AJP - Endo Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 281: E837-E847, 2001;
0193-1849/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (40)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, R.
Right arrow Articles by Quarles, L. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, R.
Right arrow Articles by Quarles, L. D.
Vol. 281, Issue 4, E837-E847, October 2001

Analysis of recombinant Phex: an endopeptidase in search of a substrate

Rong Guo, Shiguang Liu, Robert F. Spurney, and L. D. Quarles

Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

X-linked hypophosphatemia (XLH) is caused by inactivating mutations of Phex, a phosphate-regulating endopeptidase. Further advances in our knowledge of the pathogenesis of XLH require identification of the biological function of Phex and its physiologically relevant substrates. We evaluated several potential substrates using mouse recombinant wild-type Phex proteins (rPhex-WT) and inactive mutant Phex proteins (rPhex-3'M) lacking the COOH-terminal catalytic domain as controls. By Western blot analysis, we demonstrated that Phex is a membrane-bound 100-kDa glycosylated monomer. Neither casein, a substrate for the related endopeptidase thermolysin, human stanniocalcin 1 (hSTC-1), an osteoblast-derived phosphate-regulating factor, nor FGF-23 peptide (amino acid 172-186), comprising the region mutated in autosomal dominant hypophosphatemia, was cleaved by rPhex-WT. In addition, membranes expressing rPhex-WT, rPhex-3'M, and the empty vector hydrolyzed parathyroid hormone-(1-34), indicating the lack of Phex-specific cleavage of parathyroid hormone. In contrast, rPhex-WT did display an EDTA-dependent cleavage of the neutral endopeptidase substrate [Leu]enkephalin. Further studies with wild-type and mutant rPhex proteins should permit the identification of physiologically relevant substrates involved in the pathogenesis of XLH.

X-linked hypophosphatemia; hypophosphatemia; rickets; parathyroid hormone; FGF-23; [Leu]enkephalin


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

THE ABBREVIATION Phex is used for the phosphate-regulating gene with homologies to endopeptidases located at the HYP loci on the X chromosome (10, 21). The Phex gene product is a type II membrane-bound zinc metalloendopeptidase that is closely related to neutral endopeptidase (NEP), endothelin-converting enzyme, and Kell (25). The clinical consequences of inactivating mutations of Phex indicate that this endopeptidase is involved in regulating phosphate and mineral homeostasis. Loss-of-function mutations of Phex cause X-linked hypophosphatemic rickets (XLH), a clinical disorder characterized by defective calcification and hypophosphatemia (10, 21). A similar phenotype occurs in the Hyp mouse homolog of XLH, where a 3' deletion of Phex removes its COOH-terminal catalytic domain (1, 9). Despite identification of the disease gene, the pathogenesis of phosphate wasting and impaired mineralization remains poorly understood, in part because the physiologically relevant Phex substrates have not been identified.

The search for candidate substrates has been guided by the hypothesis that inactivating Phex mutations leads to the accumulation of unknown phosphaturic and/or mineralization inhibitory factors (16, 19, 21) and the knowledge that related endopeptidases may have multiple substrates that are coexpressed within an organ/cell type-specific fashion (25). For example, the related endopeptidase NEP is constitutively expressed in a variety of tissues, where it metabolizes different substrates, including atrial natriuretic factor in the kidney, substance P in the lungs, and enkephalins, such as [Leu]enkephalin, in the brain (24). Thus Phex may also have multiple substrates that are expressed in the same tissues as Phex.

Several observations suggest that a physiologically relevant Phex substrate may be produced in the skeleton. First, Phex is predominantly expressed in osteoblasts in association with genes regulating extracellular matrix production and mineralization (6). Second, osteoblasts derived from Hyp mice secrete factors that inhibit mineralization and renal tubular phosphate transport (4, 20, 30). Third, bone marrow transplantation can partially rescue the phenotype of Hyp mice (18). Recently, a mammalian homolog of stanniocalcin 1 (STC-1), a calcium- and phosphate-regulating glycoprotein hormone in fish secreted by the corpuscles of Stannius, has been identified in osteoblasts (11, 26). Because of its colocalization with Phex and ability to regulate systemic phosphate homeostasis, STC-1 is a candidate substrate for Phex. There are no published studies evaluating whether STC-1 is cleaved by Phex.

Phex transcripts have been detected at several extraskeletal sites, including ovary, spleen, B cells, fetal lung, and parathyroid glands (1, 2), as well as in tumors causing oncogenic hypophosphatemic osteomalacia (OHO) (21, 22), indicating the possible presence of other substrates and physiological functions of Phex. Parathyroid hormone (PTH) has been considered a Phex substrate on the basis of Phex expression in the parathyroid glands (2) and the important role of PTH in inhibiting renal phosphate reabsorption. Indeed, recent unconfirmed studies report that recombinant Phex (rPhex) proteins generated in COS-7 cell membranes can metabolize PTH in vitro (12). The specificity of PTH cleavage by rPhex, however, has not been independently confirmed. Moreover, the physiological significance of PTH hydrolysis by Phex is not clear, since PTH is not the humoral factor responsible for phosphaturia in XLH or Hyp mice (16).

The investigation of autosomal dominant hypophosphatemia (ADH) (28) and OHO (29) confirms the existence of novel phosphaturic factors and provides additional clues to possible Phex substrates. In this regard, mutations in FGF-23, a new member of the growing family of FGF proteins (28), are responsible for ADH, which has many similarities to XLH. In addition, FGF-23 and Phex are coexpressed in tumors causing OHO that cause phosphaturia (29). These associations raise the possibility that FGF-23 may be a Phex substrate as well as a phosphaturic factor. If this is so, the pathogenesis of OHO might be explained by excessive production of FGF-23 that overwhelms the normal capacity of Phex, whereas ADH might be caused by the failure of Phex to degrade mutant FGF-23 (21). For this model to be valid, however, FGF-23 would need to be a substrate for Phex, and the R176Q and R179Q mutations of FGF-23 that cause ADH (28) should prevent cleavage of mutant FGF-23 by Phex.

As an initial step in the systematic examination of Phex structure and function, we generated recombinant wild-type (Phex-WT) and 3'-truncated Phex (Phex-3'M) proteins and assessed the ability of membranes expressing rPhex to specifically degrade a panel of possible physiological substrates, including casein, PTH-(1-34), FGF-23-(172-186), and human STC-1 (hSTC-1). In addition, we tested the ability of rPhex to cleave casein and [Leu]enkephalin, respective substrates for the related thermolysin and NEP.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Oligonucleotide primers were synthesized at the Duke University DNA Core Facility. The Bac-to-Bac baculovirus expression system was purchased from Life Technologies (Baltimore, MD). Spodoptera frugiperda (Sf9) cells were obtained from Dr. Patrick Casey (Duke University). The modular retroviral vector pLuvGM was provided by Dr. Clay Smith (Duke University) (8). We contracted with HTI Bio-Products (Ramona, CA) to raise Phex-specific rabbit antiserum against a keyhole limpet hemocyanin-conjugated synthetic peptide (H-CGGPRNSTMNRGADS-OH) corresponding to 734-745 amino acids in the COOH-terminal end of mouse Phex. Other antibodies used in these studies included a mouse anti-V5 monoclonal IgG2a antibody (Invitrogen, Carlsbad, CA), an anti-mouse IgG (whole molecule) conjugated to alkaline phosphatase (Sigma, St. Louis, MO), and anti-rabbit IgG antibodies conjugated to horseradish peroxidase (Santa Cruz Biotechnology, Santa Cruz, CA). Anti-nitro blue tetrazolium and bromochloroindolyl phosphate, used in the detection of alkaline phosphatase, were obtained from Roche (Indianapolis, IN). The enhanced chemiluminescence detection kit (NEN Life Science Products, Boston, MA) was used to detect horseradish peroxidase. Nitrocellulose membranes (0.45 µm) and other chemicals used for SDS-PAGE and Western blotting were purchased from Bio-Rad Laboratories (Hercules, CA). Thermolysin and rat synthetic PTH-(1-34) were purchased from Sigma. Human FGF-23 peptide (172-PIPRRHTRSAEDDSE-186) and the mutant peptide (172-PIPRQHTQSAEDDSE-186) that substitutes glutamine for arginine at positions 176 and 179 were synthesized by Genemed Synthesis (San Francisco, CA). [Leu]enkephalin, consisting of the sequence YGGFL, was obtained from Bachem Biosciences (King of Prussia, PA). The EnzChek protease kit was purchased from Molecular Probes (Eugene, OR). We cloned the human stanniocalcin full-length cDNA and generated recombinant hSTC-1 protein in our laboratory (see below).

Construction of epitope-tagged Phex-WT and Phex-3'M. The Phex full-length cDNA coding sequence (Phex-WT) was amplified from mouse osteoblast total RNA by RT-PCR. Using oligonucleotides - 5F (5'-TTCTGATGGAAGCAGAAACAGGGA-3'), M + 930R (5'-GGGAATCATAGCGCTGAGTTCTGA-3'), M + 786F (5'-TAATAGCTCTCGAGCTGAACATGA-3'), and M + 2253R (5'-AGCTACCAGAGTCGGCAAGAATCT-3'), we amplified overlapping sequences from -5 to 930 and from 786 to 2253, respectively, that were ligated to generate the full-length Phex cDNA. The Phex sequence was confirmed by direct sequencing. The Phex cDNA was subcloned into the NotI and ApaI sites of pMT/V5-His vector to create a cassette containing Phex in frame with V5 and histidine epitope tags at its COOH-terminal end (pMT-Phex-WT-V5-His). The polyhistidine tag provides an anchor for purification on the affinity matrix, Ni2+-nitrilotriacetate-agarose beads.

The COOH-terminal deletion mutant Phex (Phex-3'M) encoding cDNA from bp -5 to 1299 was amplified by PCR from the pBSK-Phex-WT plasmid using oligonucleotides 5'-CCCAGTCACGACGTTCTAAAACG-3' as the sense primer and 5'-ATTCTTGGGCCCTTCCTTCTTATCCTC-3 as the antisense primer. After PCR, the amplified 3'-truncated Phex (Phex-3'M) was digested with NotI and ApaI and subcloned into pFastBac1-V5-His vector in frame with V5-His.

Isolation and cloning of human stanniocalcin from an osteoblast cDNA library. To clone hSTC-1, we used DNA from human bone cDNA library as the template to perform PCR with primers specific to stanniocalcin (26). The primer pairs were 5'-ATTCTTGCGGCCGCTCAGAGAATGCTCCAAAACT-3' as sense primer (enzyme NotI site was added to the end) and 5'-ATTCTTGGGCCCAGCACTCTCATGGGA-3' as antisense primer (enzyme ApaI site was added to the end). The 750-bp PCR fragment corresponding to the full length of the stanniocalcin coding region was amplified. After NotI and ApaI restriction digestion, the DNA product was subcloned into the same site of pFastBac1-V5-His vector in frame with V5-His. The DNA sequence was confirmed by sequencing.

Production of epitope-tagged rPhex proteins and hSTC-1 in Sf9 cells. Insect Sf9 cells were grown in suspension in Sf-900 II serum-free medium (Life Technologies) supplemented with gentamicin (25 µg/ml) at 27°C under constant stirring at 50-60 rpm. Recombinant baculoviruses were produced with the pFastBac-1 vector and the protocol provided in the Bac-to-Bac baculovirus expression system kit. The pFastBac-V5-His, containing no insert, and Phex-WT, Phex-3'M, and hSTC-1 cDNAs were separately transformed into DH10BAC Escherichia coli cells for transposition into the bacmid. Four days later, colonies containing recombinant bacmids were identified, and their DNA was used to transfect Sf9 insect cells. After 48 h of incubation, cells and culture supernatants were removed and centrifuged at 1,000 rpm for 5 min. The cell pellets from membrane-associated Phex-WT and Phex-3'M and the supernatant from secreted hSTC-1 were analyzed by immunoblotting analysis using anti-V5 antibody. The supernatant was used to generate additional viral stocks by successive amplification cycles in Sf9 cells. For production of recombinant proteins, Sf9 cells in log-phase growth were diluted to 1 × 106 cells/ml and infected with recombinant baculoviruses at multiplicity of infection of 5-10. Cells producing Phex-WT or Phex-3'M were harvested 48 h after infection and resuspended in 150 mM NaCl and 20 mM Tris · HCl at pH 7.6. In all cases, cells were disrupted by sonication, nuclei and debris were removed by centrifugation at 300 g for 15 min at 4°C, and membranes were pelleted by centrifugation at 30,000 g for 50 min. The crude membranes were solubilized with 1% n-dodecyl-beta -D-maltoside in the lysis buffer. Solubilized membranes were collected after centrifugation at 10,000 g for 15 min. The protein content of each sample was determined by the NanoOrange protein quantitation kit (Molecular Probes). Final protein concentrations of the membrane suspensions were 1-5 mg/ml. The suspensions were stored at 70°C in multiple aliquots. The recombinant V5-His-tagged rPhex-WT and rPhex-3'M were purified from solubilized membrane fractions under native conditions by Ni2+-affinity resin chromatography. The bounded rPhex proteins were eluted with a high concentration of imidazole (250 mM) in the lysis buffer (3).

Production of Phex proteins in E86 cells. The Phex retroviruses pLuvPhex-WT and pLuvPhex-3'M were created by cloning in frame the full-length, non-epitope-tagged Phex cDNA or the 3'Phex deletion mutant containing the V5-His epitope tag between the NcoI site and BamHI site of the pLuvM. E86 cells, an ecotropic packaging cell line, were transfected with the empty retrovirus vector pLuvM, pLuvPhex-WT, or pLuvPhex-3'M along with pSV2Neo using the TransFast reagent (Promega, Madison, WI). Cells were selected by incubation with 700 µg/ml G418 for 2 wk, and membranes were isolated as described below.

SDS-PAGE and Western blot analyses. Immunoblot analysis was carried out by modifications of previously described methods (17). The specified amount of membrane proteins was dissolved in SDS gel loading buffer (500 mM Tris · HCl, pH 6.8, 8.5% SDS, 27.5% sucrose, 0.03% bromphenol blue) with and without 100 mM dithiothreitol to produce reducing and nonreducing conditions, respectively. Separated proteins were transferred to a nitrocellulose membrane (0.45 µm; Bio-Rad, Chicago, IL) over a 30-min period at 2.5 mA/cm2 at room temperature using a semidry blotting system (Millipore, Chicago, IL). Immunoblotting was performed using the mouse anti-V5 monoclonal antibody diluted 1:5,000 in Tris-buffered saline-Tween 20 (TBST) and 1% bovine serum albumin (final concentration 220 ng/ml; Invitrogen, Carlsbad, CA) or affinity-purified rabbit anti-Phex polyclonal antiserum (1:2,000 dilution). For anti-V5 antibody, blots were washed with TBST for 60 min and incubated with anti-mouse IgG (whole molecule) conjugated with alkaline phosphatase (diluted to 1:5,000) (Sigma) for 60 min at room temperature. After washes with TBST, immunoreactivity was detected by colorimetric reaction using 66 µl of 50 mg/ml nitro blue tetrazolium and 33 µl of bromochloroindolyl phosphate (50 mg/ml) in alkaline phosphatase buffer (50 mM NaHCO2 and 10 mM MgCl2) as previously described (17). For studies using the Phex antiserum, the protocols were identical, except the secondary antibody was goat anti-rabbit IgG conjugated to horseradish peroxidase (diluted 1:5,000). In addition, after the blots were washed three times with TBST at room temperature for 40 min each, immunoreactivity was detected by a chemiluminescence system (NEN Life Science Products).

Deglycosylation of Phex with peptide N-glycosidase F. The membrane proteins were treated with or without peptide N-glycosidase F as described elsewhere (17). Briefly, the specified amount of protein was denatured with 1% 2-mercaptoethanol at 37°C for 15 min and then incubated with or without 2.5 U of peptide N-glycosidase F (Roche, Indianapolis, IN) with 1% Triton X-100. The digestions were carried out at 30°C overnight.

Preparation of membranes containing endogenous Phex. Stock cultures of osteoblast cell lines, including human MG63, U2Os, SaOs, and MC3T3-E1 osteoblasts (6), were used in these studies. To isolate membranes, the cell pellet was resuspended in lysis buffer containing 150 mM NaCl and 20 mM Tris · HCl, pH 7.6, cells were disrupted by sonication, and nuclei and debris were removed by centrifugation at 300 g for 15 min at 4°C. Crude membranes were then pelleted by centrifugation at 30,000 g for 50 min and solubilized with 1% n-dodecyl-beta -D-maltoside in the lysis buffer. Solubilized membranes were collected after centrifugation at 10,000 g for 15 min. The protein content of each sample was determined by the NanoOrange protein quantitation kit.

Immunoprecipitation of native and recombinant Phex. Endogenous Phex in osteoblasts or recombinant V5-His-tagged Phex from Sf9 cells was immunoprecipitated using our rabbit anti-Phex polyclonal antibody. Osteoblasts at various stages of maturation and Sf9 cells expressing rPhex were used for these studies. Briefly, the medium was removed and the cell culture plate was rinsed with PBS at room temperature. All the following steps were performed on ice. RIPA buffer (1 ml), consisting of 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, and 50 mM Tris (pH 8.0), was added to the cell culture and then removed with a cell scraper. The cell lysate was transferred to a fresh tube, passed through the 21-gauge needle several times to shear the DNA, and incubated on ice for 30 min. The insoluble material from the lysate was removed by centrifugation at 10,000 g for 10 min. To remove the nonspecific binding, the soluble lysate was precleared by addition of 20 µl of Phex prebleed serum, incubated at 4°C overnight, and then incubated with 70 µl of protein A-Sepharose for 1 h. Beads were pelleted by centrifugation at 1,000 g for 5 min at 4°C. The supernatant was transferred to a fresh tube. Affinity-purified anti-Phex antibody (10 µg) was applied to the supernatant, and it was incubated overnight at 4°C. Protein A-Sepharose (70 µl) was then added, and the supernatant was incubated for 2 h at 4°C. The immune complex was collected by centrifugation at 1,000 g for 5 min at 4°C and washed four times with RIPA buffer. The Phex-anti-Phex complex was eluted in 100 µl of RIPA buffer with SDS loading buffer and assessed by Western analysis with affinity-purified anti-Phex antibody (7).

Assessing Phex enzyme activity. Phex endopeptidase activity was assessed using rat synthetic PTH-(1-34) (Sigma-Aldrich, St. Louis, MO), hSTC-1, FGF-23 peptide, BODIPY TR-X-casein (Molecular Probes), or [Leu]enkephalin (Bachem Biosciences). To assess PTH, FGF-23, and [Leu]enkephalin peptide hydrolysis, we used modifications of previously described methods (12). PTH-(1-34) (10 µg), FGF-23 peptide (25 µg), or [Leu]enkephalin (14 µg) was incubated in a total volume of 30 µl with up to 60 µg of solubilized membrane preparations derived from mock-infected Sf9 cells, Sf9 cells infected with the baculovirus vector alone, Phex-WT, or Phex-3'M, or affinity-purified rPhex-WT. The reaction was incubated at 37°C for 30 min in a buffer containing 150 mM NaCl and 20 mM Tris · HCl (pH 7.4) and terminated by the addition of 0.1% trifluoroacetic acid. In some studies, membrane preparations were incubated in the presence of 20 mM EDTA before addition of the substrate. Degradation of the peptides was monitored by reverse-phase HPLC. All samples were dissolved in a 10 mM trifluoroacetic acid injection solvent. The samples were separated by HPLC using an HPLC system (model 840, Waters, Milford, MA) equipped with a Pecosphere HS3-C18 base-deactivated column (Perkin-Elmer Biosystems, Foster City, CA) and an ultraviolet detector (model 481, Waters) set for 214 nm. Substrate hydrolysis products were eluted with a linear gradient from 100% 10 mM trifluoroacetic acid to 60% 10 mM trifluoroacetic acid-40% acetonitrile over 60 min at 1.5 ml/min. For all experiments, standards were chromatographed immediately before the chromatography of experimental samples to verify retention times.

For analysis of hSCT-1 hydrolysis, we performed in vitro and in vivo (i.e., cell culture) cleavage reactions. For the in vitro studies, 8.5 µg of hSTC-1 collected from media of hSTC-1-producing Sf9 cells were incubated with 30 µg of solubilized Sf9 membranes expressing rPhex-WT or rPhex-3'M. The reaction was incubated at 37°C for 30 min in a buffer containing 150 mM NaCl and 20 mM Tris · HCl (pH 7.4) and terminated by the addition of SDS loading buffer. For the in vivo cleavage studies, we coinfected into Sf9 cells either recombinant baculovirus containing hSTC-1 and Phex-WT or hSTC-1 and Phex-3'M. After 48 h, we collected supernatant from the coinfected Sf9 cultures and monitored secreted hSTC-1 by Western blot analysis using anti-V5 antibody.

To determine whether casein is a substrate for Phex, we used the EnzChek protease kits. Different concentrations of thermolysin or membrane protein were prepared in 100 µl of digestion buffer (10 mM Tris · HCl, pH 7.8, 0.1 mM sodium azide) and added with 100 µl of casein (10 µg/ml), which was heavily labeled with pH-insensitive red fluorescent BODIPY TR-X dye. After 1 h of incubation at room temperature and protection from light, the fluorescence was measured by microplate reader (excitation 485 nm, emission 530 nm). The related zinc metalloproteinase thermolysin was used as a positive control.

PTH-stimulated cAMP production. PTH-stimulated cAMP production was performed in HEK cells stably transfected with the rat PTH receptor cDNA. To generate these cells, a cDNA encoding the rat PTH receptor was obtained by RT-PCR from ROS 17/2.8 cells using the following primer pair: CCCCGAGGGACGCGGCCCTAGGAATTCGCGATGGGGGCCGCCCGGATCGCACCC and TCCATCTGTCCAGGTACCCAGGCCAGCAGT. The PCR product was ligated into the vector pBK-CMV(Delta lacZ) in frame with the sequences encoding the 12CA5 epitope (27) and stably transfected into HEK-293 cells by the calcium phosphate method and G418 selection. HEK cells expressing PTH receptors were plated at an initial density of 2-5 × 104 cells/ml in six-well plastic culture dishes (9.5 cm2/well; Costar, Cambridge, MA) and, after reaching confluence, were incubated in serum-free medium containing [3H]adenine (2 µCi/ml; Amersham, Arlington Heights, IL) for 3 h. Before agonist stimulation, cells were incubated for 10 min with 100 µM 3-isobutyl-1-methylxanthine in a buffer consisting of Hanks' balanced salt solution (without Ca2+ and Mg2+) containing 10 mM HEPES (pH 7.4). Generation of cAMP was measured after 5 min of stimulation by modifications of the method of Salomon et al. (23). We stimulated cAMP production by incubation with various concentrations of hydrolyzed or nonhydrolyzed PTH-(1-34). To ensure complete PTH hydrolysis, sequential dilutions of PTH were incubated with membranes derived from baculovirus Sf9 membranes expressing rPhex-WT. PTH incubated with membranes from mock-transfected cells and PTH not incubated with membranes served as controls.

Statistical analysis. Analysis of variance was performed with the Statgraphics software package (Statistical Graphics, Princeton, NJ).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Baculovirus-based expression of Phex-WT and Phex-3'M in Sf9 insect cells. A strategy was developed for heterologous expression and purification of mouse Phex using Sf9 insect cells. The entire coding region for Phex-WT or Phex-3'M was integrated into an engineered baculovirus genome via a recombinant transfer plasmid (see METHODS). For these constructs, a V5 epitope tag was placed at the COOH terminus of Phex-WT and Phex-3'M. A polyhistidine tag follows the V5 tag (Fig. 1A) to provide an anchor for purification on the affinity matrix, Ni2+-nitrilotriacetate-agarose beads (see below). In membranes prepared from Sf9 cells expressing rPhex-WT, we identified a predominant band of ~100 kDa using the anti-V5 monoclonal antibody under reducing conditions (Fig. 1B). Because Phex has six N-linked glycosylation sites, we determined whether the 100-kDa band represents glycosylated Phex. To accomplish this, we treated rPhex protein isolated from Sf9 membranes with N-glycosidase F before SDS-PAGE electrophoresis and Western blot analysis (Fig. 1C). Treatment of membranes with N-glycosidase shifted the apparent molecular mass of the 100-kDa protein to ~86 kDa, indicating that the rPhex protein generated in Sf9 cells has N-glycosylation sites. The molecular mass of 86 kDa is close to the theoretical mass deduced from the Phex cDNA sequence. In some studies, we also observed the confluence of several products that produced a broad band at ~200 kDa as well as a slightly smaller band of ~86 kDa (Fig. 1B). In membranes prepared from Sf9 cells expressing rPhex-3'M, we identified a ~60-kDa band, consistent with the truncation of the COOH-terminal region (Fig. 1B). No products were observed in mock-infected Sf9 membranes or membranes treated with vector alone. The epitope-tagged rPhex-WT was partially purified from solubilized membrane fractions under native conditions by Ni2+-affinity resin chromatography (Fig. 1D). The expression of rPhex was enriched in membrane fractions compared with total cell lysates, consistent with its designation as a transmembrane endopeptidase (Fig. 1D).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   Baculovirus expression of wild-type (Phex-WT) and COOH-terminal deletion mutant Phex (Phex-3'M) in Sf9 cells. A: schematic of full-length Phex (Phex-WT) and Phex-3'M. Phex encodes a 749-amino acid protein with a short NH2-terminal cytoplasmic tail (20 amino acids), a transmembrane domain (27 amino acids at positions 21-47), and a large extracellular COOH-terminal region (702 amino acids) containing a consensus zinc binding site (-His-Glu-X-X-His-) at amino acid positions 580-584. The coding region for Phex-WT or Phex-3'M was integrated into an engineered baculovirus genome via a recombinant transfer plasmid. For these constructs, a V5-His epitope tag was placed at the COOH terminus of Phex-WT and Phex-3'M. c, Cysteine residues. B: Western blot analysis of Sf9 membranes expressing recombinant Phex-WT (rPhex-WT) or Phex-3'M (rPhex-3'M). In lanes 1 and 2, no products were observed in mock-infected Sf9 membranes or membranes treated with vector alone. The predominant band of ~100 kDa corresponds to full-length Phex monomer (lane 3), and the ~60-kDa band is the COOH-terminal-truncated Phex (lane 4). A broad band at ~200 kDa represents possible Phex oligomerization, and the ~86-kDa product represents deglycosylated Phex. C: deglycosylation of Phex. rPhex protein isolated from Sf9 membranes was treated with N-glycosidase F before SDS-PAGE and Western blot analysis with the anti-V5 monoclonal antibody. Treatment of membranes with N-glycosidase shifted the 100-kDa protein to ~86 kDa. D: purification of Phex-WT under native conditions. The epitope-tagged Phex protein was purified using Ni2+-nitrilotriacetate-agarose and visualized by Western blot analysis with V5 antibody. Lane 1, total cell lysate; lane 2, solubilized cell membrane lysate; lane 3, flow-through; lanes 4 and 5, successive washes with 20 mM imidazole; lanes 6 and 7, successive elutions with 250 mM imidazole. MW, molecular weight standards. Variable amounts of protein were loaded as indicated. Recombinant proteins were detected with an anti-V5 monoclonal antibody.

Detection of Phex protein using polyclonal anti-Phex antiserum. We also examined the ability of our polyclonal Phex antiserum to detect Phex overexpressed in the baculovirus expression system in Sf9 cells and the retroviral expression system in E86 cells as well as endogenously expressed Phex in various cell lines and selected tissues. First, we documented the ability of our antiserum to detect Phex by immunoblot analysis of rPhex-WT in Sf9 cells. The Phex antiserum (Fig. 2A) detected the same product as the anti-V5 antibody (Fig. 1B) in Sf9 cells expressing rPhex-WT but failed to detect products in Sf9 control cells infected with vector alone. Similarly, immunoblot analysis with polyclonal anti-Phex antiserum detected the ~100-kDa product (as well as a smaller band likely representing a differentially glycosylated product) in E86 membranes transduced with the retroviral construct containing the nontagged Phex-WT (Fig. 2A). Next, we used this antiserum to confirm Phex expression in osteoblasts. We were able to immunoprecipitate the correct-size ~100-kDa product from MG63 osteoblasts with the anti-Phex antiserum (Fig. 2B). The detection required immunoprecipitation, since we did not see bands by Western blot analysis in any osteoblast cell line, including MC3T3-E1, Saos, MG63, or U2Os, when we used 150 µg of protein per lane (Fig. 2C). This likely reflects the low abundance of native Phex in osteoblasts.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   Phex detection by anti-Phex antiserum in Sf9 and E86 cells. A: Western blot analysis of membrane protein derived from Sf9 and E86 cells expressing vector alone or vector containing rPhex-WT. Membrane-derived protein fractions (30 µg) were subjected to SDS-PAGE (8% acrylamide) under reducing conditions and immunoblot analysis with the Phex polyclonal antiserum recognizing a COOH-terminal epitope. The polyclonal antiserum detects the ~100-kDa band (arrow) in Sf9 cells expressing the epitope-tagged Phex-WT as well as 2 bands likely representing differentially glycosylated products in E86 cells expressing nontagged Phex-WT. B: immunoprecipitation followed by Western blot analysis with anti-Phex antiserum. By immunoprecipitation-Western blot, we identified the correct-size ~100-kDa product from MG63 osteoblasts as well as Sf9 cells expressing rPhex-WT. C: Western blot analysis of total membrane derived from osteoblasts. Membrane-derived protein fractions (150 µg) were subjected to SDS-PAGE (8% acrylamide) under reducing conditions and immunoblot analysis with the Phex polyclonal antiserum recognizing a COOH-terminal epitope. Consistent with its low abundance, we failed to detect endogenous Phex expression in osteoblast cell lines.

Failure to confirm PTH as a physiological substrate for rPhex-WT protein. Because of recent reports suggesting that PTH is a substrate for rPhex (12), we examined PTH hydrolysis by uninfected Sf9 membranes (mock), membranes derived from Sf9 cells infected with the engineered baculovirus vector (vector alone), Sf9 membranes expressing rPhex-WT or rPhex-3'M, and affinity-purified recombinant Phex-WT protein. Endopeptidase activity was determined by analysis of PTH-(1-34) cleavage by reverse-phase HPLC (Fig. 3A). Although we observed no degradation of PTH-(1-34) in mock-infected Sf9 membranes, as indicated by the single larger peak at ~50 min (Fig. 3A, top), endopeptidase activity was evident after incubation with Sf9 membranes expressing rPhex-WT (Fig. 3A, bottom). Further analysis, however, found that membranes from Sf9 cells infected with the engineered baculovirus vector alone as well as the inactive rPhex-3'M construct also hydrolyzed PTH-(1-34) (Fig. 3B). Membranes treated with vector alone and rPhex-3'M membranes resulted in disappearance of the PTH-(1-34) peak and its replacement by several smaller peaks identical to that observed with rPhex-WT. Moreover, affinity purification of rPhex-WT resulted in the loss of endopeptidase activity (Fig. 3B), rather than the increase in activity that is expected from purification of Phex (Fig. 1C). EDTA, which should inhibit the Phex zinc metalloproteinases, also failed to inhibit PTH cleavage by baculovirus-expressing membranes (Table 1). Rather, the endopeptidase activity of membrane preparations from vector-alone and Phex-expressing membranes was inhibited by a cocktail of protease inhibitors (Table 1).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Hydrolysis of parathyroid hormone (PTH)-derived peptides by baculovirus expressing rPhex-WT and rPhex-3'M. A: PTH-(1-34) incubated with cell membrane preparations from mock-infected Sf9 cells (top) and PTH-(1-34) incubated with cell membrane preparations expressing Phex-WT (bottom). PTH hydrolysis was monitored by reverse-phase HPLC. B: comparison of enzymatic activity of rPhex-WT, inactive rPhex-3'M, and endogenous Phex in osteoblastic membranes. Although rPhex-WT cleaved PTH-(1-34), solubilized membranes containing vector alone also cleaved PTH, suggesting that the endopeptidase activity was derived from the baculovirus vector. Membranes from Sf9 cells expressing inactive Phex-3'M construct also hydrolyzed PTH-(1-34). Purified Phex lost its ability to cleave PTH, consistent with the presence of a nonspecific endopeptidase or loss of a cofactor. Membranes derived from MG63 osteoblasts, which express endogenous Phex, did not cleave PTH. Values are means ± SE of >= 3 determinations. Values sharing the same superscript (a and b) are not significantly different at P < 0.05. Protein concentrations used in the reactions approximated 30 µg in mock, vector-alone, and Phex-WT, 60 µg in Phex-3'M membranes, 15 µg in affinity-purified rPhex, and 60 µg in MG-63 membranes. C: bioactivity of hydrolyzed PTH-(1-34) in HEK cells transfected with the PTH receptor. Serial dilutions of PTH-(1-34) after incubation with membranes prepared from Sf9 expressing recombinant Phex-WT or membranes lacking Phex display similar stimulation of cAMP production.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Effects of protease inhibitors and EDTA on PTH-(1-34) hydrolysis by membranes derived from baculovirus-infected Sf9 cells

To eliminate the possibility that the epitope-tagged rPhex is responsible for the lack of enzymatic activity, we also examined the hydrolysis of PTH using non-epitope-tagged rPhex-WT protein derived from retroviral-mediated transduction of E86 membranes. Similar to Sf9 membranes, we observed high background cleavage by the membrane alone and failed to observe any differences in cleavage between rPhex-WT and inactive rPhex-3'M (data not shown). These findings suggest that the observed cleavage of PTH is due to nonspecific enzymatic activity derived from membrane preparations in our expression systems rather than the heterologously expressed Phex protein. Finally, solubilized membrane preparations from MG63 cells, which express Phex, failed also to cleave PTH (Fig. 3B).

To provide further evidence that the cleavage of PTH might not have biological relevance, we evaluated the bioactivity of the hydrolyzed PTH-(1-34). To accomplish this, we measured the ability of PTH-(1-34) to stimulate cAMP production in HEK cells transfected with the PTH receptor after incubation of serial dilutions of PTH with membranes prepared from Sf9 cells expressing recombinant Phex-WT or mock-infected Sf9 membranes (Fig. 3C). We found that the products of both enzymatic reactions had similar ability to stimulate cAMP production by the PTH receptor, indicating that the observed hydrolysis was not only nonspecific, but it did not alter the bioactivity of PTH. The activity is not due to residual PTH that is not cleaved, since incubations with progressively lower amounts of PTH added to the reaction mix displayed parallel reductions of cAMP stimulation from PTH incubated with Phex-expressing and control membranes.

STC-1 also is not a Phex substrate. We originally obtained the full-length human PHEX cDNA coding sequence from screening a human bone library (6). Using the same library, we isolated and cloned the full-length coding sequence of hSTC-1 using a PCR method. Sequencing of our PCR product revealed 100% identity to the published STC-1 sequence (accession no. U467768). The full-length cDNA encoding hSTC-1 was successfully cloned in pFastBac-V5-His vector in frame with V5 and His tag at its COOH terminus, and recombinant protein was secreted into the media of infected Sf9 cells. By Western blot analysis using anti-V5 antibody (Fig. 4), we identified a broad band at 30 kDa, which comprises three distinct bands derived from differential glycosylation of hSTC-1, as previously reported (32). We performed in vitro (Fig. 4A) and in vivo (Fig. 4B) analysis of rPhex-WT cleavage of hSTC-1. Incubation of isolated rhSTC-1 with rPhex-WT-containing membrane preparations did not result in hydrolysis of hSTC-1 (Fig. 4A). Similarly, coinfection of rPhex-WT with rhSTC-1 in Sf9 cells did not result in the appearance of degradation products in the supernatant of cultured, coinfected Sf9 cells (Fig. 4B).


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4.   Recombinant human stanniocalcin 1 (hSTC-1) is not cleaved by rPhex. A: Western blot analysis of in vitro studies in which recombinant hSTC-1 was incubated with solubilized membranes prepared from Sf9 cells expressing rPhex-WT or inactive rPhex-3'M or membranes derived from vector controls as described in METHODS. All expressed products were epitope tagged and detected using the anti-V5 antibody. hSTC-1 is represented by the 46-kDa broad band, rPhex-WT as the ~100-kDa product, and rPhex-3'M as the ~60-kDa product. Treatment with rPhex-WT, inactive rPhex-3'M, or membranes derived from vector controls did not cleave the 46-kDa hSTC-1. B: Western blot analysis of Sf9 culture supernatant after coexpression of hSTC-1 and rPhex in vivo. There was no evidence for degradation of hSTC-1 in the presence of rPhex-WT. hSTC-1 in the supernatant was similar in vector-infected and rPhex-WT- and rPhex-3'M-coexpressing Sf9 cells. hSTC-1 can be resolved into 3 distinct, differentially glycosylated bands.

Casein and FGF-23 peptide also are not Phex substrates. We tested the ability of mock-infected Sf9 membranes, membranes treated with vector alone, and Sf9 membranes expressing rPhex-WT or rPhex-3'M, as well as affinity-purified recombinant Phex-WT protein to hydrolyze a fluorescent quenched casein (Table 2). We chose to evaluate casein, since it is a substrate for several zinc metalloproteinases (13). For these studies, we also evaluated the effects of thermolysin, a related zinc metalloprotease, as a positive control. Whereas thermolysin resulted in a dose-dependent proteolysis of BODIPY TR-X-conjugated casein, we observed no hydrolysis of this substrate by any of our baculovirus-infected Sf9 membranes or rPhex protein.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Comparison of thermolysin and rPhex-WT-catalyzed hydrolysis of fluorescence-labeled casein

ADH, which has many similarities to XLH, is caused by mutations in FGF-23, a new member of the growing family of FGF proteins (28). It has been proposed that these disorders may share a common pathogenesis due to Phex cleavage of FGF-23 (21). If this is so, the R176Q and R179Q mutations of FGF-23 that substitute glutamine for arginine might alter the cleavage site of Phex. To test this possibility, we evaluated the ability of rPhex to cleave FGF-23-(172-186) and mutant FGF-23(R176Q;R179Q) peptides derived from the region of FGF-23 potentially representing a cleavage site. We failed to observed Phex-specific cleavage of FGF-23-(172-186) (Fig. 5) or FGF-23(R176Q;R179Q) peptides (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5.   Failure of FGF-23 peptide hydrolysis by rPhex. FGF-23-(172-186) peptide was incubated with cell membrane preparations from rPhex-3'M- and rPhex-WT-infected Sf9 cells. FGF-23-(172-186) hydrolysis was monitored by HPLC. We observed no evidence of rPhex-WT-specific hydrolysis of FGF-23-(172-186), as evidenced by the similar profiles after incubation with rPhex-WT (A) or rPhex-3'M (B).

Cleavage of [Leu]enkephalin by rPhex. Because the above-mentioned studies did not establish the activity of our membrane-associated Phex endopeptidase, we tested whether rPhex-WT degrades [Leu]enkephalin (Tyr-Gly-Gly-Phe-Leu), a substrate for the related NEP and thermolysin. NEP and thermolysin cleave [Leu]enkephalin at the Gly3-Phe4 bond, resulting in a faster-migrating Tyr-Gly-Gly peptide by HPLC analysis (31). [Leu]enkephalin alone migrated as a single peak (Fig. 6A). As expected, we observed a faster-migrating peak, likely representing the Tyr-Gly-Gly peptide, after incubating [Leu]enkephalin with thermolysin (Fig. 6B). A similar product was observed after treatment of [Leu]enkephalin with rPhex-WT (Fig. 6D) but not after incubation with membrane preparations transfected with vector alone (Fig. 6C). In addition, the cation-chelating agent EDTA completely inhibited the ability of rPhex-WT to hydrolyze [Leu]enkephalin (Fig. 6D), consistent with the fact that Phex is a zinc metalloproteinase.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6.   HPLC analysis of hydrolysis of [Leu]enkephalin ([Leu]Enk). A: [Leu]enkephalin analyzed in the absence of membranes shows migration of the uncleaved Try-Gly-Gly-Phe-Leu peptide (down-arrow ). B: incubation of [Leu]enkephalin with 4 × 10-4 U of thermolysin shows degradation of the substrate and shift of the peak representing the cleaved Tyr-Gly-Gly peptide (left-arrow ). C: incubation with vector-infected membranes shows no cleavage of the substrate. D: incubation with rPhex-WT-expressing membranes results in degradation of [Leu]enkephalin similar to thermolysin (left-arrow ). E: pretreatment with 20 mM EDTA inhibited degradation of the substrate by rPhex-WT, as evidenced by the rightward shift in the peak (right-arrow).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In this report, we evaluated experimental systems to overproduce rPhex. Our studies on heterologously expressed epitope-tagged rPhex in Sf9 insect cells by using baculovirus-based vectors (Fig. 1) and nontagged rPhex in E86 cells using a retroviral vector (Fig. 2) indicate that this endopeptidase is a ~100-kDa membrane-associated glycosylated protein. After deglycosylation, the molecular mass decreases to 86 kDa (Fig. 1C), which is the size predicted for the protein deduced from the cDNA sequence. In addition, we demonstrated that the Phex protein is expressed in MG63 osteoblast membranes by immunoprecipitation-Western blot using polyclonal antiserum against a synthetic peptide corresponding to the COOH-terminal region of Phex. The fact that immunoprecipitation was required to detect Phex in osteoblasts indicates that the endogenous endopeptidase is expressed in low abundance in cell culture models.

We used these recombinant proteins to evaluate potential substrates. We found that rPhex-WT cleaves the [Leu]enkephalin (Fig. 6). The HPLC profiles of [Leu]enkephalin degradation in the presence of rPhex-WT, the similar cleavage by thermolysin, and the sensitivity of this activity to ion chelation with EDTA strongly suggest that we have successfully overexpressed a functional rPhex protein in our Sf9 membrane preparations. To our knowledge, this is the first published report that a substrate for NEP can also be cleaved by the related Phex endopeptidase. This substrate should be useful for further studies evaluating Phex function.

We also evaluated whether PTH is a substrate for Phex. Although we demonstrated PTH cleavage, we found that PTH hydrolysis was not specific for rPhex. Rather, membranes derived from Sf9 cells infected with the baculovirus alone, rPhex-WT, and rPhex-3'M displayed similar activity (Fig. 3B). Endopeptidase activity toward PTH also was lost after affinity purification of Phex-WT and renewal of membranes (Fig. 3B). Moreover, nonspecific cleavage also was observed with membranes expressing non-epitope-tagged rPhex-WT as well as inactive rPhex-3'M. In addition, EDTA, which should inhibit the Phex zinc metalloproteinases, failed to inhibit PTH cleavage by baculovirus-expressing membranes (Table 1). Finally, the membrane-associated endopeptidase activity from membranes treated with vector alone and those expressing Phex was inhibited by a cocktail of protease inhibitors (Table 1). These findings suggest that the observed cleavage of PTH is due to nonspecific endopeptidase activity derived from membrane preparations rather than the heterologously expressed Phex protein.

Our results contrast with another report showing that membranes from COS-7 cells transiently expressing Phex degrade PTH (12). These studies, however, did not characterize the requirement for metal ions, evaluate the effects of inhibitors on endopeptidase activity, determine the cleavage site in PTH, attempt to evaluate the activity of purified Phex, or use inactive mutant rPhex as controls. There also are no follow-up studies that confirm Phex cleavage of PTH-(1-34). Nevertheless, by showing that hydrolysis of PTH can occur as a result of contaminating enzymes in membrane preparations, we raise the possibility of nonspecific cleavage. We also failed to identify any alterations of the bioactivity of PTH after hydrolysis of membrane preparations (Fig. 3C), indicating that the observed cleavage does not alter PTH function, whatever the responsible enzyme. These findings, as well as previous studies that indicate that PTH is not responsible for phosphaturia in XLH (16), indicate that PTH may not be a physiologically relevant Phex substrate.

Phex is expressed in osteoblasts, albeit in low abundance (Fig. 2B), and is associated with genes regulating extracellular matrix production and mineralization (9, 19). Therefore, Phex in bone may degrade local regulators of phosphate homeostasis and mineralization (21). On the basis of this reasoning, we evaluated whether the phosphate regulatory factor STC-1, which is expressed in bone, is a substrate for Phex. We confirmed previous reports (11) of the presence of STC-1 in bone by isolating and cloning its full coding sequence from a human osteoblast library from which we originally isolated PHEX (6). However, we were unable to demonstrate cleavage of our recombinant hSTC-1 by rPhex under the conditions studied (Fig. 4). Moreover, Phex cleavage of STC-1 would be paradoxical to our current view of the pathogenesis of XLH. Because STC-1 stimulates phosphate transport, its accumulation would cause hyperphosphatemia rather than hypophosphatemia. This, as well as our negative findings, suggests that hSTC-1 is not a physiologically relevant substrate for Phex.

The possibility that XLH and ADH may share a common pathogenesis gives rise to the notion that FGF-23 may represent a Phex substrate (21). Moreover, it is well established that other members of the related matrix metalloproteinase family modulate the activity of several growth factors, including FGF (14). The mutation of FGF-23 that causes ADH has been proposed to disrupt the cleavage site in FGF-23 for Phex (21). Although we have not evaluated the full-length FGF-23 protein, we have demonstrated that the peptide encompassing the region mutated in ADH is not a substrate for Phex (Fig. 5).

In conclusion, the investigation of the pathogenesis of XLH, ADH, and OHO indicates a role for the Phex endopeptidase and novel factors regulating phosphate homeostasis. In an effort to provide evidence for a common pathogenesis for these disorders, we have created wild-type and mutated recombinant Phex proteins and used them to evaluate various candidate substrates. We have shown that the insect cell-based baculovirus system and retroviral-mediated overexpression are well suited for expression and glycosylation of rPhex. We have demonstrated that [Leu]enkephalin is a substrate for rPhex, but we were unable to show that FGF-23, hSTC-1, PTH, and casein are substrates for our rPhex protein. Rather, we have demonstrated the potential of coisolated enzymes in membrane preparations to confound interpretations of enzyme specificity. In the larger context of understanding the pathophysiology of these hypophosphatemic disorders, however, our negative studies are important. With regard to ADH, our findings suggest alternatives to a simple enzyme-substrate hypothesis where FGF-23 is a Phex substrate. Rather, our studies suggest a more complex model whereby FGF-23 is not a PHEX substrate but causes phosphaturia indirectly by altering the production of the PHEX substrate (i.e., phosphatonin) and/or the activity of PHEX itself. Possible support for this is derived from recent studies demonstrating regulation of Phex expression in bone by insulin-like growth factor I (33). Our inability to demonstrate cleavage of the FGF-23 peptide may also mean that ADH and XLH cause renal phosphate wasting through distinct pathways. With regard to XLH, we have excluded PTH and hSTC-1 as physiological substrates for Phex. On the basis of our findings of Phex protein expression in osteoblasts, the possibility remains that Phex substrates may exist in bone. Nevertheless, our results indicate that the pathogenic mechanisms underlying ADH and XLH are more complex than originally anticipated. Further advances in our knowledge of the biological function of FGF-23 as well as identification of Phex substrates are needed to piece together the pathogenesis of these phosphate-wasting disorders.


    ACKNOWLEDGEMENTS

We thank Dr. Patrick J. Casey for assistance with the baculoviral expression of Phex and Patrick Flannery for technical support.


    FOOTNOTES

This work was supported in part by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant AR-45955.

Address for reprint requests and other correspondence: L. D. Quarles, Box 3036, Duke University Medical Center, Durham, NC 27710 (E-mail: Quarl001{at}mc.duke.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 30 January 2001; accepted in final form 17 May 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Beck, L, Soumounou Y, Martel J, Krishnamurthy G, Gauthier CG, Goodyer C, and Tenenhouse HS. Pex/PEX tissue distribution and evidence for a deletion in the 3' region of the Pex gene in X-linked hypophosphatemic mice. J Clin Invest 99: 1200-1209, 1997[Web of Science][Medline].

2.   Blydt-Hansen, TD, Tenenhouse HS, and Goodyer P. PHEX expression in parathyroid gland and parathyroid hormone dysregulation in X-linked hypophosphatemia. Pediatr Nephrol 13: 607-611, 1999[Web of Science][Medline].

3.   Chang, XB, Hou YX, and Riordan JR. ATPase activity of purified multidrug resistance-associated protein. J Biol Chem 272: 30962-30968, 1997[Abstract/Free Full Text].

4.   Ecarot, B, Glorieux MH, Desbarats M, Travers R, and Labelle L. Defective bone formation by Hyp mouse bone cells transplanted into normal mice: evidence in favor of an intrinsic osteoblast defect. J Bone Miner Res 7: 215-220, 1992[Web of Science][Medline].

5.   Garner, SC, Hinson TK, McCarty KS, Leight M, Leight GS, Jr, and Quarles LD. Quantitative analysis of the calcium-sensing receptor messenger RNA in parathyroid adenomas. Surgery 122: 1166-1175, 1997[Web of Science][Medline].

6.   Guo, R, and Quarles LD. Cloning and sequencing of human PEX from a bone cDNA library: evidence for its developmental stage-specific regulation in osteoblasts. J Bone Miner Res 12: 1009-1017, 1977.

7.   Harlow, E, and Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1988, p. 471-510.

8.   Howrey, RP, El-Alfondi M, Phillips KL, Wilson L, Rooney B, Lan N, Sullenger B, and Smith C. An in vitro system for efficiently evaluating gene therapy approaches to hemoglobinopathies. Gene Ther 7: 215-223, 2000[Web of Science][Medline].

9.   Hruska, KA, Rifas L, Cheng SL, Gupta A, Halstead L, and Avioli L. X-linked hypophosphatemic rickets and the murine Hyp homologue. Am J Physiol Renal Fluid Electrolyte Physiol 268: F357-F362, 1995[Abstract/Free Full Text].

10.   HYP Consortium. A gene (Pex) with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets. Nat Genet 11: 130-136, 1995[Web of Science][Medline].

11.   Jiang, WQ, Chang AC, Satoh M, Furuichi Y, Tam PP, and Reddel RR. The distribution of stanniocalcin 1 protein in fetal mouse tissues suggests a role in bone and muscle development. J Endocrinol 165: 457-466, 2000[Abstract].

12.   Lipman, ML, Dibyendu P, Hugh PJ, Bennett JE, Henderson ES, Yingnian S, Goltzman D, and Karaplis AC. Cloning of human Pex cDNA: expression, subcellular localization, and endopeptidase activity. J Biol Chem 273: 13729-13737, 1998[Abstract/Free Full Text].

13.   Lohi, JL, Wilson CL, Roby JD, and Parks WC. Epilysin: a novel human matrix metalloproteinase (MMP-27) expressed in testis and keratinocytes and in response to injury. J Biol Chem 276: 10134-10144, 2001[Abstract/Free Full Text].

14.   Manes, S, Llorente M, Lacalle RA, Gomez-Mouton C, Kremer L, Mira E, and Martinez AC. The matrix metalloproteinase-9 regulates the insulin-like growth factor-triggered autocrine response in DU-145 carcinoma cells. J Biol Chem 274: 6935-6945, 1999[Abstract/Free Full Text].

15.   Maniatis, T, Fritsch EF, and Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.

16.   Meyer, RA, Tenenhouse HS, Jr, Meyer MH, and Klugerman AH. The renal phosphate transport defect in normal mice parabiosed to X-linked hypophosphatemic mice persists after parathyroidectomy. J Bone Miner Res 4: 523-532, 1989[Web of Science][Medline].

17.   Min, P, Hinson TK, and Quarles LD. Failure to detect the extracellular calcium sensing receptor (CasR) in human osteoblast cell lines. J Bone Miner Res 14: 1310-1319, 1999[Web of Science][Medline].

18.   Miyamura, T, Tanaka H, Inoue M, Ichinose Y, and Seino Y. The effects of bone marrow transplantation on X-linked hypophosphatemic mice. J Bone Miner Res 15: 1451-1458, 2000[Web of Science][Medline].

19.   Nesbitt, T, Coffman TM, Griffiths R, and Drezner MK. Cross transplantation of kidneys in normal and Hyp mice. Evidence that the Hyp mouse phenotype is unrelated to an intrinsic renal defect. J Clin Invest 89: 1453-1459, 1992.

20.   Nesbitt, T, Econ MK, Bun MK, Martel J, Tenenhouse HS, Jr, and Drezner MK. Phosphate transport in immortalized cell cultures from the renal proximal tubule of normal and Hyp mice: evidence that the Hyp gene locus product is an extralegal factor. J Bone Miner Res 10: 1327-1333, 1995[Web of Science][Medline].

21.   Quarles, LD, and Drezner MK. The pathophysiology of XLH, ADH, and TOM: a perPHEXing problem. J Clin Endocrinol Metab 86: 494-496, 2001[Free Full Text].

22.   Rowe, PS, de Zoysa PA, Dong R, Wang HR, White KE, Econs MJ, and Oudet CL. MEPE, a new gene expressed in bone marrow and tumors causing osteomalacia. Genomics 67: 54-68, 2000[Web of Science][Medline].

23.   Salomon, Y, Londos C, and Rodbell M. A highly sensitive adenylate cyclase assay. Anal Biochem 58: 541-548, 1974[Web of Science][Medline].

24.   Shimada, K, Takahashi M, Turner AJ, and Tanzawa K. Rat endothelin-converting enzyme-1 forms a dimer through Cys-412 with a similar catalytic mechanism and a distinct substrate binding mechanism compared with neutral endopeptidase-24.11. J Biochem (Tokyo) 315: 863-867, 1996.

25.   Turner, AJ, and Tanzawa K. Mammalian membrane metallopeptidases---NEP, ESE, FELL, and PEX. FASEB J 11: 355-364, 1977[Abstract].

26.   Varghese, R, Wong CK, Deol H, Wagner GF, and DiMattia GE. Comparative analysis of mammalian stanniocalcin genes. Endocrinology 139: 4714-4725, 1998[Abstract/Free Full Text].

27.   Weinman, EJ, Steplock D, Tate K, Hall RA, Spurney RF, and Shenolikar S. Structure-function of recombinant Na/H exchanger regulatory factor (NHE-RF). J Clin Invest 101: 2199-2206, 1998[Web of Science][Medline].

28.   White, KE, Evans WE, O'Riordan JL, Speer MC, Econs MJ, Lorenz-Depiereux B, Grabowski M, Meitinger T, and Strom TM. Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nat Genet 26: 345-348, 2000[Web of Science][Medline].

29.   White, KE, Jonsson DG, Carn G, Hampson G, Spector TD, Mannstadt M, Lorenz-Depiereux B, Miyauchi A, Yang IM, Ljunggren O, Meitinger T, Strom TM, Juppner H, and Econs MJ. The autosomal dominant hypophosphatemic rickets (ADHR) gene is a secreted polypeptide overexpressed by tumors that cause phosphate wasting. J Clin Endocrinol Metab 86: 497-500, 2001[Abstract/Free Full Text].

30.   Xiao, ZS, Creashak M, Guo R, Nesbitt T, Drezner MK, and Quarles LD. Intrinsic mineralization defect in Hyp mouse osteoblasts. Am J Physiol Endocrinol Metab 275: E700-E708, 1998[Abstract/Free Full Text].

31.   Zappulla, JP, Wickham L, Bawab W, Yang X-F, Storozhuk MV, Castellucci VF, and DesGroseillers L. Cloning and characterization of Aplysia neutral endopeptidase, a metallo-endopeptidase involved in the extracellular metabolism of neuropeptides in Aplysia californica. J Neurosci 19: 4280-4292, 1999[Abstract/Free Full Text].

32.   Zhang, J, Alfonso P, Thotakura NR, Jeffrey S, Buergin M, Parmelee D, Collins AW, Oelkuct M, Gaffney S, Gentz S, Radman DP, Wagner GF, and Gentz R. Expression, purification, and bioassay of human stanniocalcin from baculovirus-infected insect cells and recombinant CHO cells. Protein Expr Purif 12: 390-398, 1998[Web of Science][Medline].

33.   Zoidis, E, Zapf J, and Schmid C. Phex cDNA cloning from rat bone and studies of Phex mRNA express tissue specificity, age dependency, and regulation by insulin-like growth factor (IGF) I in vivo. Mol Cell Endocrinol 168: 41-51, 2000[Web of Science][Medline].


Am J Physiol Endocrinol Metab 281(4):E837-E847
0193-1849/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Liu, J. Zhou, W. Tang, R. Menard, J. Q. Feng, and L. D. Quarles
Pathogenic role of Fgf23 in Dmp1-null mice
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E254 - E261.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. Liu and L. D. Quarles
How Fibroblast Growth Factor 23 Works
J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1637 - 1647.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. Liu, W. Tang, J. Zhou, J. R. Stubbs, Q. Luo, M. Pi, and L. D. Quarles
Fibroblast Growth Factor 23 Is a Counter-Regulatory Phosphaturic Hormone for Vitamin D
J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1305 - 1315.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Syal, S. Schiavi, S. Chakravarty, V. Dwarakanath, R. Quigley, and M. Baum
Fibroblast growth factor-23 increases mouse PGE2 production in vivo and in vitro
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F450 - F455.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
T. J. Berndt, S. Schiavi, and R. Kumar
"Phosphatonins" and the regulation of phosphorus homeostasis
Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1170 - F1182.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
S. M. Jan de Beur
Tumor-Induced Osteomalacia
JAMA, September 14, 2005; 294(10): 1260 - 1267.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Baum, O. W. Moe, J. Zhang, V. Dwarakanath, and R. Quigley
Phosphatonin washout in Hyp mice proximal tubules: evidence for posttranscriptional regulation
Am J Physiol Renal Physiol, February 1, 2005; 288(2): F363 - F370.
[Abstract] [Full Text] [PDF]


Home page
CROBMHome page
P. S.N. Rowe
THE WRICKKENED PATHWAYS OF FGF23, MEPE AND PHEX
Critical Reviews in Oral Biology & Medicine, September 1, 2004; 15(5): 264 - 281.
[Abstract] [Full Text] [PDF]


Home page
CROBMHome page
C. Qin, O. Baba, and W.T. Butler
POST-TRANSLATIONAL MODIFICATIONS OF SIBLING PROTEINS AND THEIR ROLES IN OSTEOGENESIS AND DENTINOGENESIS
Critical Reviews in Oral Biology & Medicine, May 1, 2004; 15(3): 126 - 136.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Liu, R. Guo, L. G. Simpson, Z.-S. Xiao, C. E. Burnham, and L. D. Quarles
Regulation of Fibroblastic Growth Factor 23 Expression but Not Degradation by PHEX
J. Biol. Chem., September 26, 2003; 278(39): 37419 - 37426.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
Y. Kida, S. Fukumoto, T. Yamashita, K. Jonsson, M. Econs, and H. Juppner
Fibroblast Growth Factor 23 in Oncogenic Osteomalacia and X-Linked Hypophosphatemia
N. Engl. J. Med., July 31, 2003; 349(5): 505 - 506.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. D. Quarles
FGF23, PHEX, and MEPE regulation of phosphate homeostasis and skeletal mineralization
Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E1 - E9.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H. S. Tenenhouse and H. Murer
Disorders of Renal Tubular Phosphate Transport
J. Am. Soc. Nephrol., January 1, 2003; 14(1): 240 - 247.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (40)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, R.
Right arrow Articles by Quarles, L. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, R.
Right arrow Articles by Quarles, L. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online