|
|
||||||||
Division of Gastroenterology and Hepatology, 1 Department of Medicine and 2 Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, South Carolina 29425
| |
ABSTRACT |
|---|
|
|
|---|
We tested the hypothesis that leptin, in addition to reducing body fat by restraining food intake, reduces body fat through a peripheral mechanism requiring uncoupling protein 1 (UCP1). Leptin was administered to wild-type (WT) mice and mice with a targeted disruption of the UCP1 gene (UCP1 deficient), while vehicle-injected control animals of each genotype were pair-fed to each leptin-treated group. Leptin reduced the size of white adipose tissue (WAT) depots in WT mice but not in UCP1-deficient animals. This was accompanied by a threefold increase in the amount of UCP1 protein and mRNA in the brown adipose tissue (BAT) of WT mice. Leptin also increased UCP2 mRNA in WAT of both WT and UCP1-deficient mice but increased UCP2 and UCP3 mRNA only in BAT from UCP1-deficient mice. These results indicate that leptin reduces WAT through a peripheral mechanism requiring the presence of UCP1, with little or no involvement of UCP2 or UCP3.
| |
INTRODUCTION |
|---|
|
|
|---|
MITOCHONDRIAL OXIDATION of fatty acids creates a proton electrochemical gradient that is used to drive the conversion of ADP to ATP via ATP synthase (22). Brown adipose tissue (BAT) mitochondria possess an alternative pathway that allows protons to reenter the mitochondrial matrix without coupling to ATP synthesis (2), and this pathway is mediated by uncoupling protein 1 (UCP1). UCP1 transforms electrochemical energy into heat (24), enabling small mammals to tolerate cold exposure (9, 15). The sympathetic nervous system and UCP1 are essential components of this thermogenic response system (8, 31).
Recent work illustrates that thermogenesis is also induced by increased caloric intake, suggesting a potential role for BAT in maintaining energy balance during dietary challenges (26, 29). This concept was originally supported by the finding that mice with toxigene-mediated ablation of BAT were obese and more prone to morbid obesity when fed high-calorie diets (13, 20). In view of these findings and the established role of UCP1 in thermogenesis, it was surprising to find that mice with a targeted disruption of the Ucp1 gene (UCP1 deficient) were not obese and no more prone to obesity than control mice when fed high-fat diets (8). Some evidence suggested that compensatory thermogenic mechanisms may have been induced in these mice (8), so we sought to determine whether the absence of UCP1 would compromise the ability of leptin to target and reduce white adipose tissue depots. This approach is based on the hypothesis that leptin regulates in vivo rates of energy utilization through modulation of one or more of the uncoupling proteins. Using pair-fed wild-type (WT) and UCP1-deficient mice injected with vehicle or leptin, we show that UCP1 is required for leptin to decrease adipose tissue mass beyond the amount produced by its effect on food intake.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
All reagents, except where noted, were obtained from Sigma and were of
the highest reagent grade. T1-RNase and TRIzol LS reagent were from
Life Technologies (Gaithersburg, MD). The T7-Megashortscript and
RNALater kits were purchased from Ambion (Austin, TX).
-[32P]CTP and 125I-labeled NaI were
purchased from Du Pont-NEN Radiochemicals (Boston, MA). Immobilon-P
polyvinylidene difluoride membranes were from Millipore (Bedford, MA).
Recombinant methionyl mouse leptin was kindly provided by Amgen
(Thousand Oaks, CA).
Experimental animal protocol.
Breeding pairs of mice heterozygous (+/
) for a targeted disruption of
the Ucp1 gene (8) were provided by Dr.
Leslie Kozak (Pennington Biomedical Research Center, Baton Rouge, LA).
The mice were bred within the vivarium at the Medical University of South Carolina to establish a free-standing colony of homozygous UCP1-deficient (
/
) and WT mice (+/+) to serve as
controls. Genotyping of individual offspring was performed by PCR by
use of primers designed to amplify the region of exon 2, where presence
of the neomycin resistance gene identifies mutant mice (5' to 3'; exon 2 forward, ggtagtatgcaagagaggtgt, 5' to 3'; exon 2 reverse,
cctaatggtactggaagcctg, 5' to 3'; neomycin reverse,
cctacccgcttgcattgctca). Because of the temperature sensitivity of the
mice, the colony was housed at 25-27°C. Mouse chow (Purina mouse
chow, Ralston Purina, St. Louis, MO) and water were available ad
libitum, and the lights were on a 12:12-h light-dark cycle.
/
) and WT (+/+) mice were
assigned to receive either leptin (20 µg · g body
wt
1 · day
1) or vehicle (100 µl
sterile saline) for 8 days. The mice receiving saline were pair fed
(PF) to individual leptin-injected mice of the same genotype, and each
pair of mice (vehicle- and leptin-treated) was selected to be age and
weight matched. The mice were housed individually in cages with raised
wire flooring to facilitate recovery of spilled food. For a period of 7 days before the study began, mice were monitored daily for food intake,
food spillage, and body weight. For an additional period of 7 days, all
mice were given intraperitoneal injections of vehicle 2 h before
the start of the dark cycle to acclimate the animals to handling and injection. After the 7th day of saline injections and for 8 days thereafter, UCP1-deficient and WT mice received either leptin (20 µg · g body wt
1 · day
1)
or vehicle (100 µl). All injections were given intraperitoneally and
performed 2 h before the start of the dark cycle. Mice treated with leptin were provided with a preweighed amount of food known to be
in excess of daily consumption. At the time of leptin injection the
following day, spilled and remaining food was recovered and weighed,
body weights were recorded, and preweighed food was again provided.
Accounting for the amount of spilled food allowed vehicle-treated mice
to be pair fed the actual amount of food consumed by the mouse
receiving leptin with which it was paired. PF mice continued to receive
a daily injection of saline at the time body weights and food intake
were recorded. On the morning after the eighth leptin injection,
UCP1-deficient and WT mice were killed. Interscapular BAT, as well as
epididymal, retroperitoneal, and inguinal white adipose tissue (WAT)
depots, were carefully dissected free of surrounding tissue, weighed,
and processed for isolation of total RNA or preparation of mitochondria.
RNase protection assay. RNA probes complementary to UCP1, UCP2, and UCP3 mRNA were prepared, labeled, and used as previously described to quantitate the respective mRNA species (4, 6, 32).
Mitochondrial preparation and Western blotting of UCP1. Isolation and extraction of mitochondria, followed by Western blotting of UCP1 in mitochondrial extracts, were performed on contralateral brown fat pads, as we have described in detail previously (6).
Methods of analysis. The concentrations of UCP1, UCP2, UCP3, and leptin mRNA in each sample were determined by reverse calibration from standard curves as previously described (6). One-way ANOVA was used to compare the means of each response variable. The level of protection against type I errors was set at 5%. P values for specific treatment comparisons of interest are presented in RESULTS.
| |
RESULTS |
|---|
|
|
|---|
Effect of leptin on food intake, body weight, and WAT depot
weights.
Exogenous leptin caused a significant (P < 0.01)
decrease in food intake from 4.04 ± 0.14 to 3.19 ± 0.11 g food · day
1 · g body
wt
1 in WT mice and a decrease from 4.00 ± 0.09 to
3.39 ± 0.09 g food · day
1 · g
body wt
1 in UCP1-deficient mice. Total food consumption
in the respective PF groups [WT, 24.2 ± 2.3 g;
UCP1-deficient "knockout" (KO), 24.2 ± 2.7 g] was
essentially identical to the leptin-injected groups (WT, 25.5 ± 1.9 g; UCP1-deficient KO, 27.2 ± 2.1 g), as intended. The initial body weights of WT (28.2 ± 3.6 g) and
UCP1-deficient mice (27.7 ± 3.1 g) were similar, and
comparable reductions in food consumption among the groups produced
corresponding weight reductions in WT (vehicle-PF, 25.3 ± 3.4 g; leptin, 26.6 ± 2.7 g) and UCP1-deficient mice
(vehicle-PF, 23.6 ± 2.4 g; leptin, 26.8 ± 3.4 g).
These data provided no evidence that leptin induced weight loss in
excess of that observed in the PF mice. Fat pad weights from age- and
weight-matched mice of each genotype killed before the study were
similar (data not shown). To assess the importance of UCP1 to leptin's
effects on fat pad size independent of leptin's effects on food
intake, the change in weight of the three WAT depots produced by leptin
was expressed relative to that of the PF controls for each genotype.
Figure 1 illustrates that leptin induced
a significant decrease (P < 0.01) in size of all three
depots examined in WT mice. In contrast, Fig. 1 shows that the same fat
pads were unaffected by leptin in the UCP1-deficient mice. The lack of
a change in white fat pad weights from UCP1-deficient mice indicates
that the effectiveness of leptin in reducing adiposity is compromised
in the absence of UCP1.
|
UCP1 expression in BAT and WAT.
UCP1 expression was examined in BAT mitochondrial extracts from each
group to confirm that leptin increased UCP1 protein levels in WT mice
and to establish that UCP1 was not expressed in mice identified as UCP1
knockouts. Results presented in Fig. 2
demonstrate that UCP1 is absent in mitochondrial extracts from mice
identified as UCP1 deficient. Figure 2 also shows that leptin induced a
significant threefold increase in UCP1 expression in BAT from WT mice
(P < 0.01). Measurements of UCP1 mRNA in the
contralateral brown fat pads from each animal revealed that leptin
increased UCP1 mRNA by an amount (4-fold) that was comparable to the
increase in protein expression noted above (data not shown).
|
Effect of leptin on UCP2 and UCP3 mRNA in BAT.
The initial description of UCP1-deficient mice (8)
indicated that UCP2 mRNA was upregulated in BAT. We wanted to
quantitate the reported difference in UCP2 mRNA between the genotypes
and test for differences in the responses of UCP2 and UCP3 to leptin between the groups. Figure 3A
shows that UCP2 mRNA was significantly higher (P < 0.01) in PF UCP1-deficient mice (0.125 ± 0.011 fmol/µg RNA)
than in their PF WT controls (0.057 ± 0.002 fmol/µg RNA). Leptin had no effect on UCP2 mRNA in WT mice (0.051 ± 0.006 fmol/µg RNA) but produced a significant (P < 0.01)
twofold increase in UCP2 mRNA to 0.246 ± 0.042 fmol/µg RNA in
UCP1-deficient mice (Fig. 3A). A similar pattern was seen
with UCP3 in BAT, with the notable exception that UCP3 mRNA levels were
similar between PF WT (0.109 ± 0.017 fmol mRNA/µg RNA) and PF
UCP1-deficient mice (0.135 ± 0.013 fmol mRNA/µg RNA). As with
UCP2, leptin failed to increase UCP3 in WT mice but produced a twofold
increase in UCP3 mRNA in BAT from UCP1-deficient mice (0.217 ± 0.032 fmol/µg RNA, P < 0.01). These results
establish that UCP2 and UCP3 mRNA levels are significantly higher in
BAT from UCP1-deficient than from WT mice after leptin treatment, and
they suggest that the altered regulation of UCP2 and UCP3 may be a
mechanism to compensate for the absence of UCP1.
|
Effect of leptin on UCP2 and UCP3 mRNA in epididymal WAT The original work with UCP1-deficient mice failed to detect an upregulation of UCP2 mRNA in WAT (8). However, on the basis of the specific effects of leptin on WAT, we tested the idea that differences in the upregulation of UCP2 by leptin might explain leptin's differential effects on adiposity between the groups. As predicted, UCP2 mRNA levels in epididymal WAT (EWAT) did not differ between PF mice of each genotype (WT, 0.033 ± 0.005 fmol/µg RNA; UCP1 deficient, 0.036 ± 0.004 fmol/µg RNA, Fig. 3B). The responses to leptin were similar in that leptin produced a significant (P < 0.01) increase in UCP2 mRNA in both WT (0.062 ± 0.007 fmol/µg RNA) and UCP1-deficient mice (0.051 ± 0.005 fmol/µg RNA). The levels of UCP3 mRNA in EWAT were similar between control animals in each genotype and were unaffected by leptin treatment (Fig. 3B). Thus differences in the induction of UCP2 or UCP3 by leptin are not likely to be responsible for the differential effects of leptin on adiposity between the genotypes.
Skeletal muscle is also a significant site for UCP3 expression, so we compared UCP3 mRNA levels in skeletal muscle of control and leptin-treated animals of each genotype. As in other tissues, the aim was to test whether compensatory upregulation of UCP3 could account for differences in adiposity among the treatment groups. Figure 4 indicates that UCP3 mRNA levels did not differ between WT and UCP1-deficient mice. In addition, leptin treatment had no discernible effect on UCP3 mRNA in either group (Fig. 4). Taken together, these results indicate that group differences in basal or stimulated levels of UCP2 and/or UCP3 mRNA cannot account for the differential reductions in WAT size produced by leptin between the genotypes. And although the absence of UCP1 had no apparent effect on WAT size in control animals, its absence blocked the specific reduction in WAT mass that was produced by leptin in WT mice.
|
| |
DISCUSSION |
|---|
|
|
|---|
The sole known function of uncoupling proteins is to transform
energy contained in the mitochondrial proton electrochemical gradient
into heat (24). The metabolic consequence of this
thermogenic process is decreased coupling efficiency between fatty acid
oxidation and ATP formation. Given that the leak of protons across the
inner mitochondrial membrane has been estimated to account for between 15 and 35% of basal metabolic rate (1, 25), modulation of UCP expression and/or function has the potential to have major effects
on energy balance and fat deposition. Various approaches have been used
to test this concept, including a recent study showing that
overexpression of UCP1 from the aP2 gene promoter reduced genetically
determined obesity in mice and conferred resistance to diet-induced
obesity (18, 19). In another approach, targeted disruption
of the RII
-subunit of protein kinase A (PKA) led to upregulation of
the more readily activated RI
-isoform in adipose tissue
(7). The increased sensitivity of the RI
isoform to cAMP induced ectopic UCP1 expression in WAT, decreased WAT mass, and
prevented diet-induced obesity (7). Overexpression of the
1-adrenoceptor in adipose tissue produced a similar
upregulation of UCP1 expression and resistance to obesity
(28). The findings from these studies show that direct
overexpression of UCP1 or enhancement of adrenergic stimulation of
adipose tissue produces a common lean, obesity-resistant phenotype.
Based on the well established observation that leptin induces UCP1
expression, the major goal of the present study was to determine
whether UCP1 is an essential component of the mechanism used by leptin
to reduce WAT stores. Findings from the present study confirm the
requirement for UCP1 and provide no evidence to support the involvement
of UCP2 and/or UCP3 in the response.
Peripheral or central administration of leptin regulates gene
expression in adipose tissue through modulation of sympathetic tone and
activation of
-adrenoceptors (5, 6, 32). The respiratory quotient is also decreased by leptin (16, 17), and the associated increases in fat oxidation, oxygen consumption, and
release of free fatty acids indicate that these responses are
coordinated elements of the mechanism used to decrease adipose tissue
stores. Although not detected in the present study, previous work has
shown that UCP1 expression can be induced in specific WAT depot sites
by leptin or other physiological cues that activate the sympathetic
nervous system (6, 12). The heritability of this
characteristic was documented by study of recombinant inbred strains of
mice produced from backcrossing two strains with low and high
expression of the trait (12). The UCP1-deficient mice used
here were developed on the B/6 background, which has low potential for
expression of UCP1 in WAT (8, 12). The already low
expression of UCP1 in this mouse strain was likely compounded by the
slightly older mice and higher housing temperature used in the present
study (27°C). On the basis of results from mice reared at
22-23°C, we suggested previously that increased expression of
UCP1 in WAT from responsive strains might allow significant in situ fat
oxidation to occur in response to leptin (6). However, the
absence of leptin-induced UCP1 expression in WAT from control mice
here, coupled with the uniform decreases in size among the WAT depots,
supports a different mechanism. It seems more likely that the
leptin-mediated increase in fat oxidation documented by Hwa and
colleagues (16, 17) could be occurring in BAT or muscle
after mobilization and transfer of fatty acids from WAT. However,
despite the potential significance of skeletal muscle as a site for
lipid oxidation, the present results imply that BAT is the primary
metabolic sink for mobilized lipid.
The concept that thermogenesis requires the participation of both BAT
and WAT is supported by Grujic et al. (11), who showed that transgenic reexpression of
3-adrenoceptors in both
BAT and WAT was required to restore a full thermogenic response in
3-KO mice. Taken together, these findings indicate that
WAT is targeted by leptin by virtue of its role as a fuel source for
the thermogenic process.
UCP1-deficient mice are cold intolerant but do not develop obesity when
provided either standard mouse chow or a highly palatable diet
(8). This finding and a similar one in dopamine
-hydroxylase-deficient mice (31) suggest that the
absence of UCP1 can be compensated for by alternative thermogenic
components. UCP2 and UCP3 are likely candidates given their broad
tissue distribution, and it is interesting to note that UCP2 mRNA was
upregulated in BAT from both studies (8, 31). We also
found increased UCP2 mRNA in BAT from UCP1-deficient mice, but our
comparisons of UCP3 mRNA in BAT and skeletal muscle found no difference
between control and transgenic mice. Resistance to diet-induced obesity
has been associated with upregulation of UCP2 in WAT (30,
32), but it remains to be established whether UCP2 is
responsible for the leanness of UCP1-deficient mice.
In the present experiments, the important questions are whether leptin differentially affects UCP2 and/or UCP3 expression between control and transgenic animals and whether UCP2 and/or UCP3 can actually serve as uncouplers. In WAT, we found similar initial levels and a similar twofold induction of UCP2 mRNA in both groups. The responses in BAT were different in the sense that UCP1-deficient mice increased both UCP2 and UCP3 mRNA in response to leptin, whereas leptin did not affect either variable in the control mice. Therefore, if UCP2 and UCP3 were contributing to increased fat oxidation, leptin should be effective in reducing fat pad weights in the UCP1-deficient mice. Our results indicate that group differences in neither basal nor stimulated levels of UCP2 and/or UCP3 mRNA can account for the differential reductions in WAT size produced by leptin between the genotypes. An additional perspective on this issue is provided by the recent work of Matthias et al. (21) who showed that UCP1, but not UCP2 and UCP3, was the only uncoupling protein able to convey a thermogenic response to adrenergic stimulation in BAT. On the basis of the documented involvement of the sympathetic nervous system in mediating effects of leptin in BAT (4, 14, 27), the conclusion of Matthias et al. is consistent with our conclusion that UCP1 is required for leptin action. And although the absence of UCP1 had no apparent effect on WAT size in vehicle-treated mice, its absence blocked the specific reduction in WAT mass that was produced by leptin in WT mice. Taken together, our findings support the hypothesis that leptin stimulates energy utilization and fat oxidation by acutely activating thermogenesis and enhancing thermogenic capacity through increased UCP1 expression.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge the excellent technical assistance of Rudy Beiler. We thank Dr. Leslie Kozak for kindly providing the mice used in this study, and Amgen for providing the recombinant mouse leptin.
| |
FOOTNOTES |
|---|
This research was supported by National Institutes of Health Grants DK-53981 (to T. W. Gettys) and training Grant GM-08716 (to S. P. Commins) and US Department of Agriculture NRICGP Grant 9800699 (to T. W. Gettys).
Address for reprint requests and other correspondence: T. W. Gettys, 916-G Clinical Science Bldg., MUSC, 96 Jonathan Lucas St., Charleston, SC 29425 (E-mail: gettystw{at}musc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 29 September 2000; accepted in final form 16 October 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Brand, MD,
Brindle KM,
Buckingham JA,
Harper JA,
Rolfe DFS,
and
Stuart JA.
The significance and mechanism of mitochondrial proton conductance.
Int J Obes
23:
S4-S11,
1999.
2.
Cannon, B,
and
Lindberg O.
Mitochondria from brown adipose tissue: isolation and properties.
Methods Enzymol
55:
65-78,
1979[Medline].
3.
Collins, S,
Daniel KW,
Petro AE,
and
Surwit RS.
Strain-specific response to
3-adrenergic receptor agonist treatment of diet-induced obesity in mice.
Endocrinology
138:
405-413,
1997
4.
Commins, SP,
Marsh DJ,
Thomas SA,
Watson PM,
Padgett MA,
Palmiter RD,
and
Gettys TW.
Norepinephrine is required for leptin effects on gene expression in brown and white adipose tissue.
Endocrinology
140:
4772-4776,
1999
5.
Commins SP, Watson PM, Levin N, Beiler RJ, and Gettys TW. Central
leptin regulates the UCP1 and ob genes in brown
and white adipose tissue via different
-adrenoceptor subtypes.
J Biol Chem In press.
6.
Commins, SP,
Watson PM,
Padgett MA,
Dudley A,
Argyropoulos G,
and
Gettys TW.
Induction of uncoupling protein expression in brown and white adipose tissue by leptin.
Endocrinology
140:
292-300,
1999
7.
Cummings, DE,
Brandon EP,
Planas JV,
Motamed K,
Idzerda R,
and
McKnight GS.
Genetically lean mice result from targeted disruption of the RII
subunit of protein kinase A.
Nature
382:
622-626,
1996[Medline].
8.
Enerback, S,
Jacobsson A,
Simpson EM,
Guerra C,
Yamashita H,
Harper ME,
and
Kozak LP.
Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese.
Nature
387:
90-94,
1997[Medline].
9.
Foster, DO,
and
Frydman ML.
Non-shivering thermogenesis in the rat. II. Measurements of blood flow with microspheres point to brown adipose tissue as the dominant site of calorigenesis induced by noradrenaline.
Can J Physiol Pharmacol
56:
110-122,
1978[Web of Science][Medline].
10.
Gong, DW,
He YF,
Karas M,
and
Reitman M.
Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone,
3-adrenergic agonists, and leptin.
J Biol Chem
272:
24129-24132,
1997
11.
Grujic, D,
Susulic VS,
Harper ME,
Himms-Hagen J,
Cunningham BA,
Corkey BE,
and
Lowell BB.
3-adrenergic receptors on white and brown adipocytes mediate
3-selective agonist-induced effects on energy expenditure, insulin secretion, and food intake
a study using transgenic and gene knockout mice.
J Biol Chem
272:
17686-17693,
1997
12.
Guerra, C,
Koza RA,
Yamashita H,
Walsh K,
and
Kozak LP.
Emergence of brown adipocytes in white fat in mice is under genetic control
effects on body weight and adiposity.
J Clin Invest
102:
412-420,
1998[Web of Science][Medline].
13.
Hamann, A,
Flier JS,
and
Lowell BB.
Decreased brown fat markedly enhances susceptibility to diet-induced obesity, diabetes, and hyperlipidemia.
Endocrinology
137:
21-29,
1996[Abstract].
14.
Haynes, WG,
Morgan DA,
Walsh SA,
Mark AL,
and
Sivitz WI.
Receptor-mediated regional sympathetic nerve activation by leptin.
J Clin Invest
100:
270-278,
1997[Web of Science][Medline].
15.
Himms-Hagen, J.
Regulation of metabolic processes in brown adipose tissue in relation to nonshivering thermogenesis.
Adv Enzyme Regul
8:
131-151,
1970[Medline].
16.
Hwa, JJ,
Fawzi AB,
Graziano MP,
Ghibaudi L,
Williams P,
Van Heek M,
Davis H,
Rudinski M,
Sybertz E,
and
Strader CD.
Leptin increases energy expenditure and selectively promotes fat metabolism in ob/ob mice.
Am J Physiol Regulatory Integrative Comp Physiol
272:
R1204-R1209,
1997
17.
Hwa, JJ,
Ghibaudi L,
Compton D,
Fawzi AB,
and
Strader CD.
Intracerebroventricular injection of leptin increases thermogenesis and mobilizes fat metabolism in ob/ob mice.
Horm Metab Res
28:
659-663,
1996[Web of Science][Medline].
18.
Kopecky, J,
Clarke G,
Enerback S,
Spiegelman B,
and
Kozak LP.
Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity.
J Clin Invest
96:
2914-2923,
1995.
19.
Kopecky, J,
Hodny Z,
Rossmeisl M,
Syrovy I,
and
Kozak LP.
Reduction of dietary obesity in aP2-UCP transgenic mice: physiology and adipose tissue distribution.
Am J Physiol Endocrinol Metab
270:
E768-E775,
1996
20.
Lowell, BB,
Susulic VS,
Hamann A,
Lawitts JA,
Himms-Hagen J,
Boyer BB,
Kozak LP,
and
Flier JS.
Development of obesity in transgenic mice after genetic ablation of brown adipose tissue.
Nature
366:
740-742,
1993[Medline].
21.
Matthias, A,
Ohlson KB,
Fredriksson JM,
Jacobsson A,
Nedergaard J,
and
Cannon B.
Thermogenic responses in brown-fat cells are fully UCP1-dependent: UCP2 or UCP3 cannot substitute for UCP1 in adrenergically or fatty acid-induced thermogenesis.
J Biol Chem
275:
25073-25081,
2000
22.
Mitchell, P,
and
Moyle J.
Chemiosmotic hypothesis of oxidative phosphorylation.
Nature
213:
137-139,
1967[Medline].
23.
Nagase, I,
Yoshida T,
Kumamoto K,
Umekawa T,
Sakane N,
Nikami H,
Kawada T,
and
Saito M.
Expression of uncoupling protein in skeletal muscle and white fat of obese mice treated with thermogenic
3-adrenergic agonist.
J Clin Invest
97:
2898-2904,
1996[Web of Science][Medline].
24.
Nicholls, D,
and
Locke R.
Thermogenic mechanisms in brown fat.
Physiol Rev
64:
1-64,
1984
25.
Rolfe, DF,
and
Brand MD.
Contribution of mitochondrial proton leak to skeletal muscle respiration and to standard metabolic rate.
Am J Physiol Cell Physiol
271:
C1380-C1389,
1996
26.
Rothwell, NJ,
Stock MJ,
and
Warwick BP.
The effect of high fat and high carbohydrate cafeteria diets on diet-induced thermogenesis in the rat.
Int J Obes
7:
263-270,
1983[Web of Science][Medline].
27.
Scarpace, PJ,
and
Matheny M.
Leptin induction of UCP1 gene expression is dependent on sympathetic innervation.
Am J Physiol Endocrinol Metab
275:
E259-E264,
1998
28.
Soloveva, V,
Graves RA,
Rasnick MM,
Spiegelman BM,
and
Ross SR.
Transgenic mice overexpressing the
1-adrenergic receptor in adipose tissue are resistant to obesity.
Mol Endocrinol
11:
27-38,
1997
29.
Stock, MJ.
Gluttony and thermogenesis revisited.
Int J Obes
23:
1105-1117,
1999[Web of Science][Medline].
30.
Surwit, RS,
Wang SY,
Petro AE,
Sanchis D,
Raimbault S,
Ricquier D,
and
Collins S.
Diet-induced changes in uncoupling proteins in obesity-prone and obesity-resistant strains of mice.
Proc Natl Acad Sci USA
95:
4061-4065,
1998
31.
Thomas, SA,
and
Palmiter RD.
Thermoregulatory and metabolic phenotypes of mice lacking noradrenaline and adrenaline.
Nature
387:
94-97,
1997[Medline].
32.
Watson, PM,
Commins SP,
Beiler RJ,
Hatcher HC,
and
Gettys TW.
Differential regulation of leptin expression and function in A/J vs. C57BL/6J mice during diet-induced obesity.
Am J Physiol Endocrinol Metab
279:
E356-E365,
2000
This article has been cited by other articles:
![]() |
P. B. Jakus, A. Sandor, T. Janaky, and V. Farkas Cooperation between BAT and WAT of rats in thermogenesis in response to cold, and the mechanism of glycogen accumulation in BAT during reacclimation J. Lipid Res., February 1, 2008; 49(2): 332 - 339. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fry, T. D. Hoyda, and A. V. Ferguson Making Sense of It: Roles of the Sensory Circumventricular Organs in Feeding and Regulation of Energy Homeostasis Exp Biol Med, January 1, 2007; 232(1): 14 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. CANNON and J. NEDERGAARD Brown Adipose Tissue: Function and Physiological Significance Physiol Rev, January 1, 2004; 84(1): 277 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Shabalina, C. Wiklund, T. Bengtsson, A. Jacobsson, B. Cannon, and J. Nedergaard Uncoupling protein-1: involvement in a novel pathway for beta -adrenergic, cAMP-mediated intestinal relaxation Am J Physiol Gastrointest Liver Physiol, November 1, 2002; 283(5): G1107 - G1116. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Prpic, P. M. Watson, I. C. Frampton, M. A. Sabol, G. E. Jezek, and T. W. Gettys Adaptive Changes in Adipocyte Gene Expression Differ in AKR/J and SWR/J Mice during Diet-Induced Obesity J. Nutr., November 1, 2002; 132(11): 3325 - 3332. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Argyropoulos and M.-E. Harper Molecular Biology of Thermoregulation: Invited Review: Uncoupling proteins and thermoregulation J Appl Physiol, May 1, 2002; 92(5): 2187 - 2198. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |