
Black, BL,
Martin JF,
and
Olson EN.
The mouse MRF4 promoter is trans-activated directly and indirectly by muscle-specific transcription factors.
J Biol Chem
270:
2889-2892,
1995
7.
Blackwell, TK,
and
Weintraub H.
Differences and similarities in DNA-binding preferences of MyoD and E2A protein complexes revealed by binding site selection.
Science
250:
1104-1110,
1990
8.
Carlson, CJ,
Booth FW,
and
Gordon SE.
Skeletal muscle myostatin mRNA expression is fiber-type specific and increases during hindlimb unloading.
Am J Physiol Regulatory Integrative Comp Physiol
277:
R601-R606,
1999
9.
Ceccarelli, E,
McGrew MJ,
Nguyen T,
Grieshammer U,
Horgan D,
Hughes SH,
and
Rosenthal N.
An E box comprises a positional sensor for regional differences in skeletal muscle gene expression and methylation.
Dev Biol
213:
217-229,
1999[Web of Science][Medline].
10.
Chambers, AE,
Logan M,
Kotecha S,
Towers N,
Sparrow D,
and
Mohun TJ.
The RSRF/MEF2 protein SL1 regulates cardiac muscle-specific transcription of a myosin light-chain gene in Xenopus embryos.
Genes Dev
8:
1324-1334,
1994
11.
Crowley, MA,
and
Matt KS.
Hormonal regulation of skeletal muscle hypertrophy in rats: the testosterone to cortisol ratio.
Eur J Appl Physiol
73:
66-72,
1996.
12.
De Angelis, L,
Borghi S,
Melchionna R,
Berghella L,
Baccarani-Contri M,
Parise F,
Ferrari S,
and
Cossu G.
Inhibition of myogenesis by transforming growth factor beta is density-dependent and related to the translocation of transcription factor MEF2 to the cytoplasm.
Proc Natl Acad Sci USA
95:
12358-12363,
1998
13.
Edmondson, DG,
Cheng TC,
Cserjesi P,
Chakraborty T,
and
Olson EN.
Analysis of the myogenin promoter reveals an indirect pathway for positive autoregulation mediated by the muscle-specific enhancer factor MEF-2.
Mol Cell Biol
12:
3665-3677,
1992
14.
Edmondson, DG,
Lyons GE,
Martin JF,
and
Olson EN.
Mef2 gene expression marks the cardiac and skeletal muscle lineages during mouse embryogenesis.
Development
120:
1251-1263,
1994[Abstract].
15.
Ercolani, L,
Florence B,
Denaro M,
and
Alexander MD.
Isolation and complete sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase gene.
J Biol Chem
263:
15335-15341,
1988
16.
Gonzalez-Cadavid, NF,
Taylor WE,
Yarasheski K,
Sinha-Hikim I,
Ma K,
Ezzat S,
Shen R,
Lalani R,
Asa S,
Mamita M,
Nair G,
Arver S,
and
Bhasin S.
Organization of the human myostatin gene and expression in healthy men and HIV-infected men with muscle wasting.
Proc Natl Acad Sci USA
95:
14938-14943,
1998
17.
Goodlad, GA,
and
Clark CM.
Glucocorticoid-mediated muscle atrophy: alterations in transcriptional activity of skeletal muscle nuclei.
Biochim Biophys Acta
1097:
166-170,
1991[Medline].
18.
Hasselgren, PO.
Glucocorticoids and muscle catabolism.
Curr Opin Clin Nutr Metab Care
2:
201-205,
1999[Medline].
19.
Hirano, F,
Tanaka H,
Hirano Y,
Hiramoto M,
Handa H,
Makino I,
and
Scheidereit C.
Functional interference of Sp1 and NF-kappaB through the same DNA binding site.
Mol Cell Biol
18:
1266-1274,
1998
20.
Kambadur, R,
Sharma M,
Smith TP,
and
Bass JJ.
Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle.
Genome Res
7:
910-916,
1997
21.
Katz, RW,
Subauste JS,
and
Koenig RJ.
The interplay of half-site sequence and spacing on the activity of direct repeat thyroid hormone response elements.
J Biol Chem
270:
5238-5242,
1995
22.
Lalani, R,
Bhasin S,
Byhower F,
Tarnuzzer R,
Grant M,
Shen R,
Asa S,
Ezzat S,
and
Gonzalez-Cadavid NF.
Myostatin and insulin-like growth factor-I and -II expression in the muscle of rats exposed to the microgravity environment of the NeuroLab space shuttle flight.
J Endocrinol
167:
417-428,
2000[Abstract].
23.
Lassar, AB,
Buskin JN,
Lockshon D,
Davis RL,
Apone S,
Hauschka SD,
and
Weintraub H.
MyoD is a sequence-specific DNA binding protein requiring a region of myc homology to bind to the muscle creatine kinase enhancer.
Cell
58:
823-831,
1989[Web of Science][Medline].
24.
Li, H,
and
Capetanaki Y.
An E box in the desmin promoter cooperates with the E box and MEF-2 sites of a distal enhancer to direct muscle-specific transcription.
EMBO J
13:
3580-3589,
1994[Web of Science][Medline].
25.
Liu, ML,
Olson AL,
Edgington NP,
Moye-Rowley WS,
and
Pessin JE.
Myocyte enhancer factor 2 (MEF2) binding site is essential for C2C12 myotube-specific expression of the rat GLUT4/muscle-adipose facilitative glucose transporter gene.
J Biol Chem
269:
28514-28521,
1994
26.
Lyons, GE,
Micales BK,
Schwarz J,
Martin JF,
and
Olson EN.
Expression of mef2 genes in the mouse central nervous system suggests a role in neuronal maturation.
J Neurosci
15:
5727-5738,
1995[Abstract].
27.
Marshall, P,
Chartrand N,
and
Worton RG.
The mouse dystrophin enhancer is regulated by myoD, E-box binding factors and by the serum response factor.
J Biol Chem.
276:
20719-20726,
2001
28.
Martin, JF,
Miano JM,
Hustad CM,
Copeland NG,
Jenkins NA,
and
Olson EN.
A Mef2 gene that generates a muscle-specific isoform via alternative mRNA splicing.
Mol Cell Biol
14:
1647-1656,
1994
29.
McDermott, JC,
Cardoso MC,
Yu YT,
Andres V,
Leifer D,
Krainc D,
Lipton SA,
and
Nadal-Ginard B.
hMEF2C gene encodes skeletal muscle- and brain-specific transcription factors.
Mol Cell Biol
13:
2564-2577,
1993
30.
McPherron, AC,
and
Lee SJ.
Double muscling in cattle due to mutations in the myostatin gene.
Proc Natl Acad Sci USA
94:
12457-12461,
1997
31.
Meyer, ME,
Pornon A,
Ji JW,
Bocquel MT,
Chambon P,
and
Gronemeyer H.
Agonistic and antagonistic activities of RU486 on the functions of the human progesterone receptor.
EMBO J
9:
3923-3932,
1990[Web of Science][Medline].
32.
Molkentin, JD,
Black BL,
Martin JF,
and
Olson EN.
Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins.
Cell
83:
1125-1136,
1995[Web of Science][Medline].
33.
Naidu, PS,
Ludolph DC,
To RQ,
Hinterberger TJ,
and
Konieczny SF.
Myogenin and MEF2 function synergistically to activate the MRF4 promoter during myogenesis.
Mol Cell Biol
15:
2707-2718,
1995[Abstract].
34.
Olson, EN.
MyoD family: a paradigm for development?
Genes Dev
4:
1454-1461,
1990
35.
Olson, EN,
Perry M,
and
Schulz RA.
Regulation of muscle differentiation by the MEF2 family of MADS box transcription factors.
Dev Biol
172:
2-14,
1995[Web of Science][Medline].
36.
Roche, PJ,
Hoare SA,
and
Parker MG.
A consensus DNA-binding site for the androgen receptor.
Mol Endocrinol
6:
2229-2235,
1992
37.
Rudnicki, MA,
Schnegelsberg PN,
Stead RH,
Braun T,
Arnold HH,
and
Jaenisch R.
MyoD or Myf-5 is required for the formation of skeletal muscle.
Cell
75:
1351-1359,
1993[Web of Science][Medline].
38.
Ruvkun, G,
and
Finney M.
Regulation of transcription and cell identity by POU domain proteins.
Cell
64:
475-478,
1991[Web of Science][Medline].
39.
Saatcioglu, F,
Deng T,
and
Karin M.
A novel cis element mediating ligand-independent activation by c-ErbA: implications for hormonal regulation.
Cell
75:
1095-1105,
1993[Web of Science][Medline].
40.
Sambrook, J,
Fritsch EF,
and
Maniatis T.
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
41.
Scott, DK,
Stromstedt PE,
Wang JC,
and
Granner DK.
Further characterization of the glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. The role of the glucocorticoid receptor-binding sites.
Mol Endocrinol
12:
482-491,
1998
42.
Smale, ST.
Transcription: Mechanisms and Regulation. New York: Raven, 1994.
43.
Thai, MV,
Guruswamy S,
Cao KT,
Pessin JE,
and
Olson AL.
Myocyte enhancer factor 2 (MEF2)-binding site is required for GLUT4 gene expression in transgenic mice. Regulation of MEF2 DNA binding activity in insulin-deficient diabetes.
J Biol Chem
273:
14285-14292,
1998
44.
Tontonoz, P,
Hu E,
Graves RA,
Budavari AI,
and
Spiegelman BM.
mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer.
Genes Dev
8:
1224-1234,
1994
45.
Urban, F,
Cavazos G,
Dunbar J,
Tan B,
Escher P,
Tafuri S,
and
Wang M.
The important role of residue F268 in ligand binding by LXRbeta.
FEBS Lett
484:
159-163,
2000[Web of Science][Medline].
46.
Wehling, M,
Cai B,
and
Tidball JG.
Modulation of myostatin expression during modified muscle use.
FASEB J
14:
103-110,
2000
47.
Wheeler, MT,
Snyder EC,
Patterson MN,
and
Swoap SJ.
An E-box within the MHC IIB gene is bound by MyoD and is required for gene expression in fast muscle.
Am J Physiol Cell Physiol
276:
C1069-C1078,
1999
48.
Yu, YT,
Breitbart RE,
Smoot LB,
Lee Y,
Mahdavi V,
and
Nadal-Ginard B.
Human myocyte-specific enhancer factor 2 comprises a group of tissue-restricted MADS box transcription factors.
Genes Dev
6:
1783-1798,
1992
This article has been cited by other articles:
![]() |
J. Naderi, C. Bernreuther, N. Grabinski, C. T. Putman, B. Henkel, G. Bell, M. Glatzel, and K. R. Sultan Plasminogen Activator Inhibitor Type 1 Up-Regulation Is Associated with Skeletal Muscle Atrophy and Associated Fibrosis Am. J. Pathol., August 1, 2009; 175(2): 763 - 771. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Carraro, S. Ferraresso, B. Cardazzo, C. Romualdi, C. Montesissa, F. Gottardo, T. Patarnello, M. Castagnaro, and L. Bargelloni Expression profiling of skeletal muscle in young bulls treated with steroidal growth promoters Physiol Genomics, July 9, 2009; 38(2): 138 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Almon, E. Yang, W. Lai, I. P. Androulakis, S. Ghimbovschi, E. P. Hoffman, W. J. Jusko, and D. C. DuBois Relationships between circadian rhythms and modulation of gene expression by glucocorticoids in skeletal muscle Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1031 - R1047. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Diel, D Baadners, K Schlupmann, M Velders, and J P Schwarz C2C12 myoblastoma cell differentiation and proliferation is stimulated by androgens and associated with a modulation of myostatin and Pax7 expression J. Mol. Endocrinol., May 1, 2008; 40(5): 231 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Allen, A. S. Cleary, K. J. Speaker, S. F. Lindsay, J. Uyenishi, J. M. Reed, M. C. Madden, and R. S. Mehan Myostatin, activin receptor IIb, and follistatin-like-3 gene expression are altered in adipose tissue and skeletal muscle of obese mice Am J Physiol Endocrinol Metab, May 1, 2008; 294(5): E918 - E927. [Abstract] [Full Text] [PDF] |
||||
![]() |
O Schakman, H Gilson, and J P Thissen Mechanisms of glucocorticoid-induced myopathy J. Endocrinol., April 1, 2008; 197(1): 1 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Allen and T. G. Unterman Regulation of myostatin expression and myoblast differentiation by FoxO and SMAD transcription factors Am J Physiol Cell Physiol, January 1, 2007; 292(1): C188 - C199. [Abstract] [Full Text] [PDF] |
||||
![]() |
A M Solomon and P M G Bouloux Modifying muscle mass - the endocrine perspective. J. Endocrinol., November 1, 2006; 191(2): 349 - 360. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K Garikipati, S. A Gahr, and B. D Rodgers Identification, characterization, and quantitative expression analysis of rainbow trout myostatin-1a and myostatin-1b genes. J. Endocrinol., September 1, 2006; 190(3): 879 - 888. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Sultan, B. Henkel, M. Terlou, and H. P. Haagsman Quantification of hormone-induced atrophy of large myotubes from C2C12 and L6 cells: atrophy-inducible and atrophy-resistant C2C12 myotubes Am J Physiol Cell Physiol, February 1, 2006; 290(2): C650 - C659. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dasarathy, M. Dodig, S. M. Muc, S. C. Kalhan, and A. J. McCullough Skeletal muscle atrophy is associated with an increased expression of myostatin and impaired satellite cell function in the portacaval anastamosis rat Am J Physiol Gastrointest Liver Physiol, December 1, 2004; 287(6): G1124 - G1130. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Escobar, W. G. Van Alstine, D. H. Baker, and R. W. Johnson Decreased Protein Accretion in Pigs with Viral and Bacterial Pneumonia Is Associated with Increased Myostatin Expression in Muscle J. Nutr., November 1, 2004; 134(11): 3047 - 3053. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Salerno, M. Thomas, D. Forbes, T. Watson, R. Kambadur, and M. Sharma Molecular analysis of fiber type-specific expression of murine myostatin promoter Am J Physiol Cell Physiol, October 1, 2004; 287(4): C1031 - C1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Reisz-Porszasz, S. Bhasin, J. N. Artaza, R. Shen, I. Sinha-Hikim, A. Hogue, T. J. Fielder, and N. F. Gonzalez-Cadavid Lower skeletal muscle mass in male transgenic mice with muscle-specific overexpression of myostatin Am J Physiol Endocrinol Metab, October 1, 2003; 285(4): E876 - E888. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ma, C. Mallidis, S. Bhasin, V. Mahabadi, J. Artaza, N. Gonzalez-Cadavid, J. Arias, and B. Salehian Glucocorticoid-induced skeletal muscle atrophy is associated with upregulation of myostatin gene expression Am J Physiol Endocrinol Metab, August 1, 2003; 285(2): E363 - E371. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Rodgers, G. M. Weber, K. M. Kelley, and M. A. Levine Prolonged fasting and cortisol reduce myostatin mRNA levels in tilapia larvae; short-term fasting elevates Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2003; 284(5): R1277 - R1286. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |