AJP - Endo Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 280: E372-E377, 2001;
0193-1849/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Commins, S. P.
Right arrow Articles by Gettys, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Commins, S. P.
Right arrow Articles by Gettys, T. W.
Vol. 280, Issue 2, E372-E377, February 2001

RAPID COMMUNICATION
Leptin selectively reduces white adipose tissue in mice via a UCP1-dependent mechanism in brown adipose tissue

Scott P. Commins1, Patricia M. Watson2, Isabell C. Frampton2, and Thomas W. Gettys1,2

Division of Gastroenterology and Hepatology, 1 Department of Medicine and 2 Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, South Carolina 29425


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We tested the hypothesis that leptin, in addition to reducing body fat by restraining food intake, reduces body fat through a peripheral mechanism requiring uncoupling protein 1 (UCP1). Leptin was administered to wild-type (WT) mice and mice with a targeted disruption of the UCP1 gene (UCP1 deficient), while vehicle-injected control animals of each genotype were pair-fed to each leptin-treated group. Leptin reduced the size of white adipose tissue (WAT) depots in WT mice but not in UCP1-deficient animals. This was accompanied by a threefold increase in the amount of UCP1 protein and mRNA in the brown adipose tissue (BAT) of WT mice. Leptin also increased UCP2 mRNA in WAT of both WT and UCP1-deficient mice but increased UCP2 and UCP3 mRNA only in BAT from UCP1-deficient mice. These results indicate that leptin reduces WAT through a peripheral mechanism requiring the presence of UCP1, with little or no involvement of UCP2 or UCP3.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

MITOCHONDRIAL OXIDATION of fatty acids creates a proton electrochemical gradient that is used to drive the conversion of ADP to ATP via ATP synthase (22). Brown adipose tissue (BAT) mitochondria possess an alternative pathway that allows protons to reenter the mitochondrial matrix without coupling to ATP synthesis (2), and this pathway is mediated by uncoupling protein 1 (UCP1). UCP1 transforms electrochemical energy into heat (24), enabling small mammals to tolerate cold exposure (9, 15). The sympathetic nervous system and UCP1 are essential components of this thermogenic response system (8, 31).

Recent work illustrates that thermogenesis is also induced by increased caloric intake, suggesting a potential role for BAT in maintaining energy balance during dietary challenges (26, 29). This concept was originally supported by the finding that mice with toxigene-mediated ablation of BAT were obese and more prone to morbid obesity when fed high-calorie diets (13, 20). In view of these findings and the established role of UCP1 in thermogenesis, it was surprising to find that mice with a targeted disruption of the Ucp1 gene (UCP1 deficient) were not obese and no more prone to obesity than control mice when fed high-fat diets (8). Some evidence suggested that compensatory thermogenic mechanisms may have been induced in these mice (8), so we sought to determine whether the absence of UCP1 would compromise the ability of leptin to target and reduce white adipose tissue depots. This approach is based on the hypothesis that leptin regulates in vivo rates of energy utilization through modulation of one or more of the uncoupling proteins. Using pair-fed wild-type (WT) and UCP1-deficient mice injected with vehicle or leptin, we show that UCP1 is required for leptin to decrease adipose tissue mass beyond the amount produced by its effect on food intake.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. All reagents, except where noted, were obtained from Sigma and were of the highest reagent grade. T1-RNase and TRIzol LS reagent were from Life Technologies (Gaithersburg, MD). The T7-Megashortscript and RNALater kits were purchased from Ambion (Austin, TX). alpha -[32P]CTP and 125I-labeled NaI were purchased from Du Pont-NEN Radiochemicals (Boston, MA). Immobilon-P polyvinylidene difluoride membranes were from Millipore (Bedford, MA). Recombinant methionyl mouse leptin was kindly provided by Amgen (Thousand Oaks, CA).

Experimental animal protocol. Breeding pairs of mice heterozygous (+/-) for a targeted disruption of the Ucp1 gene (8) were provided by Dr. Leslie Kozak (Pennington Biomedical Research Center, Baton Rouge, LA). The mice were bred within the vivarium at the Medical University of South Carolina to establish a free-standing colony of homozygous UCP1-deficient (-/-) and WT mice (+/+) to serve as controls. Genotyping of individual offspring was performed by PCR by use of primers designed to amplify the region of exon 2, where presence of the neomycin resistance gene identifies mutant mice (5' to 3'; exon 2 forward, ggtagtatgcaagagaggtgt, 5' to 3'; exon 2 reverse, cctaatggtactggaagcctg, 5' to 3'; neomycin reverse, cctacccgcttgcattgctca). Because of the temperature sensitivity of the mice, the colony was housed at 25-27°C. Mouse chow (Purina mouse chow, Ralston Purina, St. Louis, MO) and water were available ad libitum, and the lights were on a 12:12-h light-dark cycle.

Six-month-old male UCP1-deficient (-/-) and WT (+/+) mice were assigned to receive either leptin (20 µg · g body wt-1 · day-1) or vehicle (100 µl sterile saline) for 8 days. The mice receiving saline were pair fed (PF) to individual leptin-injected mice of the same genotype, and each pair of mice (vehicle- and leptin-treated) was selected to be age and weight matched. The mice were housed individually in cages with raised wire flooring to facilitate recovery of spilled food. For a period of 7 days before the study began, mice were monitored daily for food intake, food spillage, and body weight. For an additional period of 7 days, all mice were given intraperitoneal injections of vehicle 2 h before the start of the dark cycle to acclimate the animals to handling and injection. After the 7th day of saline injections and for 8 days thereafter, UCP1-deficient and WT mice received either leptin (20 µg · g body wt-1 · day-1) or vehicle (100 µl). All injections were given intraperitoneally and performed 2 h before the start of the dark cycle. Mice treated with leptin were provided with a preweighed amount of food known to be in excess of daily consumption. At the time of leptin injection the following day, spilled and remaining food was recovered and weighed, body weights were recorded, and preweighed food was again provided. Accounting for the amount of spilled food allowed vehicle-treated mice to be pair fed the actual amount of food consumed by the mouse receiving leptin with which it was paired. PF mice continued to receive a daily injection of saline at the time body weights and food intake were recorded. On the morning after the eighth leptin injection, UCP1-deficient and WT mice were killed. Interscapular BAT, as well as epididymal, retroperitoneal, and inguinal white adipose tissue (WAT) depots, were carefully dissected free of surrounding tissue, weighed, and processed for isolation of total RNA or preparation of mitochondria.

RNase protection assay. RNA probes complementary to UCP1, UCP2, and UCP3 mRNA were prepared, labeled, and used as previously described to quantitate the respective mRNA species (4, 6, 32).

Mitochondrial preparation and Western blotting of UCP1. Isolation and extraction of mitochondria, followed by Western blotting of UCP1 in mitochondrial extracts, were performed on contralateral brown fat pads, as we have described in detail previously (6).

Methods of analysis. The concentrations of UCP1, UCP2, UCP3, and leptin mRNA in each sample were determined by reverse calibration from standard curves as previously described (6). One-way ANOVA was used to compare the means of each response variable. The level of protection against type I errors was set at 5%. P values for specific treatment comparisons of interest are presented in RESULTS.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Effect of leptin on food intake, body weight, and WAT depot weights. Exogenous leptin caused a significant (P < 0.01) decrease in food intake from 4.04 ± 0.14 to 3.19 ± 0.11 g food · day-1 · g body wt-1 in WT mice and a decrease from 4.00 ± 0.09 to 3.39 ± 0.09 g food · day-1 · g body wt-1 in UCP1-deficient mice. Total food consumption in the respective PF groups [WT, 24.2 ± 2.3 g; UCP1-deficient "knockout" (KO), 24.2 ± 2.7 g] was essentially identical to the leptin-injected groups (WT, 25.5 ± 1.9 g; UCP1-deficient KO, 27.2 ± 2.1 g), as intended. The initial body weights of WT (28.2 ± 3.6 g) and UCP1-deficient mice (27.7 ± 3.1 g) were similar, and comparable reductions in food consumption among the groups produced corresponding weight reductions in WT (vehicle-PF, 25.3 ± 3.4 g; leptin, 26.6 ± 2.7 g) and UCP1-deficient mice (vehicle-PF, 23.6 ± 2.4 g; leptin, 26.8 ± 3.4 g). These data provided no evidence that leptin induced weight loss in excess of that observed in the PF mice. Fat pad weights from age- and weight-matched mice of each genotype killed before the study were similar (data not shown). To assess the importance of UCP1 to leptin's effects on fat pad size independent of leptin's effects on food intake, the change in weight of the three WAT depots produced by leptin was expressed relative to that of the PF controls for each genotype. Figure 1 illustrates that leptin induced a significant decrease (P < 0.01) in size of all three depots examined in WT mice. In contrast, Fig. 1 shows that the same fat pads were unaffected by leptin in the UCP1-deficient mice. The lack of a change in white fat pad weights from UCP1-deficient mice indicates that the effectiveness of leptin in reducing adiposity is compromised in the absence of UCP1.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Differences in white adipose tissue (WAT) weight from pair-fed (PF) and leptin-treated wild-type (WT) and uncoupling protein 1 (UCP1)-deficient knockout (KO) mice. Differences were plotted for epididymal (A), retroperitoneal (B), and inguinal (C) WAT depots. Differences were calculated by subtracting the weight of the WAT depot of the PF animal from that of the leptin-treated counterpart. Differences and SEs are means from 3 sets (leptin and PF) of WT and 4 sets of UCP1-deficient mice. *P < 0.05, different from UCP1-deficient mice.

UCP1 expression in BAT and WAT. UCP1 expression was examined in BAT mitochondrial extracts from each group to confirm that leptin increased UCP1 protein levels in WT mice and to establish that UCP1 was not expressed in mice identified as UCP1 knockouts. Results presented in Fig. 2 demonstrate that UCP1 is absent in mitochondrial extracts from mice identified as UCP1 deficient. Figure 2 also shows that leptin induced a significant threefold increase in UCP1 expression in BAT from WT mice (P < 0.01). Measurements of UCP1 mRNA in the contralateral brown fat pads from each animal revealed that leptin increased UCP1 mRNA by an amount (4-fold) that was comparable to the increase in protein expression noted above (data not shown).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2.   Western blot of UCP1 expression in mitochondrial extracts from brown adipose tissue (BAT) of WT and UCP1-deficient PF and leptin-injected mice. Mitochondrial extracts were prepared as described in MATERIALS AND METHODS. Lane 1: UCP1-deficient PF mice; lanes 2 and 3: UCP1-deficient leptin-injected mice; lane 4: WT PF mice; lanes 5 and 6: WT leptin-injected mice. Solubilized protein (5 µg) was subjected to Western blotting with an affinity-purified UCP1 antibody raised against a peptide corresponding to AA 145-159 of mouse UCP1. Detected proteins were visualized with 125I-labeled goat anti-rabbit IgG, and autoradiograms were scanned by laser densitometry. The autoradiogram is representative of 2 experiments.

Several reports have demonstrated that UCP1 expression can be induced in WAT from certain mouse strains under conditions that mimic chronic sympathetic stimulation (3, 6, 10, 23). Because leptin reduced the mass of all WAT depots examined, we attempted to measure UCP1 mRNA in each site to test whether leptin induced UCP1 expression as a mechanism to increase fatty acid oxidation within these sites. Using both in situ hybridization, to detect discrete groups of cells within depots that might be expressing UCP1, and a sensitive RNase protection assay to screen total RNA preparations, we concluded that UCP1 mRNA levels were below the detection limits of both assays (data not shown). We also found no evidence that leptin increased UCP1 mRNA to detectable levels in these sites (data not shown).

Effect of leptin on UCP2 and UCP3 mRNA in BAT. The initial description of UCP1-deficient mice (8) indicated that UCP2 mRNA was upregulated in BAT. We wanted to quantitate the reported difference in UCP2 mRNA between the genotypes and test for differences in the responses of UCP2 and UCP3 to leptin between the groups. Figure 3A shows that UCP2 mRNA was significantly higher (P < 0.01) in PF UCP1-deficient mice (0.125 ± 0.011 fmol/µg RNA) than in their PF WT controls (0.057 ± 0.002 fmol/µg RNA). Leptin had no effect on UCP2 mRNA in WT mice (0.051 ± 0.006 fmol/µg RNA) but produced a significant (P < 0.01) twofold increase in UCP2 mRNA to 0.246 ± 0.042 fmol/µg RNA in UCP1-deficient mice (Fig. 3A). A similar pattern was seen with UCP3 in BAT, with the notable exception that UCP3 mRNA levels were similar between PF WT (0.109 ± 0.017 fmol mRNA/µg RNA) and PF UCP1-deficient mice (0.135 ± 0.013 fmol mRNA/µg RNA). As with UCP2, leptin failed to increase UCP3 in WT mice but produced a twofold increase in UCP3 mRNA in BAT from UCP1-deficient mice (0.217 ± 0.032 fmol/µg RNA, P < 0.01). These results establish that UCP2 and UCP3 mRNA levels are significantly higher in BAT from UCP1-deficient than from WT mice after leptin treatment, and they suggest that the altered regulation of UCP2 and UCP3 may be a mechanism to compensate for the absence of UCP1.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 3.   RNase protection assay of UCP2 and UCP3 mRNA from BAT (A) and epididymal WAT (EWAT, B) of WT and UCP1-deficient mice. Mice of each genotype were injected ip for 8 days with either vehicle or leptin (L), and the vehicle-injected mice were pair-fed to the leptin group as described in MATERIALS AND METHODS. Total RNA (5 µg) from BAT or EWAT was hybridized with antisense probes for UCP2 (nucleotides 741-884) and UCP3 (nucleotides 219-467) and 18S rRNA (nucleotides 715-794). The relative abundance of UCP2 and UCP3 mRNAs was quantitated by comparing the densitometric intensities of protected fragments from each treatment group to known amounts of sense strand transcripts that were hybridized simultaneously. Individual RNA samples from each animal were analyzed to calculate group means, and representative samples are presented in each figure panel.

Effect of leptin on UCP2 and UCP3 mRNA in epididymal WAT The original work with UCP1-deficient mice failed to detect an upregulation of UCP2 mRNA in WAT (8). However, on the basis of the specific effects of leptin on WAT, we tested the idea that differences in the upregulation of UCP2 by leptin might explain leptin's differential effects on adiposity between the groups. As predicted, UCP2 mRNA levels in epididymal WAT (EWAT) did not differ between PF mice of each genotype (WT, 0.033 ± 0.005 fmol/µg RNA; UCP1 deficient, 0.036 ± 0.004 fmol/µg RNA, Fig. 3B). The responses to leptin were similar in that leptin produced a significant (P < 0.01) increase in UCP2 mRNA in both WT (0.062 ± 0.007 fmol/µg RNA) and UCP1-deficient mice (0.051 ± 0.005 fmol/µg RNA). The levels of UCP3 mRNA in EWAT were similar between control animals in each genotype and were unaffected by leptin treatment (Fig. 3B). Thus differences in the induction of UCP2 or UCP3 by leptin are not likely to be responsible for the differential effects of leptin on adiposity between the genotypes.

Skeletal muscle is also a significant site for UCP3 expression, so we compared UCP3 mRNA levels in skeletal muscle of control and leptin-treated animals of each genotype. As in other tissues, the aim was to test whether compensatory upregulation of UCP3 could account for differences in adiposity among the treatment groups. Figure 4 indicates that UCP3 mRNA levels did not differ between WT and UCP1-deficient mice. In addition, leptin treatment had no discernible effect on UCP3 mRNA in either group (Fig. 4). Taken together, these results indicate that group differences in basal or stimulated levels of UCP2 and/or UCP3 mRNA cannot account for the differential reductions in WAT size produced by leptin between the genotypes. And although the absence of UCP1 had no apparent effect on WAT size in control animals, its absence blocked the specific reduction in WAT mass that was produced by leptin in WT mice.


View larger version (89K):
[in this window]
[in a new window]
 
Fig. 4.   RNase protection assay of UCP3 mRNA in skeletal muscle of WT and UCP1-deficient mice. Mice of each genotype were injected ip for 8 days with either vehicle or leptin, and the vehicle-injected mice were pair-fed to the leptin group as described in MATERIALS AND METHODS. Total RNA (5 µg) from gastrocnemius muscle was hybridized with antisense probes for UCP3 (nucleotides 219-467) and 18S rRNA (nucleotides 715-794). The relative abundance of UCP3 mRNAs was quantitated by comparing the densitometric intensities of protected fragments from each treatment group to known amounts of sense strand transcripts that were hybridized simultaneously. Individual RNA samples from each animal were analyzed to calculate group means, and representative samples are presented.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The sole known function of uncoupling proteins is to transform energy contained in the mitochondrial proton electrochemical gradient into heat (24). The metabolic consequence of this thermogenic process is decreased coupling efficiency between fatty acid oxidation and ATP formation. Given that the leak of protons across the inner mitochondrial membrane has been estimated to account for between 15 and 35% of basal metabolic rate (1, 25), modulation of UCP expression and/or function has the potential to have major effects on energy balance and fat deposition. Various approaches have been used to test this concept, including a recent study showing that overexpression of UCP1 from the aP2 gene promoter reduced genetically determined obesity in mice and conferred resistance to diet-induced obesity (18, 19). In another approach, targeted disruption of the RIIbeta -subunit of protein kinase A (PKA) led to upregulation of the more readily activated RIalpha -isoform in adipose tissue (7). The increased sensitivity of the RIalpha isoform to cAMP induced ectopic UCP1 expression in WAT, decreased WAT mass, and prevented diet-induced obesity (7). Overexpression of the beta 1-adrenoceptor in adipose tissue produced a similar upregulation of UCP1 expression and resistance to obesity (28). The findings from these studies show that direct overexpression of UCP1 or enhancement of adrenergic stimulation of adipose tissue produces a common lean, obesity-resistant phenotype. Based on the well established observation that leptin induces UCP1 expression, the major goal of the present study was to determine whether UCP1 is an essential component of the mechanism used by leptin to reduce WAT stores. Findings from the present study confirm the requirement for UCP1 and provide no evidence to support the involvement of UCP2 and/or UCP3 in the response.

Peripheral or central administration of leptin regulates gene expression in adipose tissue through modulation of sympathetic tone and activation of beta -adrenoceptors (5, 6, 32). The respiratory quotient is also decreased by leptin (16, 17), and the associated increases in fat oxidation, oxygen consumption, and release of free fatty acids indicate that these responses are coordinated elements of the mechanism used to decrease adipose tissue stores. Although not detected in the present study, previous work has shown that UCP1 expression can be induced in specific WAT depot sites by leptin or other physiological cues that activate the sympathetic nervous system (6, 12). The heritability of this characteristic was documented by study of recombinant inbred strains of mice produced from backcrossing two strains with low and high expression of the trait (12). The UCP1-deficient mice used here were developed on the B/6 background, which has low potential for expression of UCP1 in WAT (8, 12). The already low expression of UCP1 in this mouse strain was likely compounded by the slightly older mice and higher housing temperature used in the present study (27°C). On the basis of results from mice reared at 22-23°C, we suggested previously that increased expression of UCP1 in WAT from responsive strains might allow significant in situ fat oxidation to occur in response to leptin (6). However, the absence of leptin-induced UCP1 expression in WAT from control mice here, coupled with the uniform decreases in size among the WAT depots, supports a different mechanism. It seems more likely that the leptin-mediated increase in fat oxidation documented by Hwa and colleagues (16, 17) could be occurring in BAT or muscle after mobilization and transfer of fatty acids from WAT. However, despite the potential significance of skeletal muscle as a site for lipid oxidation, the present results imply that BAT is the primary metabolic sink for mobilized lipid.

The concept that thermogenesis requires the participation of both BAT and WAT is supported by Grujic et al. (11), who showed that transgenic reexpression of beta 3-adrenoceptors in both BAT and WAT was required to restore a full thermogenic response in beta 3-KO mice. Taken together, these findings indicate that WAT is targeted by leptin by virtue of its role as a fuel source for the thermogenic process.

UCP1-deficient mice are cold intolerant but do not develop obesity when provided either standard mouse chow or a highly palatable diet (8). This finding and a similar one in dopamine beta -hydroxylase-deficient mice (31) suggest that the absence of UCP1 can be compensated for by alternative thermogenic components. UCP2 and UCP3 are likely candidates given their broad tissue distribution, and it is interesting to note that UCP2 mRNA was upregulated in BAT from both studies (8, 31). We also found increased UCP2 mRNA in BAT from UCP1-deficient mice, but our comparisons of UCP3 mRNA in BAT and skeletal muscle found no difference between control and transgenic mice. Resistance to diet-induced obesity has been associated with upregulation of UCP2 in WAT (30, 32), but it remains to be established whether UCP2 is responsible for the leanness of UCP1-deficient mice.

In the present experiments, the important questions are whether leptin differentially affects UCP2 and/or UCP3 expression between control and transgenic animals and whether UCP2 and/or UCP3 can actually serve as uncouplers. In WAT, we found similar initial levels and a similar twofold induction of UCP2 mRNA in both groups. The responses in BAT were different in the sense that UCP1-deficient mice increased both UCP2 and UCP3 mRNA in response to leptin, whereas leptin did not affect either variable in the control mice. Therefore, if UCP2 and UCP3 were contributing to increased fat oxidation, leptin should be effective in reducing fat pad weights in the UCP1-deficient mice. Our results indicate that group differences in neither basal nor stimulated levels of UCP2 and/or UCP3 mRNA can account for the differential reductions in WAT size produced by leptin between the genotypes. An additional perspective on this issue is provided by the recent work of Matthias et al. (21) who showed that UCP1, but not UCP2 and UCP3, was the only uncoupling protein able to convey a thermogenic response to adrenergic stimulation in BAT. On the basis of the documented involvement of the sympathetic nervous system in mediating effects of leptin in BAT (4, 14, 27), the conclusion of Matthias et al. is consistent with our conclusion that UCP1 is required for leptin action. And although the absence of UCP1 had no apparent effect on WAT size in vehicle-treated mice, its absence blocked the specific reduction in WAT mass that was produced by leptin in WT mice. Taken together, our findings support the hypothesis that leptin stimulates energy utilization and fat oxidation by acutely activating thermogenesis and enhancing thermogenic capacity through increased UCP1 expression.


    ACKNOWLEDGEMENTS

We gratefully acknowledge the excellent technical assistance of Rudy Beiler. We thank Dr. Leslie Kozak for kindly providing the mice used in this study, and Amgen for providing the recombinant mouse leptin.


    FOOTNOTES

This research was supported by National Institutes of Health Grants DK-53981 (to T. W. Gettys) and training Grant GM-08716 (to S. P. Commins) and US Department of Agriculture NRICGP Grant 9800699 (to T. W. Gettys).

Address for reprint requests and other correspondence: T. W. Gettys, 916-G Clinical Science Bldg., MUSC, 96 Jonathan Lucas St., Charleston, SC 29425 (E-mail: gettystw{at}musc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 29 September 2000; accepted in final form 16 October 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Brand, MD, Brindle KM, Buckingham JA, Harper JA, Rolfe DFS, and Stuart JA. The significance and mechanism of mitochondrial proton conductance. Int J Obes 23: S4-S11, 1999.

2.   Cannon, B, and Lindberg O. Mitochondria from brown adipose tissue: isolation and properties. Methods Enzymol 55: 65-78, 1979[Medline].

3.   Collins, S, Daniel KW, Petro AE, and Surwit RS. Strain-specific response to beta 3-adrenergic receptor agonist treatment of diet-induced obesity in mice. Endocrinology 138: 405-413, 1997[Abstract/Free Full Text].

4.   Commins, SP, Marsh DJ, Thomas SA, Watson PM, Padgett MA, Palmiter RD, and Gettys TW. Norepinephrine is required for leptin effects on gene expression in brown and white adipose tissue. Endocrinology 140: 4772-4776, 1999[Abstract/Free Full Text].

5.  Commins SP, Watson PM, Levin N, Beiler RJ, and Gettys TW. Central leptin regulates the UCP1 and ob genes in brown and white adipose tissue via different beta -adrenoceptor subtypes. J Biol Chem In press.

6.   Commins, SP, Watson PM, Padgett MA, Dudley A, Argyropoulos G, and Gettys TW. Induction of uncoupling protein expression in brown and white adipose tissue by leptin. Endocrinology 140: 292-300, 1999[Abstract/Free Full Text].

7.   Cummings, DE, Brandon EP, Planas JV, Motamed K, Idzerda R, and McKnight GS. Genetically lean mice result from targeted disruption of the RIIbeta subunit of protein kinase A. Nature 382: 622-626, 1996[Medline].

8.   Enerback, S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME, and Kozak LP. Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387: 90-94, 1997[Medline].

9.   Foster, DO, and Frydman ML. Non-shivering thermogenesis in the rat. II. Measurements of blood flow with microspheres point to brown adipose tissue as the dominant site of calorigenesis induced by noradrenaline. Can J Physiol Pharmacol 56: 110-122, 1978[Web of Science][Medline].

10.   Gong, DW, He YF, Karas M, and Reitman M. Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, beta 3-adrenergic agonists, and leptin. J Biol Chem 272: 24129-24132, 1997[Abstract/Free Full Text].

11.   Grujic, D, Susulic VS, Harper ME, Himms-Hagen J, Cunningham BA, Corkey BE, and Lowell BB. beta 3-adrenergic receptors on white and brown adipocytes mediate beta 3-selective agonist-induced effects on energy expenditure, insulin secretion, and food intake---a study using transgenic and gene knockout mice. J Biol Chem 272: 17686-17693, 1997[Abstract/Free Full Text].

12.   Guerra, C, Koza RA, Yamashita H, Walsh K, and Kozak LP. Emergence of brown adipocytes in white fat in mice is under genetic control---effects on body weight and adiposity. J Clin Invest 102: 412-420, 1998[Web of Science][Medline].

13.   Hamann, A, Flier JS, and Lowell BB. Decreased brown fat markedly enhances susceptibility to diet-induced obesity, diabetes, and hyperlipidemia. Endocrinology 137: 21-29, 1996[Abstract].

14.   Haynes, WG, Morgan DA, Walsh SA, Mark AL, and Sivitz WI. Receptor-mediated regional sympathetic nerve activation by leptin. J Clin Invest 100: 270-278, 1997[Web of Science][Medline].

15.   Himms-Hagen, J. Regulation of metabolic processes in brown adipose tissue in relation to nonshivering thermogenesis. Adv Enzyme Regul 8: 131-151, 1970[Medline].

16.   Hwa, JJ, Fawzi AB, Graziano MP, Ghibaudi L, Williams P, Van Heek M, Davis H, Rudinski M, Sybertz E, and Strader CD. Leptin increases energy expenditure and selectively promotes fat metabolism in ob/ob mice. Am J Physiol Regulatory Integrative Comp Physiol 272: R1204-R1209, 1997[Abstract/Free Full Text].

17.   Hwa, JJ, Ghibaudi L, Compton D, Fawzi AB, and Strader CD. Intracerebroventricular injection of leptin increases thermogenesis and mobilizes fat metabolism in ob/ob mice. Horm Metab Res 28: 659-663, 1996[Web of Science][Medline].

18.   Kopecky, J, Clarke G, Enerback S, Spiegelman B, and Kozak LP. Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity. J Clin Invest 96: 2914-2923, 1995.

19.   Kopecky, J, Hodny Z, Rossmeisl M, Syrovy I, and Kozak LP. Reduction of dietary obesity in aP2-UCP transgenic mice: physiology and adipose tissue distribution. Am J Physiol Endocrinol Metab 270: E768-E775, 1996[Abstract/Free Full Text].

20.   Lowell, BB, Susulic VS, Hamann A, Lawitts JA, Himms-Hagen J, Boyer BB, Kozak LP, and Flier JS. Development of obesity in transgenic mice after genetic ablation of brown adipose tissue. Nature 366: 740-742, 1993[Medline].

21.   Matthias, A, Ohlson KB, Fredriksson JM, Jacobsson A, Nedergaard J, and Cannon B. Thermogenic responses in brown-fat cells are fully UCP1-dependent: UCP2 or UCP3 cannot substitute for UCP1 in adrenergically or fatty acid-induced thermogenesis. J Biol Chem 275: 25073-25081, 2000[Abstract/Free Full Text].

22.   Mitchell, P, and Moyle J. Chemiosmotic hypothesis of oxidative phosphorylation. Nature 213: 137-139, 1967[Medline].

23.   Nagase, I, Yoshida T, Kumamoto K, Umekawa T, Sakane N, Nikami H, Kawada T, and Saito M. Expression of uncoupling protein in skeletal muscle and white fat of obese mice treated with thermogenic beta 3-adrenergic agonist. J Clin Invest 97: 2898-2904, 1996[Web of Science][Medline].

24.   Nicholls, D, and Locke R. Thermogenic mechanisms in brown fat. Physiol Rev 64: 1-64, 1984[Free Full Text].

25.   Rolfe, DF, and Brand MD. Contribution of mitochondrial proton leak to skeletal muscle respiration and to standard metabolic rate. Am J Physiol Cell Physiol 271: C1380-C1389, 1996[Abstract/Free Full Text].

26.   Rothwell, NJ, Stock MJ, and Warwick BP. The effect of high fat and high carbohydrate cafeteria diets on diet-induced thermogenesis in the rat. Int J Obes 7: 263-270, 1983[Web of Science][Medline].

27.   Scarpace, PJ, and Matheny M. Leptin induction of UCP1 gene expression is dependent on sympathetic innervation. Am J Physiol Endocrinol Metab 275: E259-E264, 1998[Abstract/Free Full Text].

28.   Soloveva, V, Graves RA, Rasnick MM, Spiegelman BM, and Ross SR. Transgenic mice overexpressing the beta 1-adrenergic receptor in adipose tissue are resistant to obesity. Mol Endocrinol 11: 27-38, 1997[Abstract/Free Full Text].

29.   Stock, MJ. Gluttony and thermogenesis revisited. Int J Obes 23: 1105-1117, 1999[Web of Science][Medline].

30.   Surwit, RS, Wang SY, Petro AE, Sanchis D, Raimbault S, Ricquier D, and Collins S. Diet-induced changes in uncoupling proteins in obesity-prone and obesity-resistant strains of mice. Proc Natl Acad Sci USA 95: 4061-4065, 1998[Abstract/Free Full Text].

31.   Thomas, SA, and Palmiter RD. Thermoregulatory and metabolic phenotypes of mice lacking noradrenaline and adrenaline. Nature 387: 94-97, 1997[Medline].

32.   Watson, PM, Commins SP, Beiler RJ, Hatcher HC, and Gettys TW. Differential regulation of leptin expression and function in A/J vs. C57BL/6J mice during diet-induced obesity. Am J Physiol Endocrinol Metab 279: E356-E365, 2000[Abstract/Free Full Text].


Am J Physiol Endocrinol Metab 280(2):E372-E377
0193-1849/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
J. Lipid Res.Home page
P. B. Jakus, A. Sandor, T. Janaky, and V. Farkas
Cooperation between BAT and WAT of rats in thermogenesis in response to cold, and the mechanism of glycogen accumulation in BAT during reacclimation
J. Lipid Res., February 1, 2008; 49(2): 332 - 339.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
M. Fry, T. D. Hoyda, and A. V. Ferguson
Making Sense of It: Roles of the Sensory Circumventricular Organs in Feeding and Regulation of Energy Homeostasis
Experimental Biology and Medicine, January 1, 2007; 232(1): 14 - 26.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. CANNON and J. NEDERGAARD
Brown Adipose Tissue: Function and Physiological Significance
Physiol Rev, January 1, 2004; 84(1): 277 - 359.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
I. Shabalina, C. Wiklund, T. Bengtsson, A. Jacobsson, B. Cannon, and J. Nedergaard
Uncoupling protein-1: involvement in a novel pathway for beta -adrenergic, cAMP-mediated intestinal relaxation
Am J Physiol Gastrointest Liver Physiol, November 1, 2002; 283(5): G1107 - G1116.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
V. Prpic, P. M. Watson, I. C. Frampton, M. A. Sabol, G. E. Jezek, and T. W. Gettys
Adaptive Changes in Adipocyte Gene Expression Differ in AKR/J and SWR/J Mice during Diet-Induced Obesity
J. Nutr., November 1, 2002; 132(11): 3325 - 3332.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
G. Argyropoulos and M.-E. Harper
Molecular Biology of Thermoregulation: Invited Review: Uncoupling proteins and thermoregulation
J Appl Physiol, May 1, 2002; 92(5): 2187 - 2198.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Commins, S. P.
Right arrow Articles by Gettys, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Commins, S. P.
Right arrow Articles by Gettys, T. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online